Previous Article | Next Article 
Journal of Clinical Microbiology, November 2001, p. 4196-4199, Vol. 39, No. 11
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.1.4196-4199.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Identification of Isolates of Streptococcus canis
Infecting Humans
Adrian M.
Whatmore,1,*
Kathryn H.
Engler,2
Gudny
Gudmundsdottir,1 and
Androulla
Efstratiou2
Infectious Disease Research Group, Dept. of
Biological Sciences, University of Warwick, Coventry CV4
7AL,1 and Respiratory and Systemic
Infection Laboratory, Central Public Health Laboratory, London NW9
5HT,2 United Kingdom
Received 17 April 2001/Returned for modification 20 August
2001/Accepted 4 September 2001
 |
ABSTRACT |
During a survey of Group G and C streptococcal infections of humans
two epidemiologically unrelated Group G streptococcal isolates were
identified, one from a case of bacteremia and one from a wound
infection. These isolates were atypical among this sample in that the
emm gene could not be amplified from them by PCR.
Biochemical characterization identified the isolates as
Streptococcus canis, an organism normally associated
with animal hosts. The biochemical identification was confirmed by
sequencing of the 16S rRNA gene from both isolates and comparison with
sequences of the S. canis type strain and other related
streptococci of animals and humans. Comparative sequencing of fragments
of two other housekeeping genes, sodA and
mutS, confirmed that the isolates are most closely
related to S. canis. The identification of two isolates
of S. canis from a relatively small sample set suggests that the practice of identifying streptococci only by the Lancefield serological group may result in underestimation of the presence of
S. canis in the human population.
 |
TEXT |
Streptococcus canis is a
species originally proposed in 1986 (3) for streptococci
isolated from dogs and cows possessing the Lancefield Group G antigen.
The species has since been isolated from a variety of other animals
including cats, rats, mink, mice, rabbits, and foxes. Studies of human
and animal Group G streptococci (GGS) based on whole-cell protein
profiles (13) and multilocus enzyme electrophoresis
(14) have confirmed that S. canis forms a clear
taxonomic group within the pyogenic streptococci. The species appears
distinct from the most closely related species that include other
pyogenic streptococci associated with humans and animals. These include
Streptococcus dysgalactiae subsp. equisimilis, normally associated with humans and which can belong to GGS or Group C
streptococci (GCS); the animal-associated GCS Streptococcus dysgalactiae subsp. dysgalactiae; and the major
pathogen of humans, the Group A streptococcus (GAS) Streptococcus
pyogenes. Although S. canis isolates may often
represent commensal flora of the canine skin and mucosa, they have been
implicated in a variety of canine diseases associated with urinary
tract infections, abortion, vaginitis, metritis, mastitis, and skin
infections. In addition, severe invasive S. canis infections
in dogs, analogous to human streptococcal toxic shock syndrome and
necrotizing fasciitis associated predominantly with GAS, have been
reported (4, 9).
S. canis infection of humans is thought to be rare. The
single reliably confirmed report concerns a case of septicemia in a
77-year-old man where the portal of entry was thought to be leg ulcers
(2). Two other possible reports, concerning a case of
meningitis (7) and a case of peritonitis (8),
have been considered unconfirmed due to incomplete or contradictory
data (2). However, it remains possible that human
infections associated with this organism may be underestimated as
routine identification of
-hemolytic streptococci is generally based
only on Lancefield serological grouping, which is not species specific
in the case of GGS. In addition it remains possible that colonization
with S. canis may be essentially unrecognized if there are
rarely clinical implications for the host.
As part of a study examining over 200 isolates of GGS and GCS
associated with human infection, two epidemiologically unrelated isolates, CG5 and CG40, were obtained. They were unusual in that the
emm gene, encoding the M protein, could not be amplified
from them by PCR using primers 1 and 2 described previously
(16) and purified chromosomal DNA isolated as described
previously (15). These primers are routinely used in the
emm typing of GAS (1) and in this survey of
some 200 isolates of human GGS and GCS were found to successfully
amplify emm from all confirmed isolates of S. dysgalactiae subsp. equisimilis examined (data not
shown). Isolate CG5 was obtained in pure culture from two separate
blood specimens taken from a 76-year-old male leukemia patient in
Burton-upon-Trent, United Kingdom. The isolate was identified as a
Group G
-hemolytic streptococcus and was sensitive to penicillin,
ampicillin, and erythromycin. Isolate CG40 was obtained from a wound
swab on the ear of 50-year-old female in Newcastle-upon-Tyne, United
Kingdom, from which a scanty growth of hemolytic GGS was isolated along
with heavy Staphylococcus aureus growth. The isolate was
sensitive to penicillin, flucloxacillin, erythromycin, trimethoprim,
chloramphenicol, and amoxicillin but resistant to gentamicin. The
extent and nature of any domestic animal contact of these two patients
are unknown.
As a result of the inability to amplify emm, isolates CG5
and CG40 were subjected to identification on the basis of their biochemical characteristics using API Rapid ID32 Strep System strips.
Both of the isolates were identified as S. canis
(identification, 99.9%). A number of biochemical characteristics are
known to be useful in differentiating human GGS (S. dysgalactiae subsp. equisimilis) and animal GGS
(S. canis), as illustrated in Table
1 (2, 3, 5, 6). The most
informative discriminatory tests are recognized to be the production of
-galactosidase and
-galactosidase and the production of acid from
trehalose. All these biochemical tests were consistent with
identification of the two isolates as S. canis.
In order to confirm the identities of these isolates on the basis of
genetic data the 16S rRNA gene was amplified from CG5 and CG40 using
primers 16Sup (5' AGAGTTTGATCCTGGCTC 3') and 16Sdown (5' CACCTTAGGCGGCTGGCT 3'). The sequence corresponding to
the vast majority of the 16S rRNA gene (1,322 bp) was obtained from CG5, CG40, and the S. canis type strain NCTC12191 using a
series of internal primers and the Beckman CEQ200 sequencing system. These sequences were compared with the corresponding extant sequences in GenBank from the S. pyogenes, S. dysgalactiae
subsp. dysgalactiae, and S. dysgalactiae subsp.
equisimilis type strains. As illustrated in Fig.
1a, showing an alignment of variable
sites relative to the S. canis sequence and the
corresponding phylogenetic tree (Fig. 2a)
constructed using the MEGA package, and in agreement with the
phenotypic identification, both isolates are closely related to
S. canis. Sequences of species representing other human and
animal pyogenic GCS and GGS and those of GAS are clearly
distinct.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 1.
Analysis of polymorphic sites in housekeeping genes of
CG5 and CG40 and other closely related streptococci relative to the
S. canis type strain sequences. Sites identical to those
seen in S. canis are indicated by dots, while alignment
gaps are indicated by dashes. Sequences of fragments of the 16S rRNA
gene (A), sodA (B), and mutS (C) are
shown. Superscript numbers indicate accession numbers as follows: 1, AB002521; 2, AB002485; 3, AB008926; 4, Z99175; 5, Z95915; 6, Z95900.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 2.
Phylogenetic trees corresponding to the sequence data
shown in Fig. 1: 16S rRNA gene (A); sodA (B);
mutS (C). Analysis was performed using the MEGA package,
and trees were constructed using the neighbor-joining method with the
Jukes-Cantor correction. The percent bootstrap confidence levels of
internal branches were calculated from 500 resamplings of the original
sequence data.
|
|
Two further housekeeping genes were examined in order to confirm the
genetic backgrounds of the isolates. First, sodA, encoding superoxide dismutase, was chosen because sequences of this gene have
been published from some of the type strains used in the 16S rRNA gene
analysis described above (10). The sodA gene
was amplified using primers d1 and d2 described previously
(10), and 384 bp of sequence, corresponding to bases 37 to
420 of the S. canis database sequence (Z99175), was
obtained. A comparison of the variable sites, as shown in Fig. 1b,
demonstrates that CG5 and CG40 share identical sequence with the
S. canis type strain but are divergent from the S. pyogenes and S. dysgalactiae subsp. dysgalactiae sequences (no sodA sequence from
S. dysgalactiae subsp. equisimilis is available).
Analysis of a second housekeeping gene, mutS, encoding DNA
mismatch repair protein, carried out by amplifying this gene using
primers mutSextup (5' CGTTATGGAACAGCAGAATT 3') and mutSextdn
(5' GCCATACCATCATAAGTTGC 3') confirmed that the CG5 and CG40
sequences, though not identical to the S. canis sequence,
are far more closely related to S. canis than to the other
species examined (Fig. 1c and 2c). Thus, analysis of two genes distinct
from the 16S rRNA gene confirms that the genetic background of CG5 and
CG40 most closely resembles that of S. canis.
Both phenotypic and genotypic analyses described above confirm the
presence of S. canis in human infections. The isolates described in this report were initially identified on the basis of the
inability to amplify an emm gene product by PCR. The
question of the presence of the emm gene-encoded M protein
in S. canis has been the subject of some controversy. In
agreement with our findings, a number of studies have suggested that
isolates of S. canis do not possess M protein on the basis
of lack of hybridization with emm probes (9, 11,
12). However, other studies have shown hybridization with M
protein probes (4), although the presence of motifs
conserved among many gram-positive surface proteins means that such
experiments need to be interpreted with caution. If some isolates of
S. canis do possess the M protein-encoding gene, they would
not have been identified in this study and in this case there could
have been other isolates of S. canis among the 200 examined.
Based on our findings, it seems likely that S. canis
colonization of humans may be more common than is currently recognized
and that the practice of simply applying Lancefield grouping procedures
to identify streptococci may be masking the occurrence of this organism
in the population. Clearly the two organisms, isolated at least 150 miles apart, are not epidemiologically related, and sequence diversity
within both the 16S rRNA and mutS sequences confirms that
they do not represent members of a clone. Determining whether there are
particular isolates of S. canis which preferentially infect
humans, rather than animals, or whether these isolates represent
occasional reverse zoonoses requires a much more detailed molecular
epidemiological analysis. The pathogenic potential of S. canis in humans remains unclear. One of our isolates was obtained
from a wound swab in which bacterial numbers suggested that S. aureus was the primary pathogenic species, with S. canis most likely representing a secondary invading species.
However, the second isolate, obtained in pure culture from blood,
represents a second confirmed report of invasive S. canis
infection of humans (2). Clearly, clinical microbiology
laboratories should be aware of the possibility of S. canis
infection, particularly when dealing with elderly or immunocompromised
patients in contact with domestic animals.
Nucleotide sequence accession numbers.
All novel
sequences described in this study have been deposited in the EMBL
database and assigned accession numbers as follows: S. canis
NCTC12191 16S rRNA gene, AJ413203; CG5 16S rRNA gene, AJ413204; CG40
16S rRNA gene, AJ413205; CG5 sodA, AJ413206; CG40
sodA, AJ413207; S. canis NCTC12191
mutS, AJ413208; CG5 mutS, AJ413209; CG40
mutS, AJ413210; S. pyogenes SF370 mutS, AJ413211; S. dysgalactiae subsp.
equisimilis NCFB1356 mutS, AJ413212.
 |
ACKNOWLEDGMENTS |
A.M.W is supported by a Wellcome Trust Research Fellowship in
Biodiversity (grant no. 053589). This work was funded in part by an
award from the University of Warwick Research and Teaching Development Fund.
We thank Malcolm West and Jan Wheeler for collection of the strains
described in this report.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Dept. of
Biological Sciences, University of Warwick, Coventry CV4 7AL, United
Kingdom. Phone: 44 2476 528359. Fax: 44 2476 523701. E-mail:
a.m.whatmore{at}warwick.ac.uk.
 |
REFERENCES |
| 1.
|
Beall, B.,
R. Facklam, and T. Thompson.
1996.
Sequencing emm-specific PCR products for routine and accurate typing of group A streptococci.
J. Clin. Microbiol.
34:953-958[Abstract].
|
| 2.
|
Bert, F., and N. Lambert-Zechovsky.
1997.
Septicemia caused by Streptococcus canis in a human.
J. Clin. Microbiol.
35:777-779[Abstract].
|
| 3.
|
Devriese, L. A.,
J. Hommez,
R. Kilpper-Bälz, and K. H. Schleifer.
1986.
Streptococcus canis sp. nov.: a species of group G streptococci from animals.
Int. J. Syst. Bacteriol.
36:422-425[Abstract/Free Full Text].
|
| 4.
|
DeWinter, L. M.,
D. E. Low, and J. F. Prescott.
1999.
Virulence of Streptococcus canis from canine streptococcal toxic shock syndrome and necrotising fasciitis.
Vet. Microbiol.
70:95-110[CrossRef][Medline].
|
| 5.
|
Efstratiou, A.
1997.
Pyogenic streptococci of Lancefield groups C and G as pathogens in man.
J. Appl. Microbiol.
83:72S-79S[CrossRef].
|
| 6.
|
Efstratiou, A.,
G. Coleman,
G. Hahn,
J. F. Timoney,
J. M. Boeufgras, and D. Monget.
1994.
Biochemical differences among human and animal streptococci of Lancefield group C or group G.
J. Med. Microbiol.
41:145-148[Abstract/Free Full Text].
|
| 7.
|
Jacobs, J. A.,
M. C. T. de Kron,
J. T. C. Kellens, and E. E. Stobberingh.
1993.
Meningitis and sepsis due to the Group G streptococcus.
Eur. J. Clin. Microbiol. Infect. Dis.
12:224-225[CrossRef][Medline].
|
| 8.
|
Khan, J. A.,
H. E. Evans,
M. R. Macabuhay,
Y.-E. Lee, and R. Werner.
1975.
Primary peritonitis due to Group G streptococcus: a case report.
Pediatrics
56:1078-1079[Abstract/Free Full Text].
|
| 9.
|
Miller, C. W.,
J. F. Prescot,
K. A. Mathews,
S. D. Betschel,
J. A. Yager,
V. Guru,
L. DeWinter, and D. E. Low.
1996.
Streptococcal toxic shock syndrome in dogs.
J. Am. Vet. Med. Assoc.
209:1421-1426[Medline].
|
| 10.
|
Poyart, C.,
G. Quesne,
S. Coulon,
P. Berche, and P. Trieu-Cuot.
1998.
Identification of streptococci to species level by sequencing the gene encoding the manganese-dependent superoxide dismutase.
J. Clin. Microbiol.
36:41-47[Abstract/Free Full Text].
|
| 11.
|
Schnitzler, N.,
A. Podbielski,
G. Baumgarten,
M. Mignon, and A. Kaufhold.
1995.
M or M-like protein gene polymorphisms in human group G streptococci.
J. Clin. Microbiol.
33:356-363[Abstract].
|
| 12.
|
Simpson, W. J.,
J. C. Robbins, and P. P. Cleary.
1987.
Evidence for group A-related M protein genes in human but not animal-associated group G streptococcal pathogens.
Microb. Pathog.
3:339-350[CrossRef][Medline].
|
| 13.
|
Vandamme, P.,
B. Pot,
E. Falsen,
K. Kersters, and L. A. Devriese.
1996.
Taxonomic study of Lancefield streptococcal groups C, G and L (Streptococcus dysgalactiae) and proposal of S. dysgalactiae subsp. equisimilis subsp. nov.
Int. J. Syst. Bacteriol.
46:774-781[Abstract/Free Full Text].
|
| 14.
|
Vieira, V. V.,
L. M. Teixeira,
V. Zahner,
H. Momen,
R. R. Facklam,
A. G. Steigerwalt,
D. J. Brenner, and A. C. D. Castro.
1998.
Genetic relationships among the different phenotypes of Streptococcus dysgalactiae strains.
Int. J. Syst. Bacteriol.
48:1231-1243[Abstract/Free Full Text].
|
| 15.
|
Whatmore, A. M.
2001.
Streptococcus pyogenes sclB encodes a putative hypervariable surface protein with a collagen-like repetitive structure.
Microbiology
147:419-429[Abstract/Free Full Text].
|
| 16.
|
Whatmore, A. M., and M. A. Kehoe.
1994.
Horizontal gene transfer in the evolution of group A streptococcal emm-like genes: gene mosaics and variation in the Vir regulon.
Mol. Microbiol.
11:363-374[CrossRef][Medline].
|
Journal of Clinical Microbiology, November 2001, p. 4196-4199, Vol. 39, No. 11
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.1.4196-4199.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ahmad, Y., Gertz, R. E. Jr., Li, Z., Sakota, V., Broyles, L. N., Van Beneden, C., Facklam, R., Shewmaker, P. L., Reingold, A., Farley, M. M., Beall, B. W.
(2009). Genetic Relationships Deduced from emm and Multilocus Sequence Typing of Invasive Streptococcus dysgalactiae subsp. equisimilis and S. canis Recovered from Isolates Collected in the United States. J. Clin. Microbiol.
47: 2046-2054
[Abstract]
[Full Text]
-
Lam, M. M., Clarridge, J. E. III, Young, E. J., Mizuki, S.
(2007). The Other Group G Streptococcus: Increased Detection of Streptococcus canis Ulcer Infections in Dog Owners. J. Clin. Microbiol.
45: 2327-2329
[Abstract]
[Full Text]
-
Tikofsky, L. L., Zadoks, R. N.
(2005). Cross-Infection Between Cats and Cows: Origin and Control of Streptococcus canis Mastitis in a Dairy Herd. J DAIRY SCI
88: 2707-2713
[Abstract]
[Full Text]
-
Hassan, A. A., Akineden, O., Usleber, E.
(2005). Identification of Streptococcus canis Isolated from Milk of Dairy Cows with Subclinical Mastitis. J. Clin. Microbiol.
43: 1234-1238
[Abstract]
[Full Text]
-
Taillefer, M., Dunn, M.
(2004). Group G Streptococcal Toxic Shock-Like Syndrome in Three Cats. Journal of the American Animal Hospital Association
40: 418-422
[Abstract]
[Full Text]