Previous Article | Next Article 
Journal of Clinical Microbiology, February 2001, p. 631-635, Vol. 39, No. 2
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.2.631-635.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Strain Composition of the Ehrlichia
Anaplasma marginale within Persistently Infected Cattle,
a Mammalian Reservoir for Tick Transmission
Guy H.
Palmer,*
Fred
R.
Rurangirwa, and
Terry F.
McElwain
Program in Vector-borne Diseases, Department
of Veterinary Microbiology and Pathology, Washington State
University, Pullman, Washington 99164-7040.
Received 16 August 2000/Returned for modification 18 October
2000/Accepted 21 November 2000
 |
ABSTRACT |
Tick-borne ehrlichial pathogens of animals and humans require a
mammalian reservoir of infection from which ticks acquire the organism
for subsequent transmission. In the present study, we examined the
strain structure of Anaplasma marginale, a genogroup II
ehrlichial pathogen, in both an acute outbreak and in persistently infected cattle that serve as a reservoir for tick transmission. Using
the msp1
genotype as a stable strain marker, only a
single genotype was detected in a disease outbreak in a previously
uninfected herd. In contrast, a diverse set of genotypes was detected
in a persistently infected reservoir herd within a region where
A. marginale is endemic. Genotypic diversity did not
appear to be rapidly generated within an individual animal, because
only a single genotype, identical to that of the inoculating strain, was detected at time points up to 2 years after experimental infection, and only a single identical genotype was found in repeat sampling of
individual naturally infected cattle. Similarly, only a single genotype, identical to that of the experimentally inoculated St. Maries
or South Idaho strain, was identified in the bloodmeal taken by
Dermacentor andersoni ticks, in the midgut and salivary glands of the infected ticks, and in the blood of acutely infected cattle following tick transmission. The results show that mammalian reservoirs harbor genetically heterogeneous A. marginale
and suggest that different genotypes are maintained by transmission
within the reservoir population.
 |
INTRODUCTION |
Pathogens in ehrlichial genogroups I
and II, within the order Rickettsiales, are transmitted by
ixodid ticks and cause acute disease in animals and humans (12,
20). Persistently infected mammals serve as reservoir hosts for
ticks to acquire the pathogen and subsequently transmit infection to a
new susceptible host, resulting in mild to severe illness that may
progress to death (12, 20). Anaplasma marginale
is a genogroup II ehrlichial pathogen that is maintained in
persistently infected domestic cattle and transmitted to susceptible
cattle within the same population (5, 12). Similar to the
other tick-transmitted ehrlichiae, the well-characterized A. marginale strains have been isolated from acutely affected animals
during a disease outbreak and, thus, represent successful transmission
of a virulent genotype (1, 4, 13). In contrast, there is
no information regarding the uniformity, or lack of it, of strain
composition in the persistently infected cattle that serve as a
reservoir for transmission. We hypothesized that, in comparison to
acute disease outbreaks, persistently infected cattle would harbor a
greater diversity of A. marginale genotypes. For the present
study, we tested this hypothesis by using natural infections within a
region of endemicity and in an acute disease outbreak, as well as by
using experimental tick-borne transmission.
 |
MATERIALS AND METHODS |
Naturally infected animal populations.
Genotypic diversity
was studied in two cattle populations. The first was a Hereford and
Tarantais beef cattle herd (n = 235 animals) located
within an area of eastern Oregon where A. marginale is
endemic. This herd was selected based on a high prevalence of infection
(64%) within the herd and a history of seasonal transmission (19). Sampling was done at two time points: prior to when
feeding ticks are detected on cattle in this region (March) and
following a minimum of 4 months of tick activity (August). The second
population studied was a mixed-breed beef cattle herd
(n = 120) in Platte, S.Dak. This herd had no previously
reported cases of anaplasmosis in the 5 years prior to undergoing an
acute outbreak at the time of this study. Sampling was done at a single
time point during the acute outbreak. A. marginale infection
of individual animals in both herds was detected by using an MSP5
competitive inhibition (CI)-enzyme-linked immunosorbent assay
(ELISA) and was confirmed with the msp5 nested-PCR
test. These test procedures and their specificity and sensitivity for
detection in both acutely and persistently infected cattle have been
previously reported in detail (9, 19).
Determination of the msp1
genotype.
DNA
was extracted from blood, isolated tick midguts, or isolated tick
salivary glands by using Puregene (Gentra Systems, Inc.) (7,
17). Amplification of the variable repeat region was done by PCR
with Pwo DNA polymerase (Boehringer Mannheim) and primers in
the conserved regions flanking the repeat sequences. The forward primer
was 5'CATTTCCATATACTGTGCAG (nucleotide position
99 to
80
relative to the transcription start site; numbering based on the
Florida strain msp1
sequence [1]; GenBank
accession no. M32871, M32872), and the reverse primer was
5'-CTTGGAGCGCATCTCTCTTGCC (position +881 to +862). The
number of repeats (each 87 or 84 bp long) can be determined from the
size of the resulting amplicon, because the 268 bp preceding and the 17 bp following the repeats are conserved in all strains (1).
The identity of the amplicon and the numbers and sequences of the
repeats present were confirmed by sequencing. PCR products were ligated
into pCR 2.1 by using the TA cloning kit (Invitrogen), and
transformation of Escherichia coli XL-1 Blue was done as
described previously (7). The presence of inserts in
plasmids from transformed colonies was confirmed by restriction
digestion or PCR (7). Plasmid insert DNA was sequenced in
both directions by using an ABI PRISM (Applied Biosystems, Inc.)
automated sequencer. Sequence analysis was performed on a VAX11/785
computer, by using the GCG (Genetics Computer Group) package, version
9. Full-length msp1
was amplified with primers flanking
the complete open reading frame (1). The forward primer (5'-GTGCTTATGGCAGACATTTC) was derived from the sequence
upstream of the transcriptional start site (positions
110 to
91),
and the reverse primer (5'-GACTCTATCAAAGACCGGAAACTC)
represents the complementary sequence to the last bases contained
in the open reading frame (+2568 to +2544). The full-length gene was
cloned and sequenced by the methods described above for repeat region amplicons.
To control for PCR- or cloning-induced artifacts in determination of
the number of msp1
repeats, unamplified DNA was digested with EcoRII and, following agarose gel electophoresis,
hybridized with a labeled msp1
probe spanning the repeat
region. The probe was generated by PCR with the primers
5'CATTTCCATATACTGTGCAG (position
99 to
80) and
5'-CTTGGAGCGCATCTCTCTTGCC (position +881 to +862) and
labeled with digoxigenin, as previously described (15). The EcoRII sites in msp1
are external to the
repeat section (positions +81 to +85 and +1248 to +1252) and thus can
be used to provide an independent estimation of the number of repeats
(1). EcoRII digestion and Southern blotting
were done by standard methods as previously described
(16). A second control was determination of the apparent
molecular size of the expressed MSP1a, which directly reflects
the number of repeats (1, 14). A. marginale
organisms were solubilized in sample buffer containing 2% (wt/vol)
sodium dodecyl sulfate (SDS) and 5%
-mercaptoethanol
(6). Following SDS-polyacrylamide gel electrophoresis and
transfer to nitrocellulose, MSP1a was bound with monoclonal antibody
Ana22B1 (13, 14). Detection of bound antibody by enhanced
chemiluminescence and determination of apparent molecular size were
done as described previously (6).
Experimental infection and tick transmission.
Three
genotypically distinct strains of A. marginale, Florida,
South Idaho, and St. Maries (1, 4,13), were used to examine genotype stability in infected cattle and during tick transmission. All calves were confirmed to be seronegative by the MSP5
CI-ELISA prior to experimental infection. Infected cattle were
maintained in tick-free housing to prevent a second infection with an
additional genotype. Three Holstein calves (animals 94B04, 94B05, and
94B06) were inoculated intravenously with the Florida strain. The
msp1
genotype was determined at the following time points
during persistent infection: 94B04, 616, 702, and 719 days postinfection; 94B05, 525 and 612 days postinfection; and 94B06, 525, 584, and 684 days postinfection. Two Holstein calves were inoculated
intravenously with the South Idaho strain (animal 786) or the St.
Maries strain (animal 787). Both strains are naturally transmitted by
Dermacentor andersoni ticks and can be experimentally transmitted by adult males of the Reynolds Creek stock of D. andersoni (4, 5,17, 18). Following development of
rickettsemia, 250 laboratory-reared adult male Dermacentor
andersoni ticks were placed in an orthopedic stockinet and allowed
to attach and feed on each calf for 7 days. The ticks were removed and
were incubated for an additional 7 days at 26°C with 90 to 98%
relative humidity and a 14-h photoperiod. A group of 50 ticks from each
calf were dissected, and DNA was extracted from isolated midguts and
salivary glands. Ticks from each feeding were then allowed to attach
and transmission feed on individual uninfected recipient calves (animal 788 for South Idaho strain-infected ticks and animal 789 for St. Maries
strain-infected ticks) for 3 days. Ticks were then removed, and
salivary glands were obtained by dissection and used for isolation of
infective-stage DNA, as previously described (17, 18).
Nucleotide sequence accession numbers.
The GenBank/EMBL
accession numbers for the full-length msp1
nucleotide
sequences are as follows: Florida, M32871, M32872; South Idaho, M32868;
St. Maries, AF293062; Platte, S.Dak., AF293063; Baker, Oreg. (animal
2079), AF293064.
 |
RESULTS |
Genotype composition in a disease outbreak.
An acute outbreak
of anaplasmosis was diagnosed in a beef cattle herd in Platte, S.Dak.
There had been no reported cases of disease in the previous 5 years. In
the outbreak, the presumptive diagnosis of acute A. marginale infection was based on clinical signs of severe anemia,
fever, and lethargy. Infection was confirmed in 10 animals by the
msp5 nested PCR and the MSP5 CI-ELISA (data not shown).
Blood collected from each of these 10 animals during the period of
high-level rickettsemia and acute clinical disease was used for DNA
extraction and determination of the msp1
genotype. The
msp1
genotypes identified in each of the 10 acutely
rickettsemic cattle in the S.Dak. outbreak were identical. Amplicons
from four of the infected animals are shown in Fig.
1. The number and sequence of the repeats
within msp1
were determined by sequencing amplicons cloned into pCR 2.1. and expressed as the encoded amino acid sequence according to the convention described by Allred et al. (1) (Table 1). The full-length Platte,
S.Dak., strain msp1
gene sequence (GenBank accession no.
AF293063) confirmed the presence of four 87-bp repeats (Table
2). No additional genotypes were detected
in this outbreak, and no amplicons were generated by using blood
collected from five animals within the herd that were clinically normal
and that remained seronegative in the MSP5 CI-ELISA.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 1.
Presence of a single msp1 genotype in
a herd of cattle during an acute outbreak. Repeat region amplicons were
derived from each of the acutely infected animals in the Platte,
S.Dak., herd. Individual animal numbers are shown in the bottom margin.
Animals 43G, 31G, 62G, and 76G were infected, and animals 83G, 30G,
15G, and 49G were uninfected. The size of the msp1
repeat region amplicon is indicated in the left margin.
|
|
Genotype composition in a herd from an area of endemicity.
Six
different genotypes (8, 7, 5, 3, 2, and 1 repeats) were detected within
the Baker, Oreg., herd in March, prior to the transmission season
(Table 2). Amplicons representing four different genotypes (8, 7, 5, and 1 repeats), each derived from a persistently infected animal, are
shown in Fig. 2. Only a single
msp1
genotype was detected in an individual animal, and
isolates with the same number of repeats always had the same order of
repeats and an identical nucleotide sequence. In addition to the five
repeat forms previously identified by sequence analysis of the Florida, South Idaho, Virginia, and Washington-O strains of A. marginale (1), four new repeat forms, all encoded by
87-bp segments, were identified in the persistently infected animals in
the Baker, Oreg., herd (Table 1). The variation among genotypes was
limited to the number of repeats, the presence of single-codon
deletions, or nonsynonymous nucleotide substitutions within a codon
(Tables 1 and 2).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
Presence of multiple msp1 genotypes in
a Baker, Oreg., herd of cattle within a region of endemicity. Repeat
region amplicons representing four different genotypes, each derived
from a persistently infected animal, are shown. The animal number is
shown in the bottom margin, and the positions of amplicons representing
eight (984 bp), seven (897 bp), five (723 bp), or one (372 bp) repeat
are indicated in the left and right margins.
|
|
The
msp1
genotype was also determined in a previously
uninfected animal (animal 3035) that developed acute rickettsemia
following
tick transmission within this herd from an area of endemicity
in August. The
msp1
amplicon was sequenced, and the
presence
of five 87-bp repeats was determined (Table
2). This sequence
matched that detected in four other persistently rickettsemic
animals
(no. 786, 0055, 1223, and 4135) within the same Baker,
Oreg.,
herd.
To confirm that the detected diversity in repeat numbers reflected true
differences in the genotype rather than a PCR- or
cloning-induced
artifact, we determined the
msp1
genotype without
prior
PCR amplification. Digestion of genomic DNA with
EcoRII
results in two fragments that can be hybridized with the probe
(nucleotides

99 to +881): an internal
msp1
fragment and
a larger
fragment composed of the 5' end of
msp1
and
unknown upstream
sequence. With the Florida strain used as a positive
control,
the
msp1
probe hybridized strongly to the
predicted 1.17-kb internal
fragment (+83 to +1255), which includes one
84-bp repeat and seven
87-bp repeats (
1), and weakly to
the larger fragment containing
the 5' end (Fig.
3).
EcoRII digestion of the
isolate from animal
2079 of the Baker, Oreg., herd, shown by sequencing
of the complete
msp1
gene (GenBank accession no.
AF293064) to contain one
84-bp repeat and two 87-bp repeats, resulted
in a strongly hybridizing
fragment of 0.72 kb (Fig.
3). This fragment
is 435 bp smaller
than the corresponding fragment in the Florida
strain, consistent
with the presence of only three repeats. A larger,
weakly binding
EcoRII fragment was also detected, as
predicted, in the isolate
from animal 2079.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 3.
Southern blot confirmation of the msp1
repeat structure predicted by amplicon size and sequence. The
undigested msp1 repeat region amplicon from
persistently infected animal 2079 of the Baker, Oreg., herd and
EcoRII-digested DNA extracted from the Florida strain,
the isolate obtained from animal 2079, and, as a negative control,
bovine thymus were Southern blotted with an msp1
probe. The sizes of the internal EcoRII fragments of
msp1 in the Florida strain and isolate 2079 are
indicated in the left margin, and the size of the amplicon from isolate
2079 is indicated in the right margin.
|
|
The Florida strain MSP1a protein was detected at an apparent molecular
mass of 105 kDa (Fig.
4). The isolate
from 2079 had
an apparent molecular mass of 89 kDa (Fig.
4). This is
the size
predicted for MSP1a containing one 28-amino-acid repeat and
two
29-amino-acid repeats and is approximately 16 kDa smaller than
the
Florida strain MSP1a (Fig.
4), representing the presence of
five fewer
29-amino-acid repeats.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 4.
Western blot confirmation of the msp1
repeat structure predicted by amplicon size and sequence. Organisms of
the Florida strain and the isolate obtained from persistently infected
animal 2079 of the Baker, Oreg., herd were Western blotted with the
anti-MSP1a monoclonal antibody Ana22B1 or, as a negative control, the
anti-Trypanosoma brucei monoclonal antibody Tryp1E1. The
sizes of MSP1a in the Florida strain and isolate 2079 are indicated in
the left margin.
|
|
Stability of genotypes within persistently infected cattle.
Genotypes were examined at multiple time points of persistent Florida
strain infection in each of three animals. The genotypes at all eight
time points, ranging from 525 to 719 days after experimental inoculation, were identical to that of the inoculating Florida strain
(Table 2). To test whether genotypes were also stable in naturally
infected animals in a region of endemicity, 10 of the animals in
the Baker, Oreg., herd for which genotypes were determined in
March were also tested in August, following the tick transmission
season. All 10 animals remained persistently infected during the
period, and there was only a single genotype of A. marginale
in each animal. The genotypes, in terms of both the number of repeats
determined by PCR and the sequence, were identical for March and August.
Stability of genotypes during tick transmission.
The stability
of genotypes during tick transmission was tested with the South Idaho
and St. Maries strains. The South Idaho strain msp1
gene
contains six repeats (five of 87 bp and one of 84 bp) (Table 2), and
the complete sequence has been reported previously (1).
The full-length St. Maries msp1
gene was sequenced (GenBank accession no. AF293062), and three 89-bp repeats were identified, including a variant form, designated J, not present in the
previously examined strains (Tables 1 and 2). Only a single genotype,
identical to that of the inoculated St. Maries (Fig.
5) or South Idaho strain, was detected in
the following samples obtained during tick transmission: (i) the blood
of infected animals when ticks fed and acquired A. marginale, (ii) the infected tick (from the midgut and salivary
gland prior to reattachment for transmission feeding and from the
salivary gland after 3 days of transmission feeding), and (iii) the
blood of infected animals following successful transmission. Sequencing
of all the samples confirmed the invariance of the repeat structure.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 5.
Invariance of the msp1 genotype during
tick transmission of the St. Maries strain of A.
marginale. Repeat region amplicons were generated from
A. marginale in the following samples: the blood of
animal 787 at three time points during acquisition feeding by
Dermacentor andersoni tick attachment, midfeeding, and
tick removal; infected D. andersoni tick midguts and
salivary glands prior to transmission feeding (Unfed sal. gland) and
after 3 days of transmission feeding (Fed sal. gland); and the blood of
animal 789 during acute rickettsemia following transmission. PCR
amplification without DNA template was done as a negative control. The
size of the msp1 repeat region amplicon is indicated
in the right margin.
|
|
 |
DISCUSSION |
The A. marginale genotypic diversity within a herd of
persistently infected cattle was striking and demonstrates much broader genetic heterogeneity of ehrlichial pathogens in the mammalian reservoir than has been apparent based on characterization of isolates
from acutely infected animal or human patients. Within the single
Baker, Oreg., herd, we identified six distinct A. marginale genotypes as determined by the number and sequence of
msp1
repeats. We conclude that the detected genotypes
accurately represent true genotypic diversity, rather than errors
introduced during PCR amplification or sequencing, based on the
following observations: (i) only a single genotype was detected in any
infected animal; (ii) samples collected at different times from the
same naturally infected animals (Baker, Oreg., and Platte, S.Dak.,
herds) always gave rise to an identical genotype; (iii) samples
collected at different times from the same experimentally infected
animals (Florida and South Idaho strains) always gave rise to the same genotype, and the genotype was identical to that of the inoculating strain; (iv) Southern blotting of unamplified DNA identified
EcoRII fragments predicted by the PCR-generated and
-sequenced msp1
amplicon; and (v) Western blotting of the
organism revealed the MSP1a protein of the size predicted by the
PCR-generated and -sequenced amplicon.
How is this diversity of genotypes within the persistently infected
herd generated? We considered the most likely possibility to be during
the sequential cycles of replication that characterize persistent
infection (8) or, alternatively, during replication in the
midgut and salivary glands of transmitting ticks (10, 11).
Examination of three experimentally infected animals at multiple time
points during persistence revealed only a single genotype, identical to
that of the inoculating Florida strain. This msp1
genotypic stability was supported by examination of 10 persistently
infected individuals in the herd from an area of endemicity at two time
points. In each of the 10 infected individuals, only a single,
identical genotype was identified in both samples. Similarly, only a
single msp1
genotype, with a repeat structure identical
to that of the inoculating St. Maries or South Idaho strain, was
detected within the tick midgut epithelium, where early replication
takes place, and in the tick salivary gland, where final replication
and development of infectivity occur (10, 11). Thus, using
experimental infection with three genotypically distinct strains and by
sequential sampling during natural infection, we were unable to
identify emergence of new genotypes in the mammalian reservoir or in
the tick vector.
The arrangement of alternating A and F repeat forms with a terminating
H form in the Baker, Oreg., herd (Table 2) suggests that the diverse
genotypes within this herd may have arisen from a common precursor
strain. If so, this genotypic change appears to be an infrequent event,
because generation of diversity was not detected in our studies of
persistent infection and tick transmission. An alternative hypothesis
is that the diversity represents separate transmission events, each
introducing a new msp1
genotype into the herd that is
then maintained by transmission within the herd. Importantly, there had
been no new addition of animals from outside the Baker, Oreg., herd
into the study population for several years. Regardless of the source,
the infrequent generation of new genotypes suggests that the genotypes
are maintained by transmission within the herd, a possibility
supported by the identification of multiple animals with the same
genotype. While it is unproven whether each of the detected genotypes
represents a transmissible phenotype, the genotype represented by five
repeats (three 87 bp and two 84 bp) was shown to be transmitted to
animal 3035. Although this was a common msp1
genotype, we
do not have sufficient data to determine whether this represents a
genotype with enhanced transmissibility.
In contrast to the diversity of genotypes within the persistently
infected Baker, Oreg., herd, only a single genotype was detected in the
acute outbreak affecting the Platte, S.Dak. herd. The detection of only
a single genotype in all of the affected individuals is suggestive of
transmission from a point source
most likely introduction of an animal
infected with this genotype into the herd.
In summary, we have identified genotypic diversity within a population
of persistently infected cattle that serve as reservoirs for tick
transmission of the ehrlichia A. marginale. These genotypes appear to be relatively stable, because we failed to detect change during experimental or naturally occurring infection and tick transmission. The association of differences in virulence,
antigenicity, and transmissibility with specific A. marginale strains, isolated from acute cases and defined by the
msp1
genotype (1-4, 13, 14, 18, 21),
indicates that the diversity of genotypes present within an endemically
infected reservoir population could also represent a diversity of
biological phenotypes. Clearly, the transmissibility and virulence of
genotypes within the reservoir population are important determinants of
the incidence and severity of disease in the susceptible population.
Testing whether the same diversity is present within the wildlife
mammalian reservoirs of ehrlichial pathogens causing disease in humans
and learning how this diversity is generated will be critical to
improved understanding of ehrlichial transmission and disease.
 |
ACKNOWLEDGMENTS |
This work was supported by grants from USDA NRICGP
(97-35204-4597 and 96-37204-3610) and NIH (R01 AI44005).
The isolates from the Platte, S.Dak., outbreak were provided by Jon
Seagren, and the Baker, Oreg., isolates were collected with the
assistance of Patricia Rasmussen, Susana Torioni de Echaide, and
Odillon Vidotto. We acknowledge Teresa Harkins, Beverly Hunter, Emma
Karel, Kay Morris, and Carla Robertson for excellent technical assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Veterinary Microbiology and Pathology, Washington State University,
Pullman, WA 99164-7040. Phone: (509) 335-6033. Fax: (509) 335-8529. E-mail: gpalmer{at}vetmed.wsu.edu.
 |
REFERENCES |
| 1.
|
Allred, D. R.,
T. C. McGuire,
G. H. Palmer,
S. R. Leib,
T. M. Harkins,
T. F. McElwain, and A. F. Barbet.
1990.
Molecular basis for surface antigen size polymorphisms and conservation of a neutralization-sensitive epitope in Anaplasma marginale.
Proc. Natl. Acad. Sci. USA
87:3220-3224[Abstract/Free Full Text].
|
| 2.
|
Brown, W. C.,
D. Zhu,
V. Shkap,
T. C. McGuire,
E. F. Blouin,
K. M. Kocan, and G. H. Palmer.
1998.
The repertoire of Anaplasma marginale antigens recognized by CD4+ T-lymphocyte clones from protectively immunized cattle is diverse and includes major surface protein 2 (MSP-2) and MSP-3.
Infect. Immun.
66:5414-5422[Abstract/Free Full Text].
|
| 3.
|
Camacho-Nuez, M.,
M. Muñoz de Lourdes,
C. E. Suarez,
T. C. McGuire,
W. C. Brown, and G. H. Palmer.
2000.
Expression of polymorphic msp1 genes during acute Anaplasma marginale rickettsemia.
Infect. Immun.
68:1946-1952[Abstract/Free Full Text].
|
| 4.
|
Eriks, I. S.,
D. Stiller,
W. L. Goff,
S. M. Parish,
T. F. McElwain, and G. H. Palmer.
1994.
Molecular and biological characterization of a new isolated Anaplasma marginale strain.
J. Vet. Diagn. Investig.
6:435-441[Abstract/Free Full Text].
|
| 5.
|
Eriks, I. S.,
D. Stiller, and G. H. Palmer.
1993.
Impact of persistent Anaplasma marginale rickettsemia on tick infection and transmission.
J. Clin. Microbiol.
31:2091-2096[Abstract/Free Full Text].
|
| 6.
|
French, D. M.,
W. C. Brown, and G. H. Palmer.
1999.
Emergence of Anaplasma marginale antigenic variants during persistent rickettsemia.
Infect. Immun.
67:5834-5840[Abstract/Free Full Text].
|
| 7.
|
French, D. M.,
T. F. McElwain,
T. C. McGuire, and G. H. Palmer.
1998.
Expression of Anaplasma marginale major surface protein 2 variants during persistent cyclic rickettsemia.
Infect. Immun.
66:1200-1207[Abstract/Free Full Text].
|
| 8.
|
Kieser, S. T.,
I. S. Eriks, and G. H. Palmer.
1990.
Cyclic rickettsemia during persistent Anaplasma marginale infection of cattle.
Infect. Immun.
58:1117-1119[Abstract/Free Full Text].
|
| 9.
|
Knowles, D. P.,
S. Torioni de Echaide,
G. H. Palmer,
T. C. McGuire,
D. Stiller, and T. F. McElwain.
1996.
Antibody against an Anaplasma marginale MSP5 epitope common to tick and erythrocyte stages identifies persistently infected cattle.
J. Clin. Microbiol.
34:2225-2230[Abstract].
|
| 10.
|
Kocan, K. M.
1986.
Development of Anaplasma marginale in ixodid ticks: coordinated development of a rickettsial organism and its tick host, p. 472-505.
In
J.R. Sauer, and J.A. Hair (ed.), Morphology, physiology and behavioral ecology of ticks. Horwood, Chichester, United Kingdom.
|
| 11.
|
Kocan, K. M.,
W. L. Goff,
D. Stiller,
W. Edwards,
S. A. Ewing,
P. L. Claypool,
T. C. McGuire,
J. A. Hair, and S. J. Barron.
1993.
Development of Anaplasma marginale in salivary glands of male Dermacentor andersoni.
Am. J. Vet. Res.
54:107-112[Medline].
|
| 12.
|
Losos, G. J.
1986.
Anaplasmosis, p. 743-795.
In
G.J. Losos (ed.), Infectious tropical diseases of domestic animals. Longman House, Essex, United Kingdom.
|
| 13.
|
McGuire, T. C.,
G. H. Palmer,
W. L. Goff,
M. I. Johnson, and W. C. Davis.
1984.
Common and isolate-restricted antigens of Anaplasma marginale detected with monoclonal antibodies.
Infect. Immun.
45:697-700[Abstract/Free Full Text].
|
| 14.
|
Oberle, S. M.,
G. H. Palmer,
A. F. Barbet, and T. C. McGuire.
1988.
Molecular size variations in an immunoprotective protein complex among isolates of Anaplasma marginale.
Infect. Immun.
56:1567-1573[Abstract/Free Full Text].
|
| 15.
|
Palmer, G. H.,
J. R. Abbott,
D. M. French, and T. F. McElwain.
1998.
Persistence of Anaplasma ovis infection and conservation of the msp-2 and msp-3 multigene families within the genus Anaplasma.
Infect. Immun.
66:6035-6039[Abstract/Free Full Text].
|
| 16.
|
Palmer, G. H.,
G. Eid,
A. F. Barbet,
T. C. McGuire, and T. F. McElwain.
1994.
The immunoprotective Anaplasma marginale major surface protein 2 is encoded by a polymorphic multigene family.
Infect. Immun.
62:3808-3816[Abstract/Free Full Text].
|
| 17.
|
Rurangirwa, F. R.,
D. Stiller,
D. M. French, and G. H. Palmer.
1999.
Restriction of major surface protein 2 (MSP2) variants during tick transmission of the ehrlichia Anaplasma marginale.
Proc. Natl. Acad. Sci. USA
96:3171-3176[Abstract/Free Full Text].
|
| 18.
|
Rurangirwa, F. R.,
D. Stiller, and G. H. Palmer.
2000.
Strain diversity in major surface protein expression during tick transmission of Anaplasma marginale.
Infect. Immun.
68:3023-3027[Abstract/Free Full Text].
|
| 19.
|
Torioni de Echaide, S.,
D. P. Knowles,
T. C. McGuire,
G. H. Palmer,
C. E. Suarez, and T. F. McElwain.
1998.
Detection of cattle naturally infected with Anaplasma marginale in a region of endemicity by nested PCR and a competitive enzyme-linked immunosorbent assay with recombinant major surface protein 5.
J. Clin. Microbiol.
36:777-782[Abstract/Free Full Text].
|
| 20.
|
Walker, D. H., and S. J. Dumler.
1996.
Emergence of the ehrlichioses as human health problems.
Emerg. Infect. Dis.
2:18-29[Medline].
|
| 21.
|
Wickwire, K. B.,
K. M. Kocan, and S. J. Barron.
1987.
Infectivity of three Anaplasma marginale isolates for Dermacentor andersoni.
Am. J. Vet. Res.
48:96-99[Medline].
|
Journal of Clinical Microbiology, February 2001, p. 631-635, Vol. 39, No. 2
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.2.631-635.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Galletti, M. F. B. M., Ueti, M. W., Knowles, D. P. Jr., Brayton, K. A., Palmer, G. H.
(2009). Independence of Anaplasma marginale Strains with High and Low Transmission Efficiencies in the Tick Vector following Simultaneous Acquisition by Feeding on a Superinfected Mammalian Reservoir Host. Infect. Immun.
77: 1459-1464
[Abstract]
[Full Text]
-
Ladbury, G. A. F., Stuen, S., Thomas, R., Bown, K. J., Woldehiwet, Z., Granquist, E. G., Bergstrom, K., Birtles, R. J.
(2008). Dynamic Transmission of Numerous Anaplasma phagocytophilum Genotypes among Lambs in an Infected Sheep Flock in an Area of Anaplasmosis Endemicity. J. Clin. Microbiol.
46: 1686-1691
[Abstract]
[Full Text]
-
Macmillan, H., Norimine, J., Brayton, K. A., Palmer, G. H., Brown, W. C.
(2008). Physical Linkage of Naturally Complexed Bacterial Outer Membrane Proteins Enhances Immunogenicity. Infect. Immun.
76: 1223-1229
[Abstract]
[Full Text]
-
Futse, J. E., Brayton, K. A., Dark, M. J., Knowles, D. P. Jr., Palmer, G. H.
(2008). Superinfection as a driver of genomic diversification in antigenically variant pathogens. Proc. Natl. Acad. Sci. USA
105: 2123-2127
[Abstract]
[Full Text]
-
Macmillan, H., Brayton, K. A., Palmer, G. H., McGuire, T. C., Munske, G., Siems, W. F., Brown, W. C.
(2006). Analysis of the Anaplasma marginale Major Surface Protein 1 Complex Protein Composition by Tandem Mass Spectrometry. J. Bacteriol.
188: 4983-4991
[Abstract]
[Full Text]
-
Brayton, K. A., Kappmeyer, L. S., Herndon, D. R., Dark, M. J., Tibbals, D. L., Palmer, G. H., McGuire, T. C., Knowles, D. P. Jr.
(2005). Complete genome sequencing of Anaplasma marginale reveals that the surface is skewed to two superfamilies of outer membrane proteins. Proc. Natl. Acad. Sci. USA
102: 844-849
[Abstract]
[Full Text]
-
Palmer, G. H., Knowles, D. P. Jr., Rodriguez, J.-L., Gnad, D. P., Hollis, L. C., Marston, T., Brayton, K. A.
(2004). Stochastic Transmission of Multiple Genotypically Distinct Anaplasma marginale Strains in a Herd with High Prevalence of Anaplasma Infection. J. Clin. Microbiol.
42: 5381-5384
[Abstract]
[Full Text]
-
Garcia-Garcia, J. C., de la Fuente, J., Bell-Eunice, G., Blouin, E. F., Kocan, K. M.
(2004). Glycosylation of Anaplasma marginale Major Surface Protein 1a and Its Putative Role in Adhesion to Tick Cells. Infect. Immun.
72: 3022-3030
[Abstract]
[Full Text]
-
Kocan, K. M., de la Fuente, J., Guglielmone, A. A., Melendez, R. D.
(2003). Antigens and Alternatives for Control of Anaplasma marginale Infection in Cattle. Clin. Microbiol. Rev.
16: 698-712
[Abstract]
[Full Text]
-
de la Fuente, J., Golsteyn Thomas, E. J., Van Den Bussche, R. A., Hamilton, R. G., Tanaka, E. E., Druhan, S. E., Kocan, K. M.
(2003). Characterization of Anaplasma marginale Isolated from North American Bison. Appl. Environ. Microbiol.
69: 5001-5005
[Abstract]
[Full Text]
-
Futse, J. E., Ueti, M. W., Knowles, D. P. Jr., Palmer, G. H.
(2003). Transmission of Anaplasma marginale by Boophilus microplus: Retention of Vector Competence in the Absence of Vector-Pathogen Interaction. J. Clin. Microbiol.
41: 3829-3834
[Abstract]
[Full Text]
-
Park, J., Choi, K. S., Dumler, J. S.
(2003). Major Surface Protein 2 of Anaplasma phagocytophilum Facilitates Adherence to Granulocytes. Infect. Immun.
71: 4018-4025
[Abstract]
[Full Text]
-
de la Fuente, J., Van Den Bussche, R. A., Prado, T. M., Kocan, K. M.
(2003). Anaplasma marginale msp1{alpha} Genotypes Evolved under Positive Selection Pressure but Are Not Markers for Geographic Isolates. J. Clin. Microbiol.
41: 1609-1616
[Abstract]
[Full Text]
-
de la Fuente, J., Blouin, E. F., Kocan, K. M.
(2003). Infection Exclusion of the Rickettsial Pathogen Anaplasma marginale in the Tick Vector Dermacentor variabilis. CVI
10: 182-184
[Abstract]
[Full Text]
-
Lohr, C. V., Brayton, K. A., Shkap, V., Molad, T., Barbet, A. F., Brown, W. C., Palmer, G. H.
(2002). Expression of Anaplasma marginale Major Surface Protein 2 Operon-Associated Proteins during Mammalian and Arthropod Infection. Infect. Immun.
70: 6005-6012
[Abstract]
[Full Text]
-
Brown, W. C., McGuire, T. C., Mwangi, W., Kegerreis, K. A., Macmillan, H., Lewin, H. A., Palmer, G. H.
(2002). Major Histocompatibility Complex Class II DR-Restricted Memory CD4+ T Lymphocytes Recognize Conserved Immunodominant Epitopes of Anaplasma marginale Major Surface Protein 1a. Infect. Immun.
70: 5521-5532
[Abstract]
[Full Text]
-
de la Fuente, J., Garcia-Garcia, J. C., Blouin, E. F., Saliki, J. T., Kocan, K. M.
(2002). Infection of Tick Cells and Bovine Erythrocytes with One Genotype of the Intracellular Ehrlichia Anaplasma marginale Excludes Infection with Other Genotypes. CVI
9: 658-668
[Abstract]
[Full Text]
-
Caspersen, K., Park, J.-H., Patil, S., Dumler, J. S.
(2002). Genetic Variability and Stability of Anaplasma phagocytophila msp2 (p44). Infect. Immun.
70: 1230-1234
[Abstract]
[Full Text]
-
Brown, W. C., Palmer, G. H., Lewin, H. A., McGuire, T. C.
(2001). CD4+ T Lymphocytes from Calves Immunized with Anaplasma marginale Major Surface Protein 1 (MSP1), a Heteromeric Complex of MSP1a and MSP1b, Preferentially Recognize the MSP1a Carboxyl Terminus That Is Conserved among Strains. Infect. Immun.
69: 6853-6862
[Abstract]
[Full Text]