Previous Article | Next Article 
Journal of Clinical Microbiology, March 2001, p. 943-948, Vol. 39, No. 3
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.3.943-948.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Diversity within Reference Strains of Corynebacterium
matruchotii Includes Corynebacterium durum and a
Novel Organism
Sara L. Rassoulian
Barrett,1
Brad T.
Cookson,1,2
LaDonna C.
Carlson,3
Kathryn A.
Bernard,4 and
Marie B.
Coyle1,2,3,*
Department of Laboratory Medicine, University
of Washington Medical Center,1 and
Department of Microbiology, University of
Washington,2 Seattle, Washington 98195;
Department of Laboratory Medicine, Harborview Medical
Center, Seattle, Washington 981043; and
Federal Laboratory for Health Canada, Winnipeg, Manitoba,
Canada4
Received 22 May 2000/Returned for modification 25 July
2000/Accepted 19 September 2000
 |
ABSTRACT |
Corynebacterium matruchotii has been the subject of
numerous dental pathogenesis studies. The purpose of the present study was to resolve concerns about diversity within the reference strains of
C. matruchotii through analysis of seven strains procured
from the American Type Culture Collection (ATCC). Analysis of
whole-cell fatty acid profiles with the library generation software of
Microbial ID Inc. revealed that three types of organisms have been
deposited in the ATCC as C. matruchotii. These three groups
of organisms were also distinguishable by DNA-DNA dot blot
hybridization, by sequences of two hypervariable regions of the 16S
rRNA gene, and by the pyrrolidonyl arylamidase test. These studies
indicate that two C. matruchotii reference strains, ATCC
33449 and ATCC 33822, are members of the recently proposed species,
Corynebacterium durum. The colonial morphology and
biochemical reactions of the C. durum strains are more
diverse than originally reported. Strain ATCC 43833 is unique and
represents a novel species. In addition to the type strain, ATCC 14266, true members of the species C. matruchotii include ATCC
strains 14265, 33806, and 43832 plus two reference strains, L2 and
Richardson 13, which comprise the vast majority of strains used in
dental pathogenesis research with this species.
 |
INTRODUCTION |
The seminal paper by Gilmour et al.
(13) provided an accurate description of
Bacterionema matruchotii and clearly distinguished it from
members of the genus Leptotrichia and from other organisms with which it had been confused, including Cladothrix
matruchotii, Leptothrix buccalis, Leptotrichia buccalis, and
Leptotrichia dentium. Based on chemotaxonomic
characteristics, Bacterionema matruchotii was assigned to
the genus Corynebacterium by Collins et al. in 1982 (5).
When this laboratory evaluated the API Rapid CORYNE
identification system (Biomérieux Vitek, Inc., Hazelwood,
Mo.), it was discovered that reactions of
Corynebacterium matruchotii had been omitted from
its database (12). Since the database included most other
recognized Corynebacterium species of human origin, we
suspected that the developers had encountered some unresolvable discrepancies with representative strains of this species. To explore
this possibility, we purchased all strains of C. matruchotii available at the American Type Culture Collection
(ATCC). Because a large body of work has been published on the possible
role of C. matruchotii in the pathogenesis of dental plaque,
caries, and periodontitis, we also included two additional strains
of C. matruchotii that were used in many of these studies,
namely strain L2 and Richardson's strain 13 (22, 23).
The present study was designed to examine the taxonomic
relatedness of commercially available and other reference strains of C. matruchotii. The question was addressed on the basis
of whole-cell fatty acid analyses, DNA-DNA dot blot
hybridizations, sequencing of two hypervariable regions of the 16S rRNA
gene, and biochemical reactions. The results indicate that the seven ATCC strains deposited as C. matruchotii comprise three
different taxa, including four true C. matruchotii
strains, two strains of the recently proposed species
Corynebacterium durum, and one representative of a novel taxon.
 |
MATERIALS AND METHODS |
Strains.
Strains analyzed in the present study included
seven strains deposited in the ATCC as C. matruchotii: ATCC
14266 (type strain), ATCC 14265, ATCC 33449, ATCC 33806, ATCC 33822, ATCC 43832, and ATCC 43833. C. matruchotii strains L2 and
Richardson 13 were generously provided by I. Takazoe, Tokyo, Japan.
Three strains, LCDC 81-379, LCDC 86-376, and LCDC 91-086, from the
laboratory of K. A. Bernard, were also studied because they are
similar to the C. matruchotii reference strains ATCC 33449 and ATCC 33822.
Media and biochemical tests.
The broth culture medium was
heart infusion broth (HIB; Difco Laboratories, Detroit, Mich.)
supplemented with 0.2% Tween 80 (Difco Laboratories) (HIB-T). For
strains that grew poorly in HIB-T broth, a half-strength recipe of
HIB-T supplemented with 0.2% yeast extract (Difco Laboratories) and
0.2 µg of hemin/ml (Sigma Chemical Co., St. Louis, Mo.) (0.5 HIB-T/YH) was prepared as recommended by Marion Gilmour (personal
communication). Heart infusion agar supplemented with 5% sheep blood
(University Hospital Microbiology Media Room) was used for routine
subcultures and for overnight cultures that were used to inoculate
conventional biochemical tests. Trypticase soy agar supplemented with
5% sheep blood (TSBA; Prepared Media Labs, Tualatin, Oreg.) was used
for all morphology studies.
Conventional biochemical tests were done as described by Krech and
Hollis (18), including enteric fermentation media with Andrade indicator. Inocula for the Rapid CORYNE strips were harvested from overnight cultures on two to four heart infusion blood agar plates. As previously described by Gavin et al., all strains were tested with the CORYNE strips according to the manufacturer's instructions (12). For confirmation of 24-h results, the
carbohydrate reactions in the strip also were read after incubation for
48 h. API profile numbers were referenced to the version 2 database.
GLC.
Whole-cell fatty acid analyses were performed as
previously described (7). The organisms were grown on
TSBA. To obtain sufficient biomass of early-stationary-phase cells, one
to three plates were inoculated and incubated at 35°C in an aerobic
atmosphere with 5% CO2 for up to 3 days, depending on each
strain's growth rate. Whole-cell fatty acid composition was determined
by gas-liquid chromatography (GLC) with the Microbial ID, Inc. (MIDI)
system, and data were analyzed with the library generation software of MIDI, which is a program that provides two-dimensional cluster plots as
well as dendrograms based on cluster analysis. The two-dimensional plots were based on principal component analysis. Principal Component 1 is the component responsible for the greatest degree of variability among the samples tested and is represented on the horizontal axis.
Principal Component 2 is responsible for the second greatest degree of
variability and is displayed on the vertical axis. The scale for both
axes is the Euclidean distance.
DNA-DNA hybridization.
Chromosomal DNA was prepared from
cells that were incubated by shaking at 37°C for 48 h in 200 mL
of HIB-T or the 0.5 HIB-T/YH broth. The DNA extraction procedure was
described previously (6). The DNA-DNA hybridization
method, using the NEBlot Phototope kit (New England Biolabs, Inc.,
Beverly, Mass.) and the PolarPlex Chemiluminescent Blotting kit (New
England Biolabs, Inc.), was performed as described by Springer et al.
(20) by using established conditions that allowed 26 to
27% mismatch for DNA with G+C content of 55 to 58 mol%. So that
target DNAs immobilized on the membrane could be reused for subsequent
DNA-DNA hybridizations, hybridized probe DNA was removed according to
the manufacturer's instructions.
16S rRNA gene sequencing.
In order to select hypervariable
regions likely to be unique for each taxon, the 16S rRNA gene sequences
in nine Corynebacterium species were compared using the
Baylor College of Medicine search launcher ClustalW (version 1.6)
alignment method. Two regions of over 40 bp in length were chosen and
termed hypervariable region 1, corresponding to Escherichia
coli 16S rRNA positions 177 to 218, and hypervariable region 2, corresponding to positions 988 to 1034.
Two primer sets were designed for the amplification of hypervariable
region 1 and hypervariable region 2: Primer 1 (5'GGTGAGTAACACGTGGGTGA3', corresponding to E. coli 16S rRNA positions 103 to 122); Primer 1R
(5'ATTACCCCACCAACAAGCTG3', corresponding to positions 255 to 236); Primer 2 (5'CCGCAAGGCTAAAACTCAAA3', corresponding to
positions 887 to 906); and Primer 2R (5'CCAACATCTCACGACACGAG3',
corresponding to positions 1078 to 1059).
The GeneAmp PCR Core Reagents kit (Perkin-Elmer Corporation, Foster
City, Calif.) was used according to the guidelines provided by the
manufacturer, allowing for a MgCl2 concentration of 1.5 mM.
The Thermal Cycler 480 (Perkin-Elmer Cetus Instruments, Foster City,
Calif.) was used for temperature cycling. The initial template melting
step (95°C, 2 min) was followed by 35 cycles of melting (94°C, 1 min), annealing (55°C, 1 min for hypervariable region 1; and 50°C,
1 min for hypervariable region 2), and extending (72°C, 2 min). The
final extension time was increased to 8 min, and the resulting products
were stored at 4°C.
The sequencing of the entire 16S rRNA gene of strain ATCC 43833 was
done as described by Kattar et al. (16).
After amplification, mineral oil was removed by the addition of
chloroform (J.T. Baker, Phillipsburg, N.J.). Microcon-50
microconcentrators (Amicon, Inc., Beverly, Mass.) were used according
to the manufacturer's instructions to remove excess primers and
deoxynucleoside triphosphates from the PCR-generated amplicons.
The ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction kit
(Perkin-Elmer Corporation) was used for sequencing reactions, according
to the manufacturer's instructions. MicroSpin G-50 columns (Pharmacia
Biotech, Piscataway, N.J.) were used to remove unincorporated dye-labeled dideoxynucleotide terminators.
Depending upon their availability for service, automated sequencing was
carried out by the University of Washington Sequencing Facility of the
Department of Biochemistry or the DNA Core Facility of the Department
of Pharmacology using the ABI Prism 377 and the ABI Prism 373 DNA
sequencers, respectively.
Nucleotide sequence accession number.
The full sequence of
the 16S rRNA gene of strain ATCC 43833 has been deposited in GenBank
with accession number AF262996.
 |
RESULTS |
Whole-cell fatty acid analyses.
Fatty acid profiles of all
strains were analyzed with the library generation software of MIDI,
resulting in the two-dimensional plot shown in Fig.
1. The computerized cluster analysis
demonstrated three defined clusters, which were assigned the
designations of group A (ATCC 14266T, ATCC 14265, ATCC
33806, ATCC 43832, L2, and Richardson 13), group B (ATCC 33449, ATCC
33822, LCDC 81-379, LCDC 86-376, and LCDC 91-086), and group C (ATCC
43833). A dental clinical isolate of C. matruchotii is
included in the figure. The major fatty acid peaks of the group A (true
C. matruchotii) strains and the group B (true C. durum) strains were palmitic, oleic, and stearic acid (Table
1). The remaining fatty acids detected by
the MIDI system (not listed) are believed to be the products of mycolic
acid degradation, which occurs at the high temperature in the system's
injection port (11).

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 1.
Two-dimensional plot generated by principal component
analysis of fatty acid profiles showing the distribution of strains
that are listed in Table 1. Circles, group A C. matruchotii;
triangles, group B C. durum; squares, group C strain ATCC
43833. Data from repeat analyses are included. Strains: a, ATCC 14266;
b, ATCC 14265; c, ATCC 33806; d, ATCC 43832; e, L2; f, Richardson's
13; g, ATCC 33449; h, ATCC 33822; i, LCDC 81-379; j, LCDC 86-376; k,
LCDC 91-086; l, ATCC 43833; m, a dental isolate of C. matruchotii. Numbers on the axes indicate the Euclidean
distance.
|
|
In the unique strain, ATCC 43833, the major cellular fatty acid (39%)
was one of two compounds that the MIDI system cannot distinguish,
either 15:0 ISO 2OH/16:1
7t or 16:1
7t/15i2OH. Other major peaks
were 16:0 (27%), 18:1
9c (20%), and 16:1
5c (6%).
DNA-DNA hybridization.
Representative lumigraphs of DNA
dot blots for 11 of the 12 strains in this study are shown in
Fig. 2. Because the DNA yield was low
from strain ATCC 33806, it was excluded from the dot blot study.
Whole-cell DNA probes for hybridization were selected on the basis of
GLC groupings. DNA from strains in each GLC group hybridized only with
the DNA probes from strains in their respective group. DNA from the
single group C strain (ATCC 43833) hybridized only with autologous DNA.
The DNA dot blot results were in complete agreement with the groupings
indicated by the MIDI cluster analysis from cellular fatty acid
profiles.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
DNA-DNA homology studies with solid-phase dot blot
hybridizations. Probe and target DNAs are indicated.
|
|
16S rRNA sequencing.
Sequencing of the two selected
hypervariable regions confirmed the GLC and DNA group divisions (Fig.
3). The sequences from GLC group A
strains correlated well with the published sequence of the C. matruchotii type strain. For four of the five strains in group B,
the sequences of the two variable regions were almost identical to that
published for C. durum (19). The sequence of
variable region 1 in strain ATCC 33822 differed from that of C. durum by eight bases. The single strain in group C (ATCC 43833) has a unique sequence differing from any sequences accessible by BLAST
searches of all nonredundant GenBank, EMBL (European Bioinformatics
Institute), and DDBJ (DNA Data Bank of Japan) sequences.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 3.
Alignment of sequences of two variable regions in the
16S rRNA gene. GenBank sequences of C. matruchotii and
C. durum were used as references and compared with those
found in this study. Bold bases for C. durum indicate
differences from the C. matruchotii sequence. The first and
last nucleotides of regions 1 and 2 correspond to E. coli
16S rRNA positions 177 to 218 and 988 to 1034, respectively.
|
|
Morphology.
When grown in air or a CO2-enriched
atmosphere for 48 h at 37°C on TSBA, all strains in this study
produced colonies about 1 mm in diameter. Four of the six true
C. matruchotii colonies were white, cream, or gray with a
smooth matte surface and creamy texture when touched with a loop.
Colonies of strains ATCC 33806 and Richardson's 13 had a crinkled
surface and lifted as a single dry colony when touched by a wire loop.
When grown in the presence of CO2, these two strains
produced distinct pits in the agar.
The C. durum strains (ATCC 33449, ATCC 33822, LCDC 81-379, LCDC 86-376, and LCDC 91-086) produced tiny gray-white or cream-colored colonies with a dry or matte surface. When C. durum strains
were cultured in an aerobic atmosphere, all of the colonies had a gummy texture and four of the five strains caused pitting of the agar medium.
When grown in a CO2-enriched atmosphere, the C. durum colonies had a creamy texture on their surface while the
remainder of each colony was gummy and adherent to the medium. Only
strain LCDC 86-376 produced pits when grown in the presence of
CO2. Colonies of strain ATCC 43833 were pinpoint to 0.1 mm
in diameter, gray-white, and had a smooth, nonadherent texture.
During the first 6 months of this study, the three taxa had distinct
Gram stain morphologies that showed little variance with time and
growth media. The six true C. matruchotii strains
demonstrated the whip handle that is typical of this species (Fig.
4). The five C. durum strains
produced pleomorphic coryneform rods with granules or beads
but not filaments. In an aerobic atmosphere the novel strain, ATCC
43833, produced very short but relatively broad gram-positive rods in
diphtheroid-like clusters. In the presence of CO2, this
strain produced pleomorphic rods in a variety of sizes. Following
multiple serial subcultures during a 2-year period, the C. matruchotii strains lost their characteristic whip handle
cellular morphology, with the exception of rare filaments.

View larger version (147K):
[in this window]
[in a new window]
|
FIG. 4.
The Gram stain morphology of C. matruchotii
after growth on blood agar in a CO2-enriched atmosphere at
37°C for 48 h. Arrows indicate whip handle morphology.
|
|
All the strains in this study grew better in 0.5 HIB-T/YH than
in HIB or HIB-T. The greatest growth enhancement in 0.5 HIB-T/YH broth occurred with the true C. matruchotii strains.
Biochemical tests.
The results from conventional biochemical
tests and the numerical profiles of the reactions from the Rapid CORYNE
system are shown in Table 2. The
production of pyrrolidonyl arylamidase was the only trait that
consistently distinguished C. matruchotii strains from
C. durum strains. The atypical strain, ATCC 43833, was
unique in its failure to reduce nitrate and its production of alkaline
phosphatase. The conventional esculin test was negative for all
strains, whereas it was positive in the CORYNE strip for 9 of the 12 strains. In contrast, the CORYNE strip did not detect urease activity
in two of the four C. durum strains that were urease
positive in the conventional test. Two of the five C. durum isolates yielded both positive and negative reactions when tested three
times in conventional mannitol broth. With the exception of one
isolate, repeat testing of C. durum isolates for production of acid in galactose also yielded contradictory results.
 |
DISCUSSION |
Evidence from biochemical reactions, fatty acid analysis, DNA
hybridization, and 16S rRNA hypervariable region sequencing shows that
the seven strains deposited in the ATCC as C. matruchotii actually are diverse organisms including four true C. matruchotii strains, two C. durum strains, and a single
unique strain that probably represents a novel taxon. The group
corresponding to the C. matruchotii type strain was clearly
and correctly described by Marion Gilmour and colleagues
(13).
Gilmour and Turner described C. matruchotii as a pleomorphic
organism whose variability in colonial morphology is a consequence of
mode of reproduction, culture age, and cultivation conditions (14). They described a rough-to-intermediate-to-smooth
morphological variation. When our biochemical results are examined, it
is apparent that the true C. matruchotii strains have the
biochemical reactions described in Bergey's Manual of Systematic
Bacteriology (15). The API system, which does not
include C. matruchotii, provides no identification for many
of the strains in this study. Strains ATCC 33806, ATCC 43833, and
Richardson's 13 are assigned to the genus Corynebacterium,
and strain ATCC 33822 has a "good identification" as Listeria
grayi.
Biochemical tests do not readily distinguish C. durum from
C. matruchotii. The only API CORYNE test in which they
consistently differ is the pyrrolidonyl arylamidase reaction, which
occurred with the six C. matruchotii strains but with none
of the five C. durum strains in this study. This difference
is consistent with two earlier studies that tested a total of 63 C. durum isolates, none of which had pyrrolidonyl
arylamidase activity (19, 24). The C. durum
species is biochemically diverse. Within isolates from 58 cultures of
healthy throats, von Graevenitz et al. found 8 API CORYNE profile
numbers, none of which is identical to the four profile numbers in this
study (24).
Riegel et al. noted that all five of their C. durum isolates
produced acid from mannitol and galactose, which helped to distinguish them from C. matruchotii (19). However, when we
tested our C. durum isolates on Hugh Leifson's
oxidation-fermentation medium as used by Reigel, no acid was detected
in mannitol or galactose. Using the in-house peptone water fermentation
broth with Andrade indicator that the Centers for Disease Control and
Prevention recommends for testing coryneforms (18), we did
repeat tests with mannitol and galactose. Two of the C. durum strains were consistently positive with mannitol, one was
negative, and results with two strains were not reproducible. Four of
the C. durum strains also had inconsistent results in repeat
galactose testing (Table 2). An additional study of these strains'
reactions on both mannitol and galactose in peptone water broth from
two providers revealed differences in the frequency of positive results
(data not shown). The differences in urease activity and esculin
hydrolysis observed between the Rapid CORYNE system and conventional
tests might be attributed to the different basal media in these two systems.
It was surprising to find that our strains of C. durum did
not fit the colonial morphology described by Riegel et al., who selected the species name to reflect its strong adherence when grown in
an aerobic atmosphere on TSBA (19). When Riegel's strains were cultured on TSBA in the presence of CO2, they were not
adherent. Our C. durum strains on TSBA responded to the
atmosphere in the reverse manner, with gummy adherence seen only in the
presence of CO2. The differences between our strains and
Riegel's strains of C. durum might be attributed to the
fact that our strains originally were deposited in the ATCC as C. matruchotii or were reported to closely resemble C. matruchotii, which might represent a unique subset of C. durum strains. Furthermore, the original specimens for our strains
and the Riegel strains were quite different. In contrast to the five
C. durum isolates described by Riegel et al., only one of
the C. durum strains in the present study (LCDC 81-379) had
been recovered from sputum. ATCC strains 33449 and 33822 were from a
gingival margin and subgingival plaque, respectively, and LCDC strains
91-086 and 86-376 were isolated from blood and a foot abscess, respectively.
Within the true C. matruchotii strains, the sequences of
hypervariable regions 1 and 2 plus flanking regions differed at only one position, in which the guanine of the type strain was replaced by
an adenine in the other five strains. All but one of the C. durum strains also exhibited highly conserved sequences that
varied in only two contiguous bases that were either two cytosines or two thymidines. However, the sequence of hypervariable region 1 in
C. durum ATCC 33822 differed from that of the type strain by
eight bases. Because this strain was consistent with the species C. durum in DNA dot blots, fatty acid analyses, and
biochemical reactions, it seems likely that this is the correct
identification. Intraspecies variation in the sequences of 16S rRNA has
been reviewed by Clayton et al., who concluded that some of the
sequence heterogeneity observed within species may be due to
interoperon differences (4). We have notified the ATCC of
the corrected identifications of C. durum strains ATCC 33449 and ATCC 33822.
C. matruchotii has been used by a number of researchers as a
microbiologic model for intracellular calcification (1, 3, 8, 9,
21, 25). The organism has provided valuable information regarding calcification of bioprostheses (17), dental
plaque (10), and the principles of membrane-mediated
proteolipid-dependent calcification in vertebrate systems
(2). It is important to note that the diversity found in
this study does not affect the conclusions of pathogenesis studies with
C. matruchotii. The vast majority of earlier studies have
relied on results from one or more of four strains, namely ATCC 14265, ATCC 14266, L2, and Richardson 13, all of which we have confirmed to be
true C. matruchotii strains.
 |
ACKNOWLEDGMENT |
We thank Marion N. Gilmour for providing reprints and her
invaluable advice for acquiring reference strains and optimizing the
growth of C. matruchotii.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Harborview
Medical Center, Box 359743, 325 9th Ave., Seattle, WA 98104. Phone:
(206) 731-3311. Fax: (206) 731-3930. E-mail:
mbcoyle{at}u.washington.edu.
 |
REFERENCES |
| 1.
|
Boyan, B. D., and A. L. Boskey.
1984.
Co-isolation of proteolipids and calcium-phospholipid-phospate complexes.
Calcif. Tissue Int.
36:214-218[CrossRef][Medline].
|
| 2.
|
Boyan, B. D.,
W. J. Landis,
J. Knight,
G. Dereszewski, and J. Zeagler.
1984.
Microbial hydroxyapatite formation as a model of proteolipid-dependent membrane-mediated calcification.
Scanning Electron Microsc.
4:1793-1800.
|
| 3.
|
Boyan-Salyers, B. D., and A. L. Boskey.
1980.
Relationship between proteolipids and calcium-phosphate complexes in Bacterionema matruchotii calcification.
Calcif. Tissue Int.
30:167-174[CrossRef][Medline].
|
| 4.
|
Clayton, R. A.,
G. Sutton,
P. S. Hinkle, Jr.,
C. Bult, and C. Fields.
1995.
Intraspecific variation in small-subunit rRNA sequences in GenBank: why single sequences may not adequately represent prokaryotic taxa.
Int. J. Syst. Bacteriol.
45:595-599[Abstract/Free Full Text].
|
| 5.
|
Collins, M. D.,
M. Goodfellow, and D. E. Minnikin.
1982.
A survey of the structures of mycolic acids of the genus Corynebacterium and possibly related taxa.
J. Gen. Microbiol.
128:129-149[Medline].
|
| 6.
|
Coyle, M. B.,
N. B. Groman,
J. Q. Russell,
J. P. Harnisch,
M. Rabin, and K. K. Holmes.
1989.
The molecular epidemiology of three biotypes of Corynebacterium diphtheriae in the Seattle outbreak of 1972-1982.
J. Infect. Dis.
159:670-679[Medline].
|
| 7.
|
Coyle, M. B.,
R. B. Leonard,
D. J. Nowowiejski,
A. Malekniazi, and D. J. Finn.
1993.
Evidence of multiple taxa within commercially available reference strains of Corynebacterium xerosis.
J. Clin. Microbiol.
31:1788-1793[Abstract/Free Full Text].
|
| 8.
|
Damen, J. J. M., and J. M. Ten Cate.
1992.
Silica-induced precipitation of calcium-phosphate in the presence of inhibitors of hydroxyapatite formation.
J. Dent. Res.
71:453-457[Abstract/Free Full Text].
|
| 9.
|
Ennever, J.
1960.
Intracellular calcification by oral filamentous microorganisms.
J. Periodontol.
31:304.
|
| 10.
|
Ennever, J.,
J. Vogel,
L. Rider, and S. Paoloski.
1977.
Proteolipid and calculus matrix calcification in vitro.
J. Dent. Res.
56:140-142[Abstract/Free Full Text].
|
| 11.
|
Funke, G.,
P. A. Lawson, and M. D. Collins.
1995.
Heterogeneity within human-derived Centers for Disease Control and Prevention (CDC) coryneform group ANF-1-like bacteria and description of Corynebacterium auris sp. nov.
Int. J. Syst. Bacteriol.
45:735-739[Abstract/Free Full Text].
|
| 12.
|
Gavin, S. E.,
R. B. Leonard,
A. M. Briselden, and M. B. Coyle.
1992.
Evaluation of the Rapid CORYNE identification system for Corynebacterium species and other coryneforms.
J. Clin. Microbiol.
30:1692-1695[Abstract/Free Full Text].
|
| 13.
|
Gilmour, M. N.,
A. Howell, Jr., and B. G. Bibby.
1961.
The classification of organisms termed Leptotrichia (Leptothrix) buccalis.
Bacteriol. Rev.
25:131-141[Free Full Text].
|
| 14.
|
Gilmour, M. N., and P. A. Turner.
1974.
Culture purity assessments and morphological dissociation in the pleomorphic microorganisms Bacterionema matruchotii.
Appl. Microbiol.
27:1134-1141[Medline].
|
| 15.
|
Jones, D., and M. D. Collins.
1986.
Irregular, nonsporing gram-positive rods, p. 1261-1266.
In
P. H. A. Sneath, N. S. Mair, M. E. Sharpe, and J. G. Holt (ed.), Bergey's manual of systematic bacteriology, vol. 2. Williams & Wilkins Co., Baltimore, Md.
|
| 16.
|
Kattar, M. M.,
J. F. Chavez,
A. P. Limaye,
S. L. Rassoulian-Barrett,
S. L. Yarfitz,
L. C. Carlson,
Y. Houze,
S. Swanzy,
B. L. Wood, and B. T. Cookson.
2000.
Application of 16S rRNA gene sequencing to identify Bordetella hinzii as the causative agent of fatal septicemia.
J. Clin. Microbiol.
38:789-794[Abstract/Free Full Text].
|
| 17.
|
Knight, J. P.,
J. A. Torell, and R. E. Hunter.
1984.
Bacterial associated porcine heterograft heart valve calcification.
Am. J. Cardiol.
53:370-372[CrossRef][Medline].
|
| 18.
|
Krech, T., and D. G. Hollis.
1991.
Corynebacterium and related organisms, p. 277-286.
In
A. Balows, W. L. Hausler, Jr., K. L. Herrmann, H. D. Isenberg, and H. J. Shadomy (ed.), Manual of clinical microbiology, 5th ed. American Society for Microbiology, Washington, D.C.
|
| 19.
|
Riegel, P.,
R. Heller,
G. Prevost,
F. Jehl, and H. Monteil.
1997.
Corynebacterium durum sp. nov. from human clinical specimens.
Int. J. Syst. Bacteriol.
47:1107-1111[Abstract/Free Full Text].
|
| 20.
|
Springer, B.,
W. K. Wu,
T. Bodmer,
G. Haase,
G. E. Pfyffer,
R. M. Kroppenstedt,
K.-H. Schroder,
S. Emler,
J. O. Kilburn,
P. Kirschner,
A. Telenti,
M. B. Coyle, and E. C. Botter.
1996.
Isolation and characterization of a unique group of slowly growing mycobacteria: description of Mycobacterium lentiflavum sp. nov.
J. Clin. Microbiol.
34:1100-1107[Abstract].
|
| 21.
|
Swain, L. D., and B. D. Boyan.
1988.
Ion-translocating properties of calcifiable proteolipids.
J. Dent. Res.
67:526-530[Abstract/Free Full Text].
|
| 22.
|
Takazoe, I., and T. Itoyama.
1980.
Analytical electron microscopy of Bacterionema matruchotii calcification.
J. Dent. Res.
59:1090-1094[Abstract/Free Full Text].
|
| 23.
|
Takazoe, I., and T. Nakamura.
1965.
The relation between metachromatic granules and intracellular calcification of Bacterionema matruchotii.
Bull. Tokyo Dent. Coll.
6:29-42.
|
| 24.
|
von Graevenitz, A.,
V. Punter-Streit,
P. Riegel, and G. Funke.
1998.
Coryneform bacteria in throat cultures of healthy individuals.
J. Clin. Microbiol.
36:2087-2088[Abstract/Free Full Text].
|
| 25.
|
Wilhelmus, K. R.,
N. M. Robinson, and D. B. Jones.
1979.
Bacterionema matruchotii ocular infections.
Am. J. Ophthalmol.
87:143-147[Medline].
|
Journal of Clinical Microbiology, March 2001, p. 943-948, Vol. 39, No. 3
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.3.943-948.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bernard, K. A., Munro, C., Wiebe, D., Ongsansoy, E.
(2002). Characteristics of Rare or Recently Described Corynebacterium Species Recovered from Human Clinical Material in Canada. J. Clin. Microbiol.
40: 4375-4381
[Abstract]
[Full Text]