Previous Article | Next Article 
Journal of Clinical Microbiology, April 2001, p. 1227-1230, Vol. 39, No. 4
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.4.1227-1230.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Novel Mycobacterium Related to Mycobacterium
triplex as a Cause of Cervical Lymphadenitis
Rohan
Hazra,1
Margaret M.
Floyd,2
Alexander
Sloutsky,3 and
Robert N.
Husson1,*
Division of Infectious Diseases, Children's
Hospital,1 and Mycobacteriology
Laboratory, Massachusetts State Laboratory
Institute,3 Boston, Massachusetts, and
National Center for Infectious Diseases, Centers for
Disease Control and Prevention, Atlanta, Georgia2
Received 21 September 2000/Returned for modification 7 November
2000/Accepted 10 January 2001
 |
ABSTRACT |
The Mycobacterium avium complex (MAC) is an important
cause of cervical lymphadenitis in children, and its incidence appears to be increasing in the United States and elsewhere. In areas where
Mycobacterium tuberculosis is not prevalent, M. avium causes the vast majority of cases of mycobacterial
lymphadenitis, although several other nontuberculous mycobacterial
species have been reported as etiologic agents. This report describes
the case of a child with cervical lymphadenitis caused by a
nontuberculous mycobacterium that could not be identified using
standard methods, including biochemical reactions and genetic probes.
Direct 16S ribosomal DNA sequencing showed greater than 99% homology
with Mycobacterium triplex, but sequence analysis of the
283-bp 16S-23S internal transcribed spacer (ITS) sequence showed only
95% identity, suggesting that it is a novel species or subspecies
within a complex of organisms that includes M. triplex.
Mycolic acid high-performance liquid chromatography analysis also
identified this isolate as distinct from M. triplex, and
differences in susceptibility to streptomycin and rifampin between this
strain and M. triplex were also observed. These data
support the value of further testing of clinical isolates that test
negative with the MAC nucleic acid probes and suggest that standard
methods used for the identification of mycobacteria may underestimate
the complexity of the genus Mycobacterium. ITS sequence
analysis may be useful in this setting because it is easy to perform
and is able to distinguish closely related species and subspecies. This
level of discrimination may have significant clinical ramifications, as
closely related organisms may have different antibiotic susceptibility patterns.
 |
INTRODUCTION |
The Mycobacterium avium
complex (MAC) is an important cause of cervical lymphadenitis in
children, and its incidence appears to be increasing in the United
States and elsewhere. Surgical excision achieves a high cure rate, but
complete excision is often not feasible. Antibiotic therapy may be of
benefit in some cases (12, 13).
M. avium causes the vast majority of cases of lymphadenitis
in these children, although several other nontuberculous mycobacterial species have been reported as etiologic agents, including M. bohemicum, M. celatum, M. genavense, M. haemophilum, M. heidelbergense,
M. interjectum, M. intracellulare, M. lentiflavum, M. malmoense, and M. triplex (1, 6, 8-10, 12, 15, 19, 20).
Species identification has generally been performed using biochemical tests and 16S ribosomal DNA (rDNA) gene sequence analysis. However, 16S
rDNA sequence variability among selected mycobacterial species is
limited. The 16S-23S rDNA internal transcribed spacer (ITS) is
transcribed, but it does not code for a functional product and
therefore is not as highly conserved as 16S rDNA. This sequence heterogeneity may serve to differentiate mycobacterial species whose
16S rDNA sequences are closely related or identical.
Here we report the case of a child with cervical lymphadenitis due to a
nontuberculous mycobacterium that could not be identified using
standard methods: Direct 16S rDNA sequencing showed greater than 99%
identity with M. triplex, but ITS sequence analysis suggests that it is a novel species or subspecies within a complex of organisms that includes M. triplex. M. triplex belongs to a group of
slowly growing mycobacteria that resemble M. avium by
conventional biochemical tests, but commercial nucleic acid probes
designed to detect species of MAC are negative when tested against this
group of organisms (6).
 |
CASE REPORT |
(This case was included in a previously reported study evaluating
treatment of nontuberculous mycobacterial lymphadenitis [12]).
A 4-year-old Caucasian girl was admitted to the hospital with a 1-week
history of left preauricular erythematous swelling and a 1-day history
of left submandibular swelling. Physical examination revealed a 2- by
2-cm warm, slightly tender left preauricular node and a 2.5- by 2.5-cm
left submandibular node. She was treated with intravenous cefazolin
with no response. She was taken to the operating room, where incision
and drainage of the submandibular node and needle aspiration of the
preauricular node were performed. An acid-fast stain of the material
obtained was positive, and her antibiotics were switched to
clarithromycin, rifampin, and ethambutol. Over the next few months she
had persistent drainage from the preauricular node, and both lesions
developed an overlying violaceous hue. Rifampin was replaced by
rifabutin. Five months after initial presentation, while on
clarithromycin, ethambutol, and rifabutin, she developed left anterior
cervical adenitis with an overlying violaceous hue. At this time her
other lesions appeared to be healing. Surgical excision of anterior
cervical nodes was performed, and clofazimine was added to her regimen.
By 1 year, the older lesions had dried up, with scar tissue palpable on
exam and a persistent overlying violaceous hue. Medications were then discontinued. Four years after initial presentation the patient's family reported that she had had no recurrences, that the preauricular area had healed completely, and that she was left with a faint scar in
the cervical area.
 |
MATERIALS AND METHODS |
Bacterial strain.
The strain, designated RH 287, was
isolated from a mycobacterial culture of the lymph node tissue of a
child with lymphadenitis using standard methods at the Massachusetts
State Tuberculosis Laboratory. Briefly, the specimen was decontaminated
using the standard N-acetyl-L-cysteine and NaOH
procedure followed by centrifugation. The sediment was then set up for
growth on solid (Lowenstein-Jensen and Middlebrook 7H10) and liquid
(MGIT; BD Biosciences, Franklin Lakes, N.J.) media. The positive
culture was tested with a commercial MAC molecular probe (GenProbe, San
Diego, Calif.).
Phenotypic analysis.
Biochemical tests were performed using
standard methods (16). Susceptibility testing was
performed using the proportion method on solid media and in liquid
broth medium (BACTEC; BD Biosciences) (16). Mycolic acid
analysis was performed at the mycobacteriology laboratory of the
Centers for Disease Control and Prevention according to established
procedures (2). Briefly, whole cells of mycobacteria were
saponified in methanolic potassium hydroxide solution and autoclaved
for 1 h at 121°C. The saponified sample was acidified with
concentrated HCl and water (1:1) and extracted from the aqueous solution with chloroform. The mycolic acids were derivatized to bromophenacyl esters with para-bromophenacyl-8 (Pierce
Chemical, Rockford, Ill.). The derivatized sample was separated by
reverse-phase high-performance liquid chromatography (HPLC) with a
C18 column using a gradient elution of methanol and
methylene chloride (3). The chromatographic pattern
generated by this method was matched to standard HPLC patterns of
authentic species using relative retention time ratios for peaks
calculated by the chromatographic software. The ratios were derived
using a high-molecular-weight standard (Ribi ImmunoChem Research, Inc.,
Hamilton, Mont.) as the reference peak.
Genotypic analysis.
Cultures were inoculated from
Lowenstein-Jensen slants into Middlebrook 7H9 medium supplemented with
0.2% glucose, 0.5% albumin. 0.085% NaCl, and 0.05% Tween 80. Liquid
cultures were grown for 2 to 4 weeks. Mycobacterial DNA was isolated
using N-cetyl-N,N,N-trimethylammonium bromide as
described previously (21). For the ITS PCR, primers 16S
(5' TTGTACACACCGCCCGTCA) and 23S (5'
CGATGCCAAGGCATCCACC), as described previously (4),
were used to amplify a 490-bp product from 2 to 5 µl (40 to 80 ng as
estimated from ethidium bromide-stained gels) of each mycobacterial DNA
sample using the Expand high-fidelity PCR system (Boehringer GmbH,
Mannheim, Germany). This amplicon includes the entire ITS region and
flanking 16S and 23S rDNA. PCRs were carried out in a total volume of
50 µl with 0.5 µM (each) primer, 250 µM (each) nucleotide, 5 µl
of 10× buffer (with 15 mM MgCl2), and 0.5 µl of enzyme
(3.5 U/µl). At least one negative control (sterile water) was
included with each set of PCRs. PCR products were purified for
sequencing using the QIAquick PCR purification kit (Qiagen, Santa
Clarita, Calif.).
Sequencing was performed on ABI 373A and 377 automated DNA sequencers
using Taq dye terminator chemistry (Applied Biosystems, Foster City, Calif.) at the core sequencing facility of the Children's Hospital Mental Retardation Research Center. The 16S primer was used
for initial sequencing. If ambiguous bases were seen, the 23S primer
was used for a sequencing reaction on the complementary strand to
resolve the ambiguity. The sequence was compared to ITS DNA sequences
in GenBank, and analysis was performed using Sequencher (Gene Codes
Corporation, Ann Arbor, Mich.).
PCR amplification of 16S rDNA was done with oligonucleotides 5'
GAGAGTTTGATCCTGGCTCAG and 5' AAGGAGGTGATCCAGCCGCA, as
described
previously (
5,
17). Direct sequencing was
performed on an
ABI 373A sequencer. The sequence of 16S hypervariable
region A
was compared to 16S rDNA information in
GenBank.
Nucleotide sequence accession numbers.
The GenBank
nucleotide accession number of the 16S-23S ITS sequence of this isolate
is AF-214587. The accession number of the M. triplex ITS
sequence is AF334028.
 |
RESULTS |
The isolate grew as slightly yellow, smooth colonies within 24 days when incubated at 37°C. No growth was seen at 22 or 45°C. The
isolate did not hybridize with the commercially available genetic probe
for MAC (GenProbe). The results of susceptibility testing and
biochemical reactions of this strain, compared to those of M. avium and M. triplex, are shown in Table
1. These results are consistent with this
organism being similar to, yet distinct from, these species.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Biochemical analysis and drug susceptibility of strain RH
287 compared to those of M. avium and M. triplex
|
|
The HPLC mycolic acid pattern for this isolate was reported to be that
of an unidentified mycobacterium species. The chromatographic pattern
did not match that of any species described in the HPLC standard method
manual but resembled that of a group of organisms designated SAV by the
Centers for Disease Control and Prevention (2). The SAV
organisms are mycobacteria which exhibit mycolic acid patterns similar
to those of M. simiae, M. lentiflavum, and M. triplex but which biochemically are consistent with the M. avium complex (6). Among these species, the HPLC
pattern of this isolate most closely resembled that of M. triplex (Fig. 1).
Because the biochemical and HPLC results were not definitive, genotypic
testing was done. Examination of the 142 bp of 16S rDNA hypervariable
region A of the isolate we studied revealed a 99.6% similarity to that
of M. triplex (6). However, the 283-bp ITS
sequence of this strain was unique, showing 95% identity with the ITS
region of the M. triplex type strain, which is 100% identical to the one other reported M. triplex ITS sequence
(18). The ITS sequence of this isolate showed 81%
similarity to the most common M. avium ITS sequence, which
has been designated the Mav-B sequevar (Fig.
2) (11).
 |
DISCUSSION |
Standard biochemical and molecular probe analysis could not assign
isolate RH 287 to a known mycobacterial species. The probe for MAC was
negative, and the biochemical tests, while similar to those for
M. avium and M. triplex, were not definitive,
with the most obvious differences being the presence of pigmentation and susceptibility to streptomycin and rifampin. The HPLC mycolic acid
pattern and 16S rDNA sequence for this isolate most closely resembled
those of M. triplex. Most mycobacterial species show a
unique signature sequence in hypervariable region A within the 16S
ribosomal gene; however, M. kansasii and M. gastri have identical 16S rDNA sequences, as do M. ulcerans and M. marinum. In addition, members of the
M. tuberculosis complex have identical 16S rDNA sequences
(14).
Because of the high degree of sequence similarity of the 16S rDNA genes
of several mycobacterial species, further sequence analysis of the
16S-23S ITS region was performed. These results revealed a level of
difference similar to that between species within the MAC. For example,
the ITS sequence of the most common M. avium sequevar,
Mav-B, differs by 6% from that of M. intracellulare sequevar Min-A and by between 5 and 11% from those of various sequevars of a third group of MAC strains (7). A study
comparing the ITS sequences of 17 mycobacterial species revealed that
the lowest level of ITS sequence divergence between any two species is
4%, which represents a 13-nucleotide difference between the ITS
sequence of M. triplex and that of M. genavense
(18). Therefore, the 5% difference between the ITS
sequence of RH 287 and that of M. triplex, combined with the
results of biochemical and mycolic acid testing, indicates that this
strain represents a unique species or subspecies within a complex of
organisms that includes M. triplex. Although the ITS
sequences of the M. triplex type strain and the other
reported M. triplex isolate are identical, because few
isolates of this species have been studied, it remains possible that
there is a range of variation in M. triplex ITS sequences
that will link this species to the novel isolate described in this report.
As demonstrated in this study, standard biochemical testing used for
the identification of mycobacteria may underestimate the complexity of
the genus Mycobacterium. Our data support the importance of
further testing of clinical isolates that test negative to the MAC
probe. In the clinical setting, obtaining reliable susceptibility data
is paramount, but studies to identify the organism may be valuable as
well. ITS sequence analysis may be beneficial in this setting because
it is rapid and easy to perform and is able to distinguish closely
related species and subspecies. This type of analysis may prove to have
important clinical ramifications, as closely related organisms may have
different antibiotic susceptibility patterns. For example, the isolate
we studied was susceptible to streptomycin and rifampin, whereas
M. triplex is resistant to these two drugs (6,
8).
The majority of cases of MAC lymphadenitis are caused by M. avium isolates belonging to the Mav-B sequevar (11).
The isolate we describe here must be added to a long list of organisms
similar to M. avium that have been identified as causes of
lymphadenitis in children (1, 6, 8-10, 12, 15, 19, 20).
Important questions regarding the epidemiology and pathogenesis of
disease caused by these organisms remain to be answered. It is unknown, for example, whether these species share virulence mechanisms with
M. avium that allow them to cause similar clinical disease. It is also unknown whether the higher frequency of isolation of M. avium in this setting is because this species is more
virulent than others or because it is more prevalent in the environment to which these children are exposed.
 |
ACKNOWLEDGMENTS |
R.H. was supported by the Warren-Whitman-Richardson Fellowship of
Harvard Medical School and a National Institutes of Health training
grant (T32AI-07061-22).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Infectious Diseases, Children's Hospital, 300 Longwood Ave.,
Boston, MA 02115. Phone: (617) 355-5151. Fax: (617) 355-8387. E-mail: robert.husson{at}tch.harvard.edu.
 |
REFERENCES |
| 1.
|
Armstrong, K.,
R. James,
D. Dawson,
P. Francis, and B. Masters.
1992.
Mycobacterium haemophilum causing perihilar or cervical lymphadenitis in healthy children.
J. Pediatr.
121:202-205[CrossRef][Medline].
|
| 2.
|
Butler, W.,
M. Floyd,
V. Silcox,
G. Cage,
E. Desmond,
P. Duffey,
L. Guthertz,
W. Gross,
K. Jost,
L. Ramos,
L. Thibert, and N. Warren.
1996.
Standard method for HPLC identification of mycobacteria.
Public Health Service, U.S. Department of Health and Human Services, Washington, D.C.
|
| 3.
|
Butler, W.,
K. Jost, and J. Kilburn.
1991.
Identification of mycobacteria by high performance liquid chromatography.
J. Clin. Microbiol.
29:2468-2472[Abstract/Free Full Text].
|
| 4.
|
De Smet, K.,
I. Brown,
M. Yates, and J. Ivanyi.
1995.
Ribosomal internal transcribed spacer sequences are identical among Mycobacterium avium-intracellulare complex isolates from AIDS patients, but vary among isolates from elderly pulmonary disease patients.
Microbiology
141:2739-2747[Abstract/Free Full Text].
|
| 5.
|
Edwards, U.,
T. Rogall,
H. Blocker,
M. Emde, and E. Bottger.
1989.
Isolation and direct sequencing of entire genes. Characterization of a gene coding for 16S ribosomal RNA.
Nucleic Acids Res.
17:7843-7853[Abstract/Free Full Text].
|
| 6.
|
Floyd, M.,
L. Guthertz,
V. Silcox,
P. Duffey,
Y. Jang,
E. Desmond,
J. Crawford, and W. Butler.
1996.
Characterization of an SAV organism and proposal of Mycobacterium triplex sp. nov.
J. Clin. Microbiol.
34:2963-2967[Abstract].
|
| 7.
|
Frothingham, R., and K. Wilson.
1993.
Sequence-based differentiation of strains in the Mycobacterium avium complex.
J. Bacteriol.
175:2818-2825[Abstract/Free Full Text].
|
| 8.
|
Haas, W.,
W. R. Butler,
P. Kirschner,
B. B. Plikaytis,
M. B. Coyle,
B. Amthor,
A. G. Steigerwalt,
D. J. Brenner,
M. Salfinger,
J. T. Crawford,
E. C. Bottger, and H. J. Bremer.
1997.
A new agent of mycobacterial lymphadenitis in children: Mycobacterium heidelbergense sp. nov.
J. Clin. Microbiol.
35:3203-3209[Abstract].
|
| 9.
|
Haase, G.,
H. Kentrup,
H. Skopnik,
B. Springer, and E. Bottger.
1997.
Mycobacterium lentiflavum: an etiologic agent of cervical lymphadenitis.
Clin. Infect. Dis.
25:1245-1246[Medline].
|
| 10.
|
Haase, G.,
H. Skopnik,
S. Batge, and E. Bottger.
1994.
Cervical lymphadenitis caused by Mycobacterium celatum.
Lancet
344:1020-1021[Medline].
|
| 11.
|
Hazra, R.,
S.-H. Lee,
J. Maslow, and R. Husson.
2000.
Related strains of Mycobacterium avium cause disease in children with AIDS and in children with lymphadenitis.
J. Infect. Dis.
181:1298-1303[CrossRef][Medline].
|
| 12.
|
Hazra, R.,
C. Robson,
A. Perez-Atayde, and R. Husson.
1999.
Lymphadenitis due to nontuberculous mycobacteria in children: presentation and response to therapy.
Clin. Infect. Dis.
28:123-129[Medline].
|
| 13.
|
Inderlied, C.,
C. Kemper, and L. Bermudez.
1993.
The Mycobacterium avium complex.
Clin. Microbiol. Rev.
6:266-310[Abstract/Free Full Text].
|
| 14.
|
Kirschner, P.,
B. Springer,
U. Vogel,
A. Meier,
A. Wrede,
M. Kiekenbeck,
F.-C. Bange, and E. Bottger.
1993.
Genotypic identification of mycobacteria by nucleic acid sequence determination: report of a 2-year experience in a clinical laboratory.
J. Clin. Microbiol.
31:2882-2889[Abstract/Free Full Text].
|
| 15.
|
Liberek, V.,
C. Soravia,
B. Ninet,
B. Hirschel, and C.-A. Siegrist.
1996.
Cervical lymphadenitis caused by Mycobacterium genavense in a healthy child.
Pediatr. Infect. Dis. J.
15:269-270[CrossRef][Medline].
|
| 16.
|
Nolte, F., and B. Metchock.
1995.
Mycobacterium, p. 400-437.
In
P. R. Murray, E. J. Baron, M. A. Pfaller, F. C. Tenover, and R. H. Yolken (ed.), Manual of clinical microbiology, 6th ed. American Society for Microbiology, Washington, D.C.
|
| 17.
|
Rogall, T.,
J. Wolters,
T. Flohr, and E. Bottger.
1990.
Towards a phylogeny and definition of species at the molecular level within the genus Mycobacterium.
Int. J. Syst. Bacteriol.
40:323-330[Abstract/Free Full Text].
|
| 18.
|
Roth, A.,
M. Fischer,
M. Hamid,
S. Michalke,
W. Ludwig, and H. Mauch.
1998.
Differentiation of phylogenetically related slowly growing mycobacteria based on 16S-23S rRNA gene internal transcribed spacer sequences.
J. Clin. Microbiol.
36:139-147[Abstract/Free Full Text].
|
| 19.
|
Springer, B.,
P. Kirschner,
G. Rost-Meyer,
K.-H. Schroder,
R. Kroppenstedt, and E. Bottger.
1993.
Mycobacterium interjectum, a new species isolated from a patient with chronic lymphadenitis.
J. Clin. Microbiol.
31:3083-3089[Abstract/Free Full Text].
|
| 20.
|
Tortoli, E.,
A. Bartoloni,
V. Manfrin,
A. Mantella,
C. Scarparo, and E. Bottger.
2000.
Cervical lymphadenitis due to Mycobacterium bohemicum.
Clin. Infect. Dis.
30:210-211[CrossRef][Medline].
|
| 21.
|
van Soolingen, D.,
P. W. M. Hermans,
P. de Haas,
D. R. Soll, and J. van Embden.
1991.
Occurrence and stability of insertion sequences in Mycobacterium tuberculosis complex strains: evaluation of an insertion sequence-dependent DNA polymorphism as a tool in the epidemiology of tuberculosis.
J. Clin. Microbiol.
29:2578-2586[Abstract/Free Full Text].
|
Journal of Clinical Microbiology, April 2001, p. 1227-1230, Vol. 39, No. 4
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.4.1227-1230.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Tortoli, E., Rindi, L., Goh, K. S., Katila, M. L., Mariottini, A., Mattei, R., Mazzarelli, G., Suomalainen, S., Torkko, P., Rastogi, N.
(2005). Mycobacterium florentinum sp. nov., isolated from humans. Int. J. Syst. Evol. Microbiol.
55: 1101-1106
[Abstract]
[Full Text]
-
Rhodes, M. W., Kator, H., McNabb, A., Deshayes, C., Reyrat, J.-M., Brown-Elliott, B. A., Wallace, R. Jr, Trott, K. A., Parker, J. M., Lifland, B., Osterhout, G., Kaattari, I., Reece, K., Vogelbein, W., Ottinger, C. A.
(2005). Mycobacterium pseudoshottsii sp. nov., a slowly growing chromogenic species isolated from Chesapeake Bay striped bass (Morone saxatilis). Int. J. Syst. Evol. Microbiol.
55: 1139-1147
[Abstract]
[Full Text]
-
Zeller, V., Nardi, A.-L., Truffot-Pernot, C., Sougakoff, W., Stankoff, B., Katlama, C., Bricaire, F.
(2003). Disseminated Infection with a Mycobacterium Related to Mycobacterium triplex with Central Nervous System Involvement Associated with AIDS. J. Clin. Microbiol.
41: 2785-2787
[Abstract]
[Full Text]
-
Levi, M. H., Bartell, J., Gandolfo, L., Smole, S. C., Costa, S. F., Weiss, L. M., Johnson, L. K., Osterhout, G., Herbst, L. H.
(2003). Characterization of Mycobacteriummontefiorense sp. nov., a Novel Pathogenic Mycobacterium from Moray Eels That Is Related to Mycobacteriumtriplex. J. Clin. Microbiol.
41: 2147-2152
[Abstract]
[Full Text]
-
Tortoli, E.
(2003). Impact of Genotypic Studies on Mycobacterial Taxonomy: the New Mycobacteria of the 1990s. Clin. Microbiol. Rev.
16: 319-354
[Abstract]
[Full Text]