Previous Article | Next Article 
Journal of Clinical Microbiology, April 2001, p. 1407-1415, Vol. 39, No. 4
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.4.1407-1415.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Pediatric Solid-Organ Transplant Recipients Carry
Chronic Loads of Epstein-Barr Virus Exclusively in the
Immunoglobulin D-Negative B-Cell Compartment
Camille
Rose,1
Michael
Green,2,3
Steven
Webber,3
Demetrius
Ellis,2
Jorges
Reyes,3 and
David
Rowe1,*
Department of Infectious Diseases and
Microbiology, Graduate School of Public Health, University of
Pittsburgh,1 and Departments of
Pediatrics2 and
Surgery,3 Children's Hospital of
Pittsburgh, Pittsburgh, Pennsylvania 15213
Received 27 July 2000/Returned for modification 15 November
2000/Accepted 27 December 2000
 |
ABSTRACT |
Solid-organ transplant recipients are at risk for development of
lymphoproliferative diseases. The purpose of this study was to examine
the distribution of Epstein-Barr virus (EBV) load in the peripheral
blood of pediatric transplant recipients who had become chronic viral
load carriers (>8 copies/105 lymphocytes for >2 months).
A total of 19 patients with viral loads ranging from 20 to 5,000 viral
genome copies/105 lymphocytes were studied. Ten patients
had no previous diagnosis of posttransplant lymphoproliferative disease
(PT-LPD), while nine had recovered from a diagnosed case of PT-LPD. No
portion of the peripheral blood viral load was detected in the
cell-free plasma fraction. Viral DNA was found in a population of cells characterized as CD19hi and immunoglobulin D
negative, a phenotype that is consistent with the virus
being carried exclusively in the memory B-cell compartment of the
peripheral blood. There was no difference in the compartmentalization
based upon either the level of the viral load or the past diagnosis of
an episode of PT-LPD. These results have implications for the design of
tests to detect EBV infection and for the interpretation and use of
positive EBV PCR assays in the management of transplant recipients.
 |
INTRODUCTION |
Most primary infections with
Epstein-Barr virus (EBV), a ubiquitous B-lymphotropic herpesvirus,
occur in childhood and have a clinically asymptomatic presentation.
Symptomatic infection in adolescents and adults is infrequent and
associated with a clinically recognizable entity (infectious
mononucleosis) (9). In immunocompetent hosts, infections
are controlled by cell-mediated immunity that leads to a lifelong
carrier state characterized by episodic shedding of virus into saliva,
persistent low antibody titers to EBNA1, and a corps of latently
infected B cells that can represent as many as 1 to 10 per million of
the circulating B-cell population (1, 2, 13, 17,
25). An even higher frequency of circulating
virus-specific cytotoxic-T-cell precursors appears to be required to
prevent significant reactivation of virus from this latent state.
Recent estimates from HLA tetramer staining suggest that more than 5%
of the circulating CD8+-T-cell population in
healthy long-term carriers are specific for EBV epitopes
(24).
In immunosuppressed individuals EBV-driven B-cell proliferation is not
regulated by such powerfully focused immune responses, and infection
can thus produce a lymphoproliferative disease which has varied
clinical presentations and histopathologic features and may progress to
an immunoblastic lymphoma (4, 17). One group at very high
risk is transplant recipients undergoing primary EBV infection while
receiving an immunosuppressive drug regimen. A number of studies have
recently shown that posttransplant lymphoproliferative disease (PT-LPD)
is associated with a very high viral load of EBV circulating in the
peripheral blood (6, 7, 8, 12, 15, 19, 22, 23,). Many of
these reports have suggested that tests aimed at detection of this
viral load could be used as a diagnostic marker for the presence of
PT-LPD. Tests, such as quantitative load measurement, that provide
early detection of infection and lymphoproliferation hold the
possibility of allowing preemptive therapeutic intervention early in
the course of EBV infection before symptomatic disease and progression
to a lymphoma. However, recent cross-sectional and longitudinal
analyses suggest that clinical resolution of primary EBV infection in a
significant proportion of transplant recipients results in a chronic
viral load carrier state in which high copy numbers of EBV persist
asymptomatically in the peripheral blood for months or, in some cases,
years (references 5, 6, 12, and 27 and our
unpublished observations). Persistently elevated viral load in
asymptomatic transplant recipients represents a newly recognized
phenomenon revealed by the advent of PCR-based load measurement as a
diagnostic tool. The utility of single isolated viral load
measurements as a diagnostic marker of EBV-driven disease needs to be
assessed in view of these findings.
Viral load monitoring in immunosuppressed individuals following
solid-organ transplantation has provided a unique opportunity to study
the virus interacting with a host where there is a high risk of the
development of a PT-LPD or where that risk has been realized and a
PT-LPD has already occurred. The purpose of this study was to examine
the relative distribution of viral DNA load among plasma, the naive
B-cell compartment, and the memory B-cell compartment in the chronic
carrier state that has developed in immunosuppressed pediatric
transplant recipients.
 |
MATERIALS AND METHODS |
Subjects.
Since 1995, transplant recipients attending
Children's Hospital of Pittsburgh and University of Pittsburgh Medical
Center have been regularly monitored for EBV viral load using a
quantitative-competitive PCR (QC-PCR) protocol developed in our
laboratory (22). We have monitored bowel, liver, lung,
renal, and heart transplant recipients for EBV DNA copy number in
peripheral blood lymphocytes. We have focused on the pediatric
transplant population because within this group there are more than 190 patients for whom we have multiple prospectively collected specimens.
In only 65 of these patients (34.2%) has there never been a detectable
viral load. A chronic low load (defined as detectable but <200 genome
copies/105 lymphocytes for >2 months) has been
detected in 69 patients (36.3%), and a chronic high load (defined as
>200 genome copies/105 lymphocytes for >2
months) has been detected in 35 (18.4%). The remaining 21 patients
have had viral loads that have fluctuated. We developed lists of
patients who met the criteria for the chronic low-load and chronic
high-load carrier states. From these patient pools, we randomly
selected 10 chronic low-load carriers and 9 chronic high-load carriers
equally split with respect to whether their clinical history included a
recognized episode of PT-LPD (Table 1).
When blood specimens in excess of the requirements for viral DNA load
testing were available, they were used to prepare the plasma and B-cell
subfractions for load distribution measurements.
Cell lines.
The X50-7 and B95-8 cell lines (gifts of
G. Miller, Yale University, New Haven, Conn.) are widely used cell
lines for studies on immortalization and viral production. BJAB is an
EBV-negative B-cell lymphoma used as a virus-negative control and as
carrier cells. Namalwa is a BL cell line that contains two copies of
the EBV genome integrated into the host genome and is a source of easily measured cell-associated wild-type EBV genome copy number. All
cell lines were maintained in 5% CO2 with 10%
fetal calf serum-RPMI 1640 with penicillin and streptomycin.
QC-PCR of EBV load in lymphocytes and plasma.
Lymphocytes
were prepared from whole-blood samples by centrifugation onto a
Histopaque (Sigma) cushion. The cells were washed in phosphate-buffered
saline and counted. Cell pellets were stored at
20°C until ready
for PCR. A plasma volume equivalent to 4 × 105 cells for each patient was ultracentrifuged
at 14,000 rpm for 90 min (Eppendorf 5417R) in order to pellet
cell-free virus. To make lymphocyte and plasma lysates, 20 µl of PCR
lysis buffer (50 mM KCl, 10 mM Tris [pH 7.6], 2.5 mM
MgCl2, 1% Tween 20, and 100 µg of proteinase K
per ml) was added for every 105 lymphocytes or
plasma volume equivalents. The lysates were incubated at 55°C for
1 h, boiled for 10 min to inactivate the proteinase K, and chilled
on ice. Primers for the PCR target sequence in the EBV genome were
designed with OLIGO software (National Biosciences). TP1Q5'
(AGGAACGTGAATCTAATGAAGA) and TP1Q3'
(GAGTCATCCCGTGGAGAGTA) amplify a 177-bp EBV sequence (exon
1) in the Lmp2a gene. A competitor target was made by deleting 42 bp
from a 177-bp EBV amplicon derived from the viral LMP2a exon 1 sequence. For each sample, four tubes containing 8, 40, 200, or 1,000 copies of the viral LMP2a competitor sequence along with
lymphocyte or plasma lysates equivalent to 105
cells were subjected to 30 cycles of amplification (94°C for 1 min,
54°C for 1 min, and 72°C for 1 min). Each PCR mixture (50 µl)
contained 20 pmol of 5' and 3' primers, 50 mM KCl, 2.5 mM MgCl2, 10 mM Tris [pH 9.0], 0.1% Triton X-100,
and 0.25 mM deoxynucleotides (Pharmacia). One unit of Amplitaq Gold DNA
polymerase (Perkin-Elmer) was used in each reaction. The PCR products
were analyzed on 3% agarose gels containing 0.5× Tris-borate-EDTA
electrophoresis buffer and 0.5 µg of ethidium bromide per ml.
The QC-PCR assay for EBV is used to quantitate viral loads in the range
of 8 to 5,000 copies of viral DNA in 10
5
lymphocytes. Normal latent infection (0.01 to 0.1 copies/10
5 lymphocytes) is not detected by this
protocol (
22), and detectable
levels of viral DNA reflect
a viral genome burden at least 2 to
3 orders of magnitude above normal
latency.
Cell sorting with magnetic beads.
Lymphocytes were
positively sorted for the CD15+ (granulocytes),
CD19+ (B cells), or surface immunoglobulin
D-positive (sIgD+) (naive B cells)
phenotype by using Dynabeads 450 CD15 or CD19 (pan B) or a CELLection
Pan Mouse IgG kit conjugated with anti-IgD (PharMingen).
Ficoll-Hypaque lymphocyte preparations from patient blood samples were
mixed with Dynabeads at a concentration of 107
beads/ml and incubated for 30 min at 4°C. The positively selected cells were isolated using a magnet (Dynal MPC) and detached from the
Dynabeads using DETACHaBEAD CD19 or a releasing buffer (CELLection Pan
Mouse IgG kit). The detachment of positively selected CD15 cells was
not feasible. The positive and negative sorted cell compartments were
stored at
20°C as dried pellets for QC-PCR.
Flow cytometric analysis.
Ficoll-Hypaque-prepared
lymphocytes (106) were stained for three-color or
two-color analysis with CD45-allophycocyanin (Caltag) and with
CD3-fluorescein isothiocyanate (CD3-FITC) (Coulter) plus CD19-phycoerythrin (CD19-PE) (Coulter) or CD14-PE (Becton Dickinson) plus CD15-FITC (Coulter). Naive and memory B cells were stained with anti-IgD-FITC and anti-IgG-PE, respectively. Cells were stained with the appropriate antibodies at 4°C for 30 min and fixed in 1%
paraformaldehyde. As negative controls, MsIgG2b-RD1 (IgG2 isotype control; Coulter), IgM-FITC (IgM isotype control; Coulter), and IgG1-PE
and IgG1-FITC (IgG1 isotype control; Coulter) were used, as well as
unstained cells. Flow cytometry measurements were analyzed using the
Win MDI version 2.7 flow cytometry application.
Wright staining and microscopy.
Cytospun cells were fixed on
slides for 15 s in absolute methanol and air dried. Each sample
was stained with Wright's stain (Shannon) for 1 min, after which an
equal volume of a pH-balanced buffer was added and left for 8 to 10 min. The stained slides were rinsed thoroughly in distilled water. Cell
morphology was assessed by bright-field microscopy using a Nikon E600 microscope.
 |
RESULTS |
EBV viral DNA load is in CD19+ lymphocytes.
After
5 years of observation of the dynamics of viral load in transplant
recipients, we have obtained quantitative PCR results for EBV load for
over 800 patients. One striking observation from the data (to be
analyzed and published separately) is the development and persistence
of asymptomatic chronic viral loads in over 50% of the subjects. The
first question to be addressed was whether the chronic viral load that
had been measured in the unsorted peripheral blood lymphocytes was
indeed associated with the B-cell fraction of the lymphocyte
population. Fresh peripheral blood lymphocytes from three chronic
low-load carriers (patients 1, 5, and 8) and three chronic high-load
carriers (patients 13, 16, and 19) were fractionated into B cells
(CD19+) and T cells
(CD19
) using anti-CD19 magnetic beads. Flow
cytometric analysis of the fluorescent-antibody-tagged lymphocytes
revealed that the CD19+ cells consisted of
distinct CD19hi and CD19lo
subpopulations (Fig. 1). More than 90%
of both CD19 subpopulations were recovered from the magnetic bead
separation of the CD19-positive cells from purified peripheral blood
lymphocytes. QC-PCR assays were then performed on
104 CD19+ or
105 CD19
cells. These
numbers of cells were used in the PCRs to approximate the numbers of
each cell type that are normally present in QC-PCRs conducted on
unsorted lymphocytes. For the three low-load carriers and the three
high-load carriers analyzed, PCRs using the CD19+
cells were positive for viral DNA. Detectable EBV DNA was sometimes present in the CD19
populations, but this
positivity was always less than 10% and correlated with the degree to
which the CD19
population contained residual
CD19+ cells. Complete removal of all
CD19+ cells eliminated PCR positivity from the
CD19
populations. These results are consistent
with the viral load detected in chronic load carriers being carried by
the B-cell population.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 1.
Quantitation of viral load in cells fractionated on the
basis of CD19 expression. Viral load is restricted to the
CD19+ fraction of peripheral blood lymphocytes. (A) Flow
cytometric profile of CD19 fluorescence in a typical lymphocyte
preparation from a chronic viral load carrier. The CD19+
fraction is composed of a CD19hi and a CD19lo
peak of fluorescence. (B) Ethidium bromide-stained DNA products of
QC-PCRs using 104 CD19+ or 105
CD19 cells and 8, 40, 200, or 1,000 copies of an
identical competitor target sequence (lower of the two PCR product
bands) were analyzed by agarose gel electrophoresis. Results for
patient 8 (a low-load carrier) and patient 16 (a high-load carrier) are
shown. The interpolated DNA concentration in copy numbers of EBV
genomes detected is shown below each panel.
|
|
One explanation for the persistence of viral loads in the peripheral
lymphocyte pool at levels 3 to 4 orders of magnitude
greater than has
been observed in normal latently infected immunocompetent
carriers
would be that there is a continuously ongoing viral replication
process. An analysis of viral load in the plasma was conducted
to
determine if the product of such an active replication process
could be
detected in the form of circulating cell-free virus.
For all 19 patients in the study, a volume of plasma equivalent
to the volume of
blood containing 10
5 lymphocytes was analyzed by
QC-PCR for the presence of free virus.
Free virus was not detected from
either the chronic high-load
carriers or the chronic low-load carriers
(Table
1). If a chronic
load carrier state requires an active
virus-producing state of
infection, it was not manifested by the
presence of free virus
in the
plasma.
EBV viral DNA load is in the CD19hi subpopulation.
The EBV viral load in normal latently infected virus carriers is not
distributed equally among all B-cell compartments but is carried
exclusively in the memory B-cell subpopulation (17, 18).
The presence of two distinct subpopulations of
CD19+ cells in the patient blood specimens seemed
unusual and immediately suggested that there could be a relationship to
the chronic load carrier state detected by QC-PCR. This notion was
reinforced by the observation that normal control lymphocyte
preparations did not contain a CD19lo
subpopulation. In addition, the CD19lo population
was positive for sIgG and not for sIgD, a characteristic of memory B
cells (Fig. 2).

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
Characterization of the CD19hi and
CD19lo cell populations detected in the peripheral blood
lymphocyte fraction. (Top row) Flow cytometric analysis of B-cell
(CD19) and T-cell (CD3) markers after gating on the population of
high-FS and -SS cells unique to lymphocyte preparations of
transplant recipients compared to a normal healthy EBV-positive control
donor. (Center panels) Analysis of the sIgG and sIgD expression.
(Bottom panels) Analysis of monocyte (CD14) and granulocyte (CD15)
markers. High-FS and -SS cells appear to be CD19lo,
IgG+, and CD15+.
|
|
Another feature of the patient specimens was the presence of an
uncharacteristic forward light scatter (FS)-to-side light
scatter (SS)
profile. Gating on the unusual cells in the FS-SS
window revealed that
these cells exclusively constituted the CD19
lo
subpopulation. Further analysis of the lymphocyte preparation
using a
monocyte marker (CD14) and a granulocyte marker (CD15)
revealed that
the CD19
lo population was strongly
CD15
+ (Fig.
2, lower panels). The
CD15
hi CD19
lo
sIgG
+ phenotype and the high FS-SS
light-scattering profile are consistent
with these cells being mature
granulocytes. Wright staining of
the patient Ficoll-Hypaque lymphocyte
preparations confirmed the
presence of granulocytes in the patients'
specimens but not in
normal control lymphocyte
preparations.
The principal difference between the patient specimens and the control
blood, as far as handling in the laboratory, was that
patient specimens
were often 24 to 48 h old owing to the individual's
location,
with specimens being either from the hospital ward or
from remote sites
such as outpatient clinics or doctors' offices.
Control blood was
always drawn immediately prior to lymphocyte
preparation. Instructions
for preserving patient blood samples
specify that refrigeration at
4
0C be used to prevent changes in viral load
caused by postvenipuncture
replication of the virus during transport.
The effects of refrigeration
during transport were duplicated by
incubating an aliquot of a
control blood draw overnight at 4°C prior
to lymphocyte separation.
When this was done, the Wright staining and
FS-SS flow cytometric
profile showed the appearance of granulocytes in
a specimen that
had shown no evidence of granulocyte contamination when
it had
been processed immediately (Fig.
3).

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 3.
Wright staining of lymphocyte preparations from a
pediatric transplant recipient (left panel) reveals the presence of
polymorphonuclear cells, and the light-scattering profile contains
large numbers of high-FS and -SS cells. A normal control donor
lymphocyte preparation (center panel) has no polymorphonuclear cells
and no high-FS and -SS cells. Incubation of a blood specimen at
4°C overnight prior to Ficoll-Hypaque gradient preparation
shows the appearance of polymorphonuclear cells and high-FS and -SS
cells (right panel)
|
|
The presence of granulocytes in the patient specimens was most probably
the consequence of 4°C storage prior to processing
(
26).
Although EBV infection of granulocytes has not been reported,
the
possibility that the chronically elevated viral load detected
in
unsorted patient lymphocyte specimens was carried in these
contaminating granulocytes still formally remained. To address
this, we
depleted CD15
+ cells from the lymphocyte
preparations of four load carriers
(patients 4, 7, 8, and 11) by
incubation with anti-CD15 beads.
More than 90% removal of
granulocytes was achieved. The
CD15
+-cell-depleted lymphocytes and
the CD15
+ cells were then used for QC-PCR (Fig.
4). All of the viral DNA
from two of the
carriers (patients 1 and 4) was present in the
CD15
+-cell-depleted cells, while approximately
1% of the viral load
was detected in the CD15
+
cells for the other two load carriers (patients 5 and 7). The
detection
of small amounts of viral DNA in the CD15
+ cells
is most likely due to impurity of the population caused
by the presence
of adherent lymphocytes including B cells. The
presence of viral DNA in
the CD15
+-cell-depleted lymphocytes was
consistent with the viral DNA load
being carried in the
CD19
hi (B-cell) fraction of the peripheral blood
lymphocytes.

View larger version (72K):
[in this window]
[in a new window]
|
FIG. 4.
Ethidium bromide-stained DNA products of QC-PCRs using
105 CD15+ or 105 CD15
cells and 8, 40, 200, or 1,000 copies of an identical competitor target
sequence were analyzed by agarose gel electrophoresis. Results for
patients (pt) 1, 4, 5, and 8 are shown. The concentration in copy
numbers of EBV genomes detected is shown below each panel.
|
|
EBV viral DNA load is in the sIgD
B-cell
subpopulation.
Normal immunocompetent virus carriers have loads
equivalent to 0.2 to 0.5 copies/105 lymphocytes
and carry the load in the memory B-cell compartment of the B-cell
population (2, 22). This has been demonstrated by sorting
cells on the basis of whether they express sIgD, a marker for mature,
naive B cells. Therefore, the key issue concerning the chronic load in
immunocompromised carriers is whether the sIgD+ B
cells contain a significant proportion of the circulating viral load.
For this analysis, we analyzed 10 chronic low-load and 9 chronic
high-load carriers. Five of the chronic low-load carriers and four of
the chronic high-load carriers had no history of PT-LPD, while five of
each of the low- and high-load carriers had a previous diagnosis of
PT-LPD. Anti-IgD magnetic beads were used to fractionate these cells
from the lymphocyte preparations. More than 90% depletion of
sIgD+ cells was obtained with a single incubation
with magnetic beads (Fig. 5A). The
sIgD
and sIgD+ cell
populations were then analyzed by QC-PCR for the presence of viral DNA.
An example of the QC-PCR analysis for a low-load carrier and a
high-load carrier is shown in Fig. 5B. The high-load carrier had a
viral load of 5,000 copies/105 lymphocytes, which
was the highest load of any patient in this study. QC-PCR analysis of
this specimen clearly indicates that no portion of the load was
detected in the positively selected sIgD+ cells.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 5.
EBV viral load in naive B cells fractionated from
lymphocyte preparations from chronic viral load carriers. (A) Flow
cytometric profiles of sIgG- and sIgD-stained cells before (left panel)
and after (right panel) anti-IgD magnetic bead separation of the naive
B cells. (B) Ethidium bromide-stained DNA products of QC-PCRs using
104 IgD+ or 105 IgD
cells and 8, 40, 200, or 1,000 copies of an identical competitor target
sequence were analyzed by agarose gel electrophoresis. Results for
patient 7, a low-load carrier, and patient 15 (a high-load carrier) are
shown. The interpolated DNA concentration in copy numbers of EBV
genomes detected is shown below each panel. A complete analysis of all
19 patients in the study is summarized in Table 1.
|
|
Specimens from the 10 chronic low-load carriers and 9 chronic high-load
carriers were similarly analyzed after anti-IgD magnetic
bead
fractionation. Nine of the 10 low-load carriers and all nine
of the
high-load carriers showed no detectable viral DNA in the
sIgD
+ population (Table
1). The only low-load
carrier to have detectable
viral DNA in the quantitative assay had a
value reported as <8.
The standard QC-PCR assay interpolates viral
load values between
8 and 5,000 (
22). A value of <8 means
that viral DNA was detected
but that there were fewer than eight copies
present in the PCR.
This is consistent with the presence of a single
virus-infected
cell in the reaction mixture, and it is possible that a
virus-infected
IgD

cell contaminated the
sIgD
+ population. Overall, the results indicate
that there is no difference
between high- and low-load carriers with
respect to the B-cell
compartment carrying the viral load. There was
also no difference
between patients who had a prior diagnosis of PT-LPD
and patients
who had no history of PT-LPD with respect to the B-cell
compartment
in which viral load was
carried.
Relative proportions of B cells in lymphocyte populations.
The
chronic viral loads of immunosuppressed transplant recipients are 100- to 10,000-fold higher than the loads that have been measured in
latently infected immunocompetent individuals (6). For
both patients and controls the viral loads are carried in the same
subfraction of the B-cell population. It was possible from the studies
we have presented thus far to conclude that the greater viral loads
were due, at least in part, to an expansion of the
IgD
B-cell compartment. We therefore conducted
an analysis of the relative proportions of B cells carrying sIgD (naive
B cells), B cells carrying sIgG (memory B cells),
CD15+ cells (granulocytes), and other cells (T
cells, NK cells, monocytes, and granulocytes) in Ficoll-Hypaque
lymphocyte preparations (Fig. 6). Blood
samples from pediatric transplant recipients with no detected EBV
infection incubated overnight at 40C were used as
controls. The 4°C storage produced a similar level of contaminating
granulocytes in the control population as in the chronic carriers, and
there was no difference between the chronic low- and high-load carriers
in the numbers of granulocytes present, indicating that the level of
the viral load was not a factor in determining the presence of
granulocytes. When only lymphocytes were considered, the proportion of
B cells to total lymphocytes was 6% for the controls and 25% for the
chronic viral load carriers. There was no significant difference
between the high- and low-load carriers. The larger proportion of B
cells in the viral load-carrying patient population is at most 4 times greater than normal. This modest increase in the fraction of B cells in
lymphocyte preparations includes a relative increase in the uninfected
IgD+ population and is within the range expected
for pediatric blood specimens (9, 13).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 6.
Pictographs showing the relative proportions of B cells
in the population of cells purified from the blood of immunosuppressed
transplant recipients. On the left are the percentages of B cells in
the total population, while on the right the CD15+ cells
have been removed and only lymphocytes have been considered. (A)
Control EBV-negative pediatric transplant recipients; (B) mean of all
19 chronic load carriers in the study group; (C) the 10 chronic
low-load carriers; (D) the 9 chronic high-load carriers.
|
|
 |
DISCUSSION |
We have determined that a large proportion (104 of 190 [54.7%])
of immunocompromised pediatric transplant recipients whom we have
prospectively monitored become chronic viral load carriers carrying
loads several orders of magnitude greater than normally observed in
immunocompetent individuals. The load appears to be largely or entirely
cell associated, as no viral DNA was detected in plasma specimens from
even the highest-load carriers. Plasma-based PCR assays for EBV have
been suggested for diagnostic purposes to detect EBV infection and
lymphoproliferative disease (15). We have found that even
during EBV productive disease the plasma fraction contains only a small
fraction (<10%) of the total load in an equivalent volume of blood
(data not shown) The inability to detect virus in the plasma of chronic
viral load carriers indicates that plasma-based assays will probably
miss the detection of virus infection in most cases.
We have identified the cells that are carrying the viral DNA in the
lymphocyte populations obtained upon Ficoll-Hypaque separation of blood
from chronic viral load carriers. To do this, it was necessary to adopt
a strategy limited by the use of single incubations with
antibody-coated magnetic beads. This was because (i) there were
restricted numbers of available cells from patient specimens, which
were subject to the losses inherent to magnetic bead sorts, and (ii)
the sorted cells were often unable to survive secondary or tertiary
bead incubations. A strategy for obtaining pure
IgG+ B cells would involve an anti-CD15 bead
negative sort to remove granulocytes followed by an anti-CD19 bead
positive sort followed by an sIg positive sort. This type of strategy
was not practical for most patients' specimens. We therefore set out
to confirm that the EBV load was in memory B cells by a series of
experiments using single bead sorts. We confirmed that the load was in
the CD19+ cell fraction and then eliminated the
CD19lo cells from consideration by demonstrating
that (i) they were granulocytes and (ii) they did not account for any
significant portion of the viral load. The small amounts of viral DNA
detected in the granulocyte preparations from the highest-load carriers were most likely the result of adherent B cells. We then assayed a
large number of specimens using an anti-IgD bead separation to
subfractionate the naive B cells from the total lymphocyte pool and
determined that these cells did not harbor a viral load. The sum of the
observations is that the viral load appears to be carried by
CD19high CD15
sIgD
cells, a phenotype which is consistent
with EBV being carried in memory B cells. The same B-cell compartment
carries the latently infected cells of immunocompetent adults
(2). Thus, these results suggest that the chronic viral
load of immunosuppressed pediatric transplant recipients is most likely
carried in a latent state.
In related work, preliminary results from our laboratory with reverse
transcriptase PCR analysis of sentinel viral gene expression confirms
the presence of RNA for the LMP2a latency-associated gene and the
absence of expression of genes associated with immortalization and
lytic virus production in the peripheral blood of the chronic low-load
carriers (20). The pattern of viral gene expression in the
high-load carrier state is not as simple. It is characterized by
expression of LMP1 and LMP2a. The results reported here indicate that
the different viral gene expression patterns seen in low- and high-load
carriers occur within the memory B-cell fraction. The proportion of
memory B cells to naive B cells and other lymphocytes in the peripheral
circulation of chronic viral load carriers is not greatly skewed in
favor of memory B cells and actually falls within the range of expected
values for children. Since this relatively small fraction of cells
harbors all the elevated viral load in immunocompromised transplant
recipients, then within the memory B-cell compartment a high proportion
of the cells is likely to be infected. If the estimate of 2 to 5 genomes per cell for latently infected cells in adults
(17) is assumed to be correct for this patient population
as well, then approximately 1 of 10 memory B cells (for a load of
1,000/105 lymphocytes) to 1 of 1,000 memory B
cells (for a load of 10/105 lymphocytes) carries
viral DNA. These frequencies for viral DNA-positive cells make in situ
studies feasible for further defining and characterizing this population.
Although intuitively a high viral load cannot be viewed as desirable,
it is not yet clear exactly what risks are associated with the
persistently elevated-load carrier state of immunocompromised patients.
If the state of the virus infection in the peripheral blood is
indicative of the state of infection in lymphoid tissues and other
organs, then the present studies reveal an essentially quiescent, but
potentially dangerous, situation that conventional antiviral
therapies cannot affect. Experimental therapies involving intravenous
administration of anti-CD20 antibodies to abolish the
B-cell compartment do diminish the circulating viral load but in many
cases may unnecessarily affect the large and uninfected naive segment
of the B-cell population. Our data suggest that it might be more
logical to use therapeutic agents that target only the memory B-cell
population not only as therapy for disease, but also in preemptive
therapeutic strategies aimed at reducing high-load carrier states.
Our preliminary analyses of chronic load carriers and patients with
PT-LPD suggest that there are shifts in the distribution of the load in
the peripheral blood between naive and memory compartments (not shown)
and in the patterns of viral gene expression that are associated with
the PT-LPD disease state 20). We are developing new
diagnostic tools based on these observations that will define the state
of the infection more clearly than is presently possible with
measurements of a viral load alone.
 |
ACKNOWLEDGMENTS |
We thank Martin Cottrill and Monica Bailey for their dedicated
technical support.
This work was supported by a grant from the Cancer Treatment Research
Foundation, Chicago, Ill., and an unrestricted research and educational
grant from Medimmune Inc.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Infectious Diseases and Microbiology, Graduate School of Public Health, 130 DeSoto St., Pittsburgh, PA 15213. Phone: (412) 624-1529. Fax: (412)
383-7490. E-mail: rowe1+{at}pitt.edu.
 |
REFERENCES |
| 1.
|
Babcock, G. J.,
L. L. Decker,
R. B. Freeman, and D. A. Thorley-Lawson.
1999.
Epstein-Barr virus-infected resting memory B cells, not proliferating lymphoblasts, accumulate in the peripheral blood of immunosuppressed patients.
J. Exp. Med.
190:567-576[Abstract/Free Full Text].
|
| 2.
|
Babcock, G. J.,
L. L. Decker,
M. Volk, and D. Thorley-Lawson.
1998.
EBV persistence in memory B cells in vivo.
Immunity
9:395-404[CrossRef][Medline].
|
| 3.
|
Barkholt, L.,
H. Dahl,
M. Endom, and A. Lindé.
1996.
Epstein-Barr virus DNA in serum after liver transplantation surveillance of viral activity during treatment with different immunosuppressive agents.
Transpl. Int.
9:439-445[CrossRef][Medline].
|
| 4.
|
Finn, L.,
J. Reyes,
J. Bueno, and E. Yunis.
1998.
Epstein-Barr virus infections in children after transplantation of the small intestine.
Am. J. Surg. Pathol.
22:299-309[CrossRef][Medline].
|
| 5.
|
Green, M.,
T. V. Cacciarelli,
G. V. Mazariegos,
L. Sigurdsson,
L. Qu,
D. T. Rowe, and J. Reyes.
1998.
Serial measurement of Epstein-Barr viral load in peripheral blood in pediatric liver transplant recipients during treatment for posttransplant lymphoproliferative diseases.
Transplantation
66:1641-1644[CrossRef][Medline].
|
| 6.
|
Green, M.,
T. V. Cacciarelli,
G. V. Mazariegos,
L. Sigurdsson,
D. Rowe, and J. Reyes.
1998.
Natural history of Epstein-Barr virus load in pediatric thoracic recipients with post transplant lymphoproliferative disorders and other primary EBV infections.
Transplantation
67:S215.
|
| 7.
|
Green, M.,
M. G. Michaels,
S. A. Webber,
D. Rowe, and J. Reyes.
1999.
The management of Epstein-Barr virus associated post-transplant lymphoproliferative disorders in pediatric solid-organ transplant recipients.
Pediatr. Transplant.
3:271-281[CrossRef][Medline].
|
| 8.
|
Green, M.,
J. Reyes,
S. Webber,
M. G. Michaels, and D. Rowe.
1999.
The role of viral load in the diagnosis, management and possible prevention of Epstein-Barr virus-associated post-transplant lymphoproliferative disease following solid organ transplantation.
Curr. Opin. Org. Transplant.
4:292-296[CrossRef].
|
| 9.
|
Hicks, M. J.,
J. Jones,
L. Minnich,
K. Weigle,
A. C. Thies, and J. Layton.
1983.
Age-related changes in T- and B-lymphocyte subpopulations in the peripheral blood.
Arch. Pathol. Lab. Med.
107:518-523[Medline].
|
| 10.
|
Khan, G.,
E. Miyashita,
B. Yang,
G. Babcock, and D. Thorley-Lawson.
1996.
Is EBV persistence in vivo a model for B cell homeostasis?
Immunity
5:173-179[CrossRef][Medline].
|
| 11.
|
Kieff, E.
1996.
Herpesviridae, p. 2343-2396.
In
B. N. Fields, D. M. Knipe, P. M. Howley, et al. (ed.), Fields virology, 3rd ed. Raven Press, New York, N.Y.
|
| 12.
|
Kogan, D. L.,
M. Burroughs,
S. Emre,
T. Fishbein,
A. Moscona,
C. Ramson, and B. L. Schneider.
1999.
Prospective longitudinal analysis of quantitative Epstein-Barr virus polymerase chain reaction in pediatric liver transplant recipients.
Transplantation
67:1068-1070[CrossRef][Medline].
|
| 13.
|
Kotylo, P.,
N. Fineberg,
K. Freeman,
N. Redmond, and C. Charland.
1993.
Reference ranges for lymphocyte subsets in pediatric patients.
Am. J. Clin. Pathol.
100:111-115[Medline].
|
| 14.
|
Lewin, N.,
P. Aman,
M. G. Masucci,
E. Klein,
G. Klein,
B. Oberg,
H. Strander,
W. Henle, and G. Henle.
1987.
Characterization of EBV carrying B cell populations in healthy seropositive individuals with regard to density, release of transforming virus and spontaneous outgrowth.
Int. J. Cancer
39:472-476[Medline].
|
| 15.
|
Limaye, A. P.,
M-L. Huang,
E. E. Atienza,
J. M. Ferrenberg, and L. Corey.
1999.
Detection of Epstein-Barr virus DNA in sera from transplant recipients with lymphoproliferative disorders.
J. Clin. Microbiol.
37:1113-1116[Abstract/Free Full Text].
|
| 16.
|
Lucas, K. G.,
R. L. Burton,
S. E. Zimmerman,
J. Wang,
K. G. Cornetta,
K. A. Robertson,
C. H. Lee, and D. J. Emanuel.
1998.
Semiquantitative Epstein-Barr virus (EBV) polymerase chain reaction for the determination of patients at risk for EBV-induced lymphoproliferative disease after stem cell transplantation.
Blood
91:3654-3661[Abstract/Free Full Text].
|
| 17.
|
Miyashita, E.,
B. Yang,
G. Babcock, and D. Thorley-Lawson.
1997.
Identification of the site of Epstein-Barr persistence in vivo as a resting B cell.
J. Virol.
71:4882-4891[Abstract].
|
| 18.
|
Miyashita, E.,
B. Yang,
K. Lam,
D. Crawford, and D. Thorley-Lawson.
1995.
A novel form of Epstein-Barr virus latency in normal B cells in vivo.
Cell
80:593-601[CrossRef][Medline].
|
| 19.
|
Nalesnik, M.
1998.
Clinical and pathological features of post transplant lymphoproliferative disorders.
Springer Semin. Immunopathol.
20:325-342[Medline].
|
| 20.
|
Qu, L.,
M. Green,
S. Webber,
J. Reyes,
D. Ellis, and D. Rowe.
2000.
Epstein-Barr virus gene expression in the peripheral blood of transplant recipients with chronic circulating viral loads.
J. Infect. Dis.
182:1013-1021[CrossRef][Medline].
|
| 21.
|
Riddler, S. A.,
B. K. Breining, and J. C. McKnight.
1994.
Increased levels of circulating Epstein-Barr virus (EBV)-infected lymphocytes and decreased EBV nuclear antigen antibody responses are associated with the development of post-transplant lymphoproliferative disease in solid-organ transplant recipients.
Blood
84:1972-1984.
|
| 22.
|
Rowe, D. T.,
L. Qu,
J. Reyes,
N. Jabbour,
E. Yunis,
P. Putnam,
S. Todo, and M. Green.
1997.
Use of quantitative competitive PCR to measure Epstein-Barr virus genome load in the peripheral blood of pediatric transplant patients with lymphoproliferative disorders.
J. Clin. Microbol.
35:1612-1615[Abstract].
|
| 23.
|
Shapiro, R.,
M. Nalesnik,
J. McCauley,
S. Fedorek,
M. L. Jordan,
V. P. Scantlebury,
A. Jain,
C. Vivas,
D. Ellis,
S. Lombardozzi-Lane,
P. Randhawa,
J. Johnston,
T. R. Hakala,
R. L. Simmons,
J. J. Fung, and T. E. Starzl.
1999.
Posttransplant lymphoproliferative disorders in adult and pediatric renal transplant patients receiving Tacrolimus-based immunosuppression.
Transplantation
68:1851-1854[CrossRef][Medline].
|
| 24.
|
Tan, L. C.,
N. Gudgeon,
N. E. Annels,
P. Hansasuta,
C. A. O'Callaghan,
S. Rowland-Jones,
A. J. McMichael,
A. B. Rickinson, and M. F. Callan.
1999.
A re-evaluation of the frequency of CD8+ T cells specific for EBV in healthy virus carriers.
J. Immunol.
162:1827-1835[Abstract/Free Full Text].
|
| 25.
|
Thorley-Lawson, D., and G. Babcock.
1999.
A model for persistent infection with Epstein-Barr virus: the stealth virus of human B cells.
Life Sci.
65:1433-1453[CrossRef][Medline].
|
| 26.
|
Van Lambalgen, R., and G. Van Meurs.
1985.
Lymphocyte subpopulations do not alter during blood storage at 4°C.
J. Immunol. Methods
80:39-43[Medline].
|
| 27.
|
Zangwill, S. D.,
D. T. Hsu,
M. P. Kichuk,
J. H. Garvin,
C. J. Stolar,
J. Haddad, Jr.,
S. Stylianos,
R. E. Michler,
A. Chadburn,
D. M. Knowles, and L. J. Addonizio.
1998.
Incidence and outcome of primary Epstein-Barr virus infection and lymphoproliferative disease in pediatric heart transplant recipients.
J. Heart Lung Transplant.
17:1161-1166[Medline].
|
Journal of Clinical Microbiology, April 2001, p. 1407-1415, Vol. 39, No. 4
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.4.1407-1415.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Gross, A. J., Hochberg, D., Rand, W. M., Thorley-Lawson, D. A.
(2005). EBV and Systemic Lupus Erythematosus: A New Perspective. J. Immunol.
174: 6599-6607
[Abstract]
[Full Text]
-
Schauer, E., Webber, S., Green, M., Rowe, D.
(2004). Surface Immunoglobulin-Deficient Epstein-Barr Virus-Infected B Cells in the Peripheral Blood of Pediatric Solid-Organ Transplant Recipients. J. Clin. Microbiol.
42: 5802-5810
[Abstract]
[Full Text]
-
Rose, C., Green, M., Webber, S., Kingsley, L., Day, R., Watkins, S., Reyes, J., Rowe, D.
(2002). Detection of Epstein-Barr Virus Genomes in Peripheral Blood B Cells from Solid-Organ Transplant Recipients by Fluorescence In Situ Hybridization. J. Clin. Microbiol.
40: 2533-2544
[Abstract]
[Full Text]