INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Most primary infections with Epstein-Barr virus (EBV), a ubiquitous B-lymphotropic herpesvirus, occur in childhood and have a clinically asymptomatic presentation. Symptomatic infection in adolescents and adults is infrequent and associated with a clinically recognizable entity (infectious mononucleosis) (9). In immunocompetent hosts, infections are controlled by cell-mediated immunity that leads to a lifelong carrier state characterized by episodic shedding of virus into saliva, persistent low antibody titers to EBNA1, and a corps of latently infected B cells that can represent as many as 1 to 10 per million of the circulating B-cell population (1, 2, 13, 17, 25). An even higher frequency of circulating virus-specific cytotoxic-T-cell precursors appears to be required to prevent significant reactivation of virus from this latent state. Recent estimates from HLA tetramer staining suggest that more than 5% of the circulating CD8⁺-T-cell population in healthy long-term carriers are specific for EBV epitopes (24).

In immunosuppressed individuals EBV-driven B-cell proliferation is not regulated by such powerfully focused immune responses, and infection can thus produce a lymphoproliferative disease which has varied clinical presentations and histopathologic features and may progress to an immunoblastic lymphoma (4, 17). One group at very high risk is transplant recipients undergoing primary EBV infection while receiving an immunosuppressive drug regimen. A number of studies have recently shown that posttransplant lymphoproliferative disease (PT-LPD) is associated with a very high viral load of EBV circulating in the peripheral blood (6, 7, 8, 12, 15, 19, 22, 23,). Many of these reports have suggested that tests aimed at detection of this viral load could be used as a diagnostic marker for the presence of PT-LPD. Tests, such as quantitative load measurement, that provide early detection of infection and lymphoproliferation hold the possibility of allowing preemptive therapeutic intervention early in the course of EBV infection before symptomatic disease and progression to a lymphoma. However, recent cross-sectional and longitudinal analyses suggest that clinical resolution of primary EBV infection in a significant proportion of transplant recipients results in a chronic viral load carrier state in which high copy numbers of EBV persist asymptomatically in the peripheral blood for months or, in some cases, years (references 5, 6, 12, and 27 and our unpublished observations). Persistently elevated viral load in asymptomatic transplant recipients represents a newly recognized phenomenon revealed by the advent of PCR-based load measurement as a diagnostic tool. The utility of single isolated viral load measurements as a diagnostic marker of EBV-driven disease needs to be assessed in view of these findings.

Viral load monitoring in immunosuppressed individuals following solid-organ transplantation has provided a unique opportunity to study the virus interacting with a host where there is a high risk of the development of a PT-LPD or where that risk has been realized and a PT-LPD has already occurred. The purpose of this study was to examine the relative distribution of viral DNA load among plasma, the naive B-cell compartment, and the memory B-cell compartment in the chronic carrier state that has developed in immunosuppressed pediatric transplant recipients.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Subjects. Since 1995, transplant recipients attending Children's Hospital of Pittsburgh and University of Pittsburgh Medical Center have been regularly monitored for EBV viral load using a quantitative-competitive PCR (QC-PCR) protocol developed in our laboratory (22). We have monitored bowel, liver, lung, renal, and heart transplant recipients for EBV DNA copy number in peripheral blood lymphocytes. We have focused on the pediatric transplant population because within this group there are more than 190 patients for whom we have multiple prospectively collected specimens. In only 65 of these patients (34.2%) has there never been a detectable viral load. A chronic low load (defined as detectable but <200 genome copies/10⁵ lymphocytes for >2 months) has been detected in 69 patients (36.3%), and a chronic high load (defined as >200 genome copies/10⁵ lymphocytes for >2 months) has been detected in 35 (18.4%). The remaining 21 patients have had viral loads that have fluctuated. We developed lists of patients who met the criteria for the chronic low-load and chronic high-load carrier states. From these patient pools, we randomly selected 10 chronic low-load carriers and 9 chronic high-load carriers equally split with respect to whether their clinical history included a recognized episode of PT-LPD (Table 1). When blood specimens in excess of the requirements for viral DNA load testing were available, they were used to prepare the plasma and B-cell subfractions for load distribution measurements.

Cell lines. The X50-7 and B95-8 cell lines (gifts of G. Miller, Yale University, New Haven, Conn.) are widely used cell lines for studies on immortalization and viral production. BJAB is an EBV-negative B-cell lymphoma used as a virus-negative control and as carrier cells. Namalwa is a BL cell line that contains two copies of the EBV genome integrated into the host genome and is a source of easily measured cell-associated wild-type EBV genome copy number. All cell lines were maintained in 5% CO₂ with 10% fetal calf serum-RPMI 1640 with penicillin and streptomycin.

QC-PCR of EBV load in lymphocytes and plasma. Lymphocytes were prepared from whole-blood samples by centrifugation onto a Histopaque (Sigma) cushion. The cells were washed in phosphate-buffered saline and counted. Cell pellets were stored at 20°C until ready for PCR. A plasma volume equivalent to 4 × 10⁵ cells for each patient was ultracentrifuged at 14,000 rpm for 90 min (Eppendorf 5417R) in order to pellet cell-free virus. To make lymphocyte and plasma lysates, 20 µl of PCR lysis buffer (50 mM KCl, 10 mM Tris [pH 7.6], 2.5 mM MgCl₂, 1% Tween 20, and 100 µg of proteinase K per ml) was added for every 10⁵ lymphocytes or plasma volume equivalents. The lysates were incubated at 55°C for 1 h, boiled for 10 min to inactivate the proteinase K, and chilled on ice. Primers for the PCR target sequence in the EBV genome were designed with OLIGO software (National Biosciences). TP1Q5' (AGGAACGTGAATCTAATGAAGA) and TP1Q3' (GAGTCATCCCGTGGAGAGTA) amplify a 177-bp EBV sequence (exon 1) in the Lmp2a gene. A competitor target was made by deleting 42 bp from a 177-bp EBV amplicon derived from the viral LMP2a exon 1 sequence. For each sample, four tubes containing 8, 40, 200, or 1,000 copies of the viral LMP2a competitor sequence along with lymphocyte or plasma lysates equivalent to 10⁵ cells were subjected to 30 cycles of amplification (94°C for 1 min, 54°C for 1 min, and 72°C for 1 min). Each PCR mixture (50 µl) contained 20 pmol of 5' and 3' primers, 50 mM KCl, 2.5 mM MgCl₂, 10 mM Tris [pH 9.0], 0.1% Triton X-100, and 0.25 mM deoxynucleotides (Pharmacia). One unit of Amplitaq Gold DNA polymerase (Perkin-Elmer) was used in each reaction. The PCR products were analyzed on 3% agarose gels containing 0.5× Tris-borate-EDTA electrophoresis buffer and 0.5 µg of ethidium bromide per ml.

Cell sorting with magnetic beads. Lymphocytes were positively sorted for the CD15⁺ (granulocytes), CD19⁺ (B cells), or surface immunoglobulin D-positive (sIgD⁺) (naive B cells) phenotype by using Dynabeads 450 CD15 or CD19 (pan B) or a CELLection Pan Mouse IgG kit conjugated with anti-IgD (PharMingen). Ficoll-Hypaque lymphocyte preparations from patient blood samples were mixed with Dynabeads at a concentration of 10⁷ beads/ml and incubated for 30 min at 4°C. The positively selected cells were isolated using a magnet (Dynal MPC) and detached from the Dynabeads using DETACHaBEAD CD19 or a releasing buffer (CELLection Pan Mouse IgG kit). The detachment of positively selected CD15 cells was not feasible. The positive and negative sorted cell compartments were stored at 20°C as dried pellets for QC-PCR.

Flow cytometric analysis. Ficoll-Hypaque-prepared lymphocytes (10⁶) were stained for three-color or two-color analysis with CD45-allophycocyanin (Caltag) and with CD3-fluorescein isothiocyanate (CD3-FITC) (Coulter) plus CD19-phycoerythrin (CD19-PE) (Coulter) or CD14-PE (Becton Dickinson) plus CD15-FITC (Coulter). Naive and memory B cells were stained with anti-IgD-FITC and anti-IgG-PE, respectively. Cells were stained with the appropriate antibodies at 4°C for 30 min and fixed in 1% paraformaldehyde. As negative controls, MsIgG2b-RD1 (IgG2 isotype control; Coulter), IgM-FITC (IgM isotype control; Coulter), and IgG1-PE and IgG1-FITC (IgG1 isotype control; Coulter) were used, as well as unstained cells. Flow cytometry measurements were analyzed using the Win MDI version 2.7 flow cytometry application.

Wright staining and microscopy. Cytospun cells were fixed on slides for 15 s in absolute methanol and air dried. Each sample was stained with Wright's stain (Shannon) for 1 min, after which an equal volume of a pH-balanced buffer was added and left for 8 to 10 min. The stained slides were rinsed thoroughly in distilled water. Cell morphology was assessed by bright-field microscopy using a Nikon E600 microscope.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

EBV viral DNA load is in CD19⁺ lymphocytes. After 5 years of observation of the dynamics of viral load in transplant recipients, we have obtained quantitative PCR results for EBV load for over 800 patients. One striking observation from the data (to be analyzed and published separately) is the development and persistence of asymptomatic chronic viral loads in over 50% of the subjects. The first question to be addressed was whether the chronic viral load that had been measured in the unsorted peripheral blood lymphocytes was indeed associated with the B-cell fraction of the lymphocyte population. Fresh peripheral blood lymphocytes from three chronic low-load carriers (patients 1, 5, and 8) and three chronic high-load carriers (patients 13, 16, and 19) were fractionated into B cells (CD19⁺) and T cells (CD19) using anti-CD19 magnetic beads. Flow cytometric analysis of the fluorescent-antibody-tagged lymphocytes revealed that the CD19⁺ cells consisted of distinct CD19^hi and CD19^lo subpopulations (Fig. 1). More than 90% of both CD19 subpopulations were recovered from the magnetic bead separation of the CD19-positive cells from purified peripheral blood lymphocytes. QC-PCR assays were then performed on 10⁴ CD19⁺ or 10⁵ CD19 cells. These numbers of cells were used in the PCRs to approximate the numbers of each cell type that are normally present in QC-PCRs conducted on unsorted lymphocytes. For the three low-load carriers and the three high-load carriers analyzed, PCRs using the CD19⁺ cells were positive for viral DNA. Detectable EBV DNA was sometimes present in the CD19 populations, but this positivity was always less than 10% and correlated with the degree to which the CD19 population contained residual CD19⁺ cells. Complete removal of all CD19⁺ cells eliminated PCR positivity from the CD19 populations. These results are consistent with the viral load detected in chronic load carriers being carried by the B-cell population.

View larger version (30K): [in this window] [in a new window]   FIG. 1.   Quantitation of viral load in cells fractionated on the basis of CD19 expression. Viral load is restricted to the CD19+ fraction of peripheral blood lymphocytes. (A) Flow cytometric profile of CD19 fluorescence in a typical lymphocyte preparation from a chronic viral load carrier. The CD19+ fraction is composed of a CD19hi and a CD19lo peak of fluorescence. (B) Ethidium bromide-stained DNA products of QC-PCRs using 104 CD19+ or 105 CD19 cells and 8, 40, 200, or 1,000 copies of an identical competitor target sequence (lower of the two PCR product bands) were analyzed by agarose gel electrophoresis. Results for patient 8 (a low-load carrier) and patient 16 (a high-load carrier) are shown. The interpolated DNA concentration in copy numbers of EBV genomes detected is shown below each panel.

EBV viral DNA load is in the CD19^hi subpopulation. The EBV viral load in normal latently infected virus carriers is not distributed equally among all B-cell compartments but is carried exclusively in the memory B-cell subpopulation (17, 18). The presence of two distinct subpopulations of CD19⁺ cells in the patient blood specimens seemed unusual and immediately suggested that there could be a relationship to the chronic load carrier state detected by QC-PCR. This notion was reinforced by the observation that normal control lymphocyte preparations did not contain a CD19^lo subpopulation. In addition, the CD19^lo population was positive for sIgG and not for sIgD, a characteristic of memory B cells (Fig. 2).

View larger version (40K): [in this window] [in a new window]   FIG. 2.   Characterization of the CD19hi and CD19lo cell populations detected in the peripheral blood lymphocyte fraction. (Top row) Flow cytometric analysis of B-cell (CD19) and T-cell (CD3) markers after gating on the population of high-FS and -SS cells unique to lymphocyte preparations of transplant recipients compared to a normal healthy EBV-positive control donor. (Center panels) Analysis of the sIgG and sIgD expression. (Bottom panels) Analysis of monocyte (CD14) and granulocyte (CD15) markers. High-FS and -SS cells appear to be CD19lo, IgG+, and CD15+.

View larger version (54K): [in this window] [in a new window]   FIG. 3.   Wright staining of lymphocyte preparations from a pediatric transplant recipient (left panel) reveals the presence of polymorphonuclear cells, and the light-scattering profile contains large numbers of high-FS and -SS cells. A normal control donor lymphocyte preparation (center panel) has no polymorphonuclear cells and no high-FS and -SS cells. Incubation of a blood specimen at 4°C overnight prior to Ficoll-Hypaque gradient preparation shows the appearance of polymorphonuclear cells and high-FS and -SS cells (right panel)

View larger version (72K): [in this window] [in a new window]   FIG. 4.   Ethidium bromide-stained DNA products of QC-PCRs using 105 CD15+ or 105 CD15 cells and 8, 40, 200, or 1,000 copies of an identical competitor target sequence were analyzed by agarose gel electrophoresis. Results for patients (pt) 1, 4, 5, and 8 are shown. The concentration in copy numbers of EBV genomes detected is shown below each panel.

EBV viral DNA load is in the sIgD B-cell subpopulation. Normal immunocompetent virus carriers have loads equivalent to 0.2 to 0.5 copies/10⁵ lymphocytes and carry the load in the memory B-cell compartment of the B-cell population (2, 22). This has been demonstrated by sorting cells on the basis of whether they express sIgD, a marker for mature, naive B cells. Therefore, the key issue concerning the chronic load in immunocompromised carriers is whether the sIgD⁺ B cells contain a significant proportion of the circulating viral load. For this analysis, we analyzed 10 chronic low-load and 9 chronic high-load carriers. Five of the chronic low-load carriers and four of the chronic high-load carriers had no history of PT-LPD, while five of each of the low- and high-load carriers had a previous diagnosis of PT-LPD. Anti-IgD magnetic beads were used to fractionate these cells from the lymphocyte preparations. More than 90% depletion of sIgD⁺ cells was obtained with a single incubation with magnetic beads (Fig. 5A). The sIgD and sIgD⁺ cell populations were then analyzed by QC-PCR for the presence of viral DNA. An example of the QC-PCR analysis for a low-load carrier and a high-load carrier is shown in Fig. 5B. The high-load carrier had a viral load of 5,000 copies/10⁵ lymphocytes, which was the highest load of any patient in this study. QC-PCR analysis of this specimen clearly indicates that no portion of the load was detected in the positively selected sIgD⁺ cells.

View larger version (57K): [in this window] [in a new window]   FIG. 5.   EBV viral load in naive B cells fractionated from lymphocyte preparations from chronic viral load carriers. (A) Flow cytometric profiles of sIgG- and sIgD-stained cells before (left panel) and after (right panel) anti-IgD magnetic bead separation of the naive B cells. (B) Ethidium bromide-stained DNA products of QC-PCRs using 104 IgD+ or 105 IgD cells and 8, 40, 200, or 1,000 copies of an identical competitor target sequence were analyzed by agarose gel electrophoresis. Results for patient 7, a low-load carrier, and patient 15 (a high-load carrier) are shown. The interpolated DNA concentration in copy numbers of EBV genomes detected is shown below each panel. A complete analysis of all 19 patients in the study is summarized in Table 1.

Relative proportions of B cells in lymphocyte populations. The chronic viral loads of immunosuppressed transplant recipients are 100- to 10,000-fold higher than the loads that have been measured in latently infected immunocompetent individuals (6). For both patients and controls the viral loads are carried in the same subfraction of the B-cell population. It was possible from the studies we have presented thus far to conclude that the greater viral loads were due, at least in part, to an expansion of the IgD B-cell compartment. We therefore conducted an analysis of the relative proportions of B cells carrying sIgD (naive B cells), B cells carrying sIgG (memory B cells), CD15⁺ cells (granulocytes), and other cells (T cells, NK cells, monocytes, and granulocytes) in Ficoll-Hypaque lymphocyte preparations (Fig. 6). Blood samples from pediatric transplant recipients with no detected EBV infection incubated overnight at 4⁰C were used as controls. The 4°C storage produced a similar level of contaminating granulocytes in the control population as in the chronic carriers, and there was no difference between the chronic low- and high-load carriers in the numbers of granulocytes present, indicating that the level of the viral load was not a factor in determining the presence of granulocytes. When only lymphocytes were considered, the proportion of B cells to total lymphocytes was 6% for the controls and 25% for the chronic viral load carriers. There was no significant difference between the high- and low-load carriers. The larger proportion of B cells in the viral load-carrying patient population is at most 4 times greater than normal. This modest increase in the fraction of B cells in lymphocyte preparations includes a relative increase in the uninfected IgD⁺ population and is within the range expected for pediatric blood specimens (9, 13).

View larger version (29K): [in this window] [in a new window]   FIG. 6.   Pictographs showing the relative proportions of B cells in the population of cells purified from the blood of immunosuppressed transplant recipients. On the left are the percentages of B cells in the total population, while on the right the CD15+ cells have been removed and only lymphocytes have been considered. (A) Control EBV-negative pediatric transplant recipients; (B) mean of all 19 chronic load carriers in the study group; (C) the 10 chronic low-load carriers; (D) the 9 chronic high-load carriers.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

We have determined that a large proportion (104 of 190 [54.7%]) of immunocompromised pediatric transplant recipients whom we have prospectively monitored become chronic viral load carriers carrying loads several orders of magnitude greater than normally observed in immunocompetent individuals. The load appears to be largely or entirely cell associated, as no viral DNA was detected in plasma specimens from even the highest-load carriers. Plasma-based PCR assays for EBV have been suggested for diagnostic purposes to detect EBV infection and lymphoproliferative disease (15). We have found that even during EBV productive disease the plasma fraction contains only a small fraction (<10%) of the total load in an equivalent volume of blood (data not shown) The inability to detect virus in the plasma of chronic viral load carriers indicates that plasma-based assays will probably miss the detection of virus infection in most cases.

We have identified the cells that are carrying the viral DNA in the lymphocyte populations obtained upon Ficoll-Hypaque separation of blood from chronic viral load carriers. To do this, it was necessary to adopt a strategy limited by the use of single incubations with antibody-coated magnetic beads. This was because (i) there were restricted numbers of available cells from patient specimens, which were subject to the losses inherent to magnetic bead sorts, and (ii) the sorted cells were often unable to survive secondary or tertiary bead incubations. A strategy for obtaining pure IgG⁺ B cells would involve an anti-CD15 bead negative sort to remove granulocytes followed by an anti-CD19 bead positive sort followed by an sIg positive sort. This type of strategy was not practical for most patients' specimens. We therefore set out to confirm that the EBV load was in memory B cells by a series of experiments using single bead sorts. We confirmed that the load was in the CD19⁺ cell fraction and then eliminated the CD19^lo cells from consideration by demonstrating that (i) they were granulocytes and (ii) they did not account for any significant portion of the viral load. The small amounts of viral DNA detected in the granulocyte preparations from the highest-load carriers were most likely the result of adherent B cells. We then assayed a large number of specimens using an anti-IgD bead separation to subfractionate the naive B cells from the total lymphocyte pool and determined that these cells did not harbor a viral load. The sum of the observations is that the viral load appears to be carried by CD19^high CD15 sIgD cells, a phenotype which is consistent with EBV being carried in memory B cells. The same B-cell compartment carries the latently infected cells of immunocompetent adults (2). Thus, these results suggest that the chronic viral load of immunosuppressed pediatric transplant recipients is most likely carried in a latent state.

In related work, preliminary results from our laboratory with reverse transcriptase PCR analysis of sentinel viral gene expression confirms the presence of RNA for the LMP2a latency-associated gene and the absence of expression of genes associated with immortalization and lytic virus production in the peripheral blood of the chronic low-load carriers (20). The pattern of viral gene expression in the high-load carrier state is not as simple. It is characterized by expression of LMP1 and LMP2a. The results reported here indicate that the different viral gene expression patterns seen in low- and high-load carriers occur within the memory B-cell fraction. The proportion of memory B cells to naive B cells and other lymphocytes in the peripheral circulation of chronic viral load carriers is not greatly skewed in favor of memory B cells and actually falls within the range of expected values for children. Since this relatively small fraction of cells harbors all the elevated viral load in immunocompromised transplant recipients, then within the memory B-cell compartment a high proportion of the cells is likely to be infected. If the estimate of 2 to 5 genomes per cell for latently infected cells in adults (17) is assumed to be correct for this patient population as well, then approximately 1 of 10 memory B cells (for a load of 1,000/10⁵ lymphocytes) to 1 of 1,000 memory B cells (for a load of 10/10⁵ lymphocytes) carries viral DNA. These frequencies for viral DNA-positive cells make in situ studies feasible for further defining and characterizing this population.

Although intuitively a high viral load cannot be viewed as desirable, it is not yet clear exactly what risks are associated with the persistently elevated-load carrier state of immunocompromised patients. If the state of the virus infection in the peripheral blood is indicative of the state of infection in lymphoid tissues and other organs, then the present studies reveal an essentially quiescent, but potentially dangerous, situation that conventional antiviral therapies cannot affect. Experimental therapies involving intravenous administration of anti-CD20 antibodies to abolish the B-cell compartment do diminish the circulating viral load but in many cases may unnecessarily affect the large and uninfected naive segment of the B-cell population. Our data suggest that it might be more logical to use therapeutic agents that target only the memory B-cell population not only as therapy for disease, but also in preemptive therapeutic strategies aimed at reducing high-load carrier states.

Our preliminary analyses of chronic load carriers and patients with PT-LPD suggest that there are shifts in the distribution of the load in the peripheral blood between naive and memory compartments (not shown) and in the patterns of viral gene expression that are associated with the PT-LPD disease state 20). We are developing new diagnostic tools based on these observations that will define the state of the infection more clearly than is presently possible with measurements of a viral load alone.