INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Traditionally the clinically most important Streptococcus species have been identified by Lancefield carbohydrate antigen detection and the application of a few biochemical or physiological tests. Difficulties arise when less-prevalent species are to be dealt with. Lancefield groups are not species-specific (5, 10), and certain species groups (2) are notoriously difficult to differentiate phenotypically (8).

A number of genotypic methods have been evaluated for the identification of streptococci: amplified ribosomal DNA restriction analysis (7, 9), amplification of ddl genes (6), and sequencing of the MnSOD gene (13). tRNA intergenic length polymorphism analysis (tDNA-PCR) (15) has been used not only for the differentiation of streptococcal species (3, 12) but also for Acinetobacter (4, 16), staphylococci (11), Listeria (14), and enterococci (1). Thus far the interlaboratory reproducibility of this kind of genotypic identification technique has been ill studied although it is crucial with regard to the ability to compare fingerprints generated in different laboratories and with regard to the construction of publicly accessible DNA fingerprint data banks. Here we evaluated the interlaboratory reproducibility of tDNA-PCR in combination with capillary fluorescent electrophoresis and its suitability for identification in routine diagnostics.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacterial strains. Fifty-four BCCM-LMG culture collection strains (University of Ghent, K. L. Ledeganckstraat 35, B-9000 Ghent) belonging to 18 streptococcal species were used to standardize the method of tDNA-PCR and to evaluate its interlaboratory reproducibility (Table 1). The collection was extended with 47 strains of the BCCM-LMG culture collection belonging to 17 other streptococcal species (Table 2). Ten collection strains were subjected to blind testing in all three laboratories.

DNA preparation. Bacterial cells were grown overnight on Columbia agar (Gibco Life Technologies, Paisley, Scotland) with 5% ovine blood for 24 h at 37°C in a 5% CO₂-enriched environment and checked for purity. A 1-µl loopful of cells was suspended in 20 µl of lysis buffer (0.25% sodium dodecyl sulfate, 0.05 N NaOH) and heated at 95°C for 5 min. The cell lysate was spun down by brief centrifugation at 16,000 × g and neutralized by adding 180 µl of distilled water. The cell debris was removed by centrifugation at 16,000 × g for 5 min. Supernatants were used as the DNA in the PCR or were frozen at 20°C until further use.

tDNA-intergenic PCR. PCR was carried out using outwardly directed tRNA gene consensus primers T5A (5' AGTCCGGTGCTCTAACCAACTGAG) and T3B (5' AGGTCGCGGGTTCGAATCC) as described by Welsh and McClelland (15). Reactions were carried out in a 10-µl volume containing 9.1 µl (dilution, 1.1) of High Fidelity Mix (Gibco Life Technologies). Primers were added to a final concentration of 0.1 µM. Primer T3B consisted of a mixture of one-fifth fluorescent TET-labeled oligonucleotides and four-fifths nonlabeled oligonucleotides (PE Biosystems, Nieuwerkerk a/d IJssel, The Netherlands). A volume of 0.7 µl of sample DNA was added (dilution, 1/15). After 2 min at 94°C, reaction mixtures were cycled 30 times in a Perkin-Elmer Cetus 9600 thermocycler with the following conditions: 30 s at 94°C, 1 min at 50°C, and 1 min at 72°C, without a final extension period. Reaction vials were then cooled to 10°C and kept on ice until used in electrophoresis.

Capillary electrophoresis. Twelve microliters of deionized formamide was mixed with 0.5 µl of an internal size standard mixture containing 0.3 µl of the GS-400 high-density size standard and 0.2 µl of the GS-500 size standard, which both contain ROX-labeled fragments in the range of 50 to 500 bp. One microliter of tDNA-PCR product was added. The mixtures were denatured by heating at 95°C for 3 min and placed directly on ice for at least 15 min (according to the recommendations of the manufacturer).

Data analysis. tDNA-PCR fingerprints were obtained as table files from the Genescan Analysis software and used in a software program developed at our laboratory (1). Using these sample files containing tDNA spacer fragment lengths (peak values) in base pairs, this program enabled us to construct manually a library which contains one entry for each species and whereby each entry consists of a number of numeric values representing the peak values in base pairs. The peak values in the library entries are the averages of the peak values obtained after testing different strains of each species, which are listed in Tables 1 and 2. The peaks retained for each entry are user selected, which means that the scientist takes the final decision about which peaks appear to be characteristic for each species. Negative values can be added to indicate that a certain peak must not be present in the fingerprint in order to be identified as a certain species. The similarity between the unknown fingerprint and a library entry is calculated with a coefficient, further referred to as dbp (differential base pairs): the number of fragments in common between the unknown fingerprint and the species entry, divided by the total number of fragments of the species entry in the library. A peak position tolerance of 0.7 bp was used.

Reproducibility testing. One S. agalactiae strain (LMG 14694^T) was tested 135 times by tDNA-PCR in order to evaluate the variation caused by differences in PCR mixture preparation, PCR cycling, and electrophoresis runs at and between three different laboratories.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Standardization. In the three laboratories, different protocols were tested in order to assess the best fingerprint results. This revealed that the PCR conditions which produced the most reproducible and discriminatory tDNA fingerprints in each laboratory were obtained with the PCR mixture composition and the PCR cycling conditions as described in Materials and Methods.

Reproducibility. Extensive testing of the reproducibility of tDNA-PCR was done by repeated amplification of one S. agalactiae strain (LMG 14694^T) in different laboratories using different reaction mixtures, thermal cycling runs, and capillary electrophoresis runs. One of the 45 PCR mixtures and 10 of the 135 electrophoresis runs failed to produce a fingerprint. This resulted in 122 tDNA fingerprints available for the reproducibility studies.

Discriminatory power. Most species were easily distinguishable using tDNA-PCR (Table 6). The closely related species S. bovis, S. alactolyticus, and S. gallolyticus showed resembling but distinctive tDNA fingerprints. S. mutans and S. gordonii differed in one base pair of only one peak. The species S. anginosus, S. constellatus, and S. intermedius could be differentiated by the longer tRNA spacer fragments. S. canis and S. dysgalactiae fingerprints differed slightly in two peak values (Table 6). S. oralis, S. mitis, S. parasanguinis, and S. pneumoniae were not distinguishable on the basis of their tDNA pattern, nor were S. vestibularis and S. thermophilus. Some species were divided into two groups on the basis of different tDNA patterns. This was the case for S. iniae and S. porcinus.

View larger version (33K): [in this window] [in a new window]   FIG. 1.   Dendrogram obtained after similarity calculations between the tDNA fingerprints of streptococci. The bar represents a distance of 10%.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

tDNA-PCR and capillary electrophoresis of the amplified DNA fragments already have been evaluated for the differentiation of Listeria species (14) and enterococci (1). To enable identification of a large number of strains, a software program which was described previously (1) has been developed at our laboratory. In the present study, the interlaboratory reproducibility of tDNA-PCR was evaluated in order to develop a fully exchangeable digital fingerprint database which can be consecutively extended with new fingerprints of species belonging to a wide array of genera.

For S. agalactiae strains, tDNA-PCR resulted in a fingerprint with six reproducibly present peaks. The standard deviation of the amplified tDNA spacer fragment lengths (peak values) was calculated for each of the six peaks obtained in 122 fingerprints of strain LMG14694^T. The standard deviation of all samples ranged from 0.19 to 0.38 bp for peaks between 54 and 253 bp, which indicates that reproducibility with regard to peak values was extremely high.

The presence or absence of peaks must be caused by different PCR mixtures and/or PCR cycling runs and not by electrophoretic migration differences. The six DNA fragments which are most strongly amplified are reproducibly present in more than 97.5% of all cases. Therefore it can be concluded that peak presence reproducibility, i.e., PCR reproducibility, is high. Further, it becomes clear that the variation of peak values around the mean value is caused by electrophoretic run-to-run differences in and between laboratories (Table 4). The results show that electrophoresis of the same PCR product on another genetic analyzer can give peak position differences of more than 1 bp (the highest range found was 1.56 bp), which means that the difference is due to variation in migration and not to the addition or loss of a nucleotide during PCR. Therefore we conclude that the final variability between the obtained fingerprints was not caused by PCR mix preparation or by PCR cycling runs either in one laboratory or in different laboratories, but solely by differences in migration during capillary electrophoresis, whereby the largest difference occurred between ABI Prism 310 genetic analyzers in different laboratories. Nevertheless, the reproducibility was found to be very high and a peak position tolerance of less than 0.8 bp can be used to score corresponding fragments as identical.

In one laboratory, PCR mixtures were cycled on three other PCR cyclers and electrophoresis was carried out on the same genetic analyzer. The standard deviations for the six peaks ranged from 0.11 to 0.22 bp. This means that this PCR assay can be performed on the four PCR cyclers tested without the need for adjustment of the cycling conditions.

The observation that prolonged extension resulted in the disappearance of double peaks can be explained by the fact that this enables the Taq polymerase to add an extra A to most of the PCR fragments, causing these to outnumber the peaks without an additional A.

To be able to compare a large number of patterns, a software program was developed in our laboratory. It takes into account only peak values, not peak intensities. Importantly, extra peaks which are caused by electrophoretic impurities or other unknown factors are ignored by the approach used here and therefore cannot influence the identification results. Variability in peak positions due to electrophoretic differences can be compensated by enlarging the position tolerance in the software. Still, visual checking of the patterns to confirm the results is advised.

tDNA-PCR seems to be suited for the identification of most streptococcal species. However, S. mitis, S. oralis, S. parasanguinis, and S. pneumoniae, belonging to the clinically important viridans streptococci and to one phylogenetically closely related S. mitis species group (2), showed highly resembling patterns (see Table 6) and were not distinguishable. Recently, Degheldre et al. (3) have evaluated the discriminatory power of tDNA-PCR for the differentiation of viridans streptococci with separation of fragments on an ALFexpress DNA sequencer. Apparently, the patterns they found are not similar to those obtained in our study, because of the presence of more large fragments and fewer small ones. In their study, the large fragments enabled discrimination within the S. mitis group. The cause of this disagreement is not clear.

tDNA-PCR is very rapid and relatively easy to perform. In a PE 9600 thermocycler, 96 samples can be run at once. Starting from a single colony, DNA extraction takes about 3 h for 96 strains. The preparation of the tDNA-PCR mixtures in separate tubes and addition of the sample DNA takes about 1 h and the PCR run itself takes 2 h. During this run, the genetic analyzer ABI Prism 310 capillary electrophoresis apparatus can be prepared. Denaturation and preparation of the PCR products takes about 30 min. The electrophoresis run takes about half an hour per sample, but with the use of different dyes for labeling primers, three samples can be run at the same time. Quality control of the obtained profiles by means of GeneScan analysis and comparison of the tDNA-PCR profiles of the unknown strains with the database takes another hour. Summarized results for all 96 strains can be available within 25 h if the three-dye technology is used. Obviously, taking fewer samples at once will reduce the manipulation time, which makes it possible to have the first electrophoresis results within 8 h after colony picking.

The cost, including culture, DNA extraction, PCR, and capillary electrophoresis, was calculated as $2.50 per strain. Given the possibility for automation, the broad applicability of tDNA-PCR for species identification, and the interlaboratory exchange of data due to its high reproducibility, tDNA-PCR could be developed as a routinely applicable genotypic identification technique.