![[Feedback]](/icons/banner/feedbackACT.gif)
![[For Subscribers]](/icons/banner/subscriberACT.gif)
![[Archive]](/icons/banner/archiveACT.gif)
![[Search]](/icons/banner/searchACT.gif)
![[Contents]](/icons/banner/tocACT.gif)
Previous Article | Next Article 
Journal of Clinical Microbiology, April 2001, p. 1530-1535, Vol. 39, No. 4
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.4.1530-1535.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
A Combination of Two Genetic Markers Is Sufficient for
Restriction Fragment Length Polymorphism Typing of Mycobacterium
tuberculosis Complex in Areas with a High Incidence of
Tuberculosis
Voahangy
Rasolofo-Razanamparany,1,*
Herimanana
Ramarokoto,2
Guy
Aurégan,3,
Brigitte
Gicquel,4 and
Suzanne
Chanteau1
Unité
Tuberculose-Peste1 and Centre National
de Référence des
Mycobactéries,2 Institut Pasteur, 101 Antananarivo, and Programme National de Lutte
Anti-Tuberculeuse, Ministère Santé,3
Madagascar, and Unité de Génétique
Mycobactérienne, Institut Pasteur, 75724 Paris Cedex 15, France4
Received 11 July 2000/Returned for modification 17 October
2000/Accepted 26 January 2001
 |
ABSTRACT |
The incidence of tuberculosis (TB) in Madagascar is 150 cases per
100,000 people. Because of this endemicity, we studied the genetic
diversity of Mycobacterium tuberculosis strains isolated in
four big cities in 1994 to 1995 with the aim of monitoring TB
transmission. Isolates from 316 cases of pulmonary TB
(PTM+) were typed by Southern hybridization with genetic
markers IS6110 and DR. Of the 316 PTM+ strains,
66 (20.8%) had a single IS6110 band and were
differentiated by the DR marker into 33 profiles. Using both markers,
37.7% (119) of the patients were clustered, a proportion similar to
that in countries with a high prevalence of TB. There was no
significant difference between clustered and nonclustered patients in
age, sex, Mycobacterium bovis BCG status, and drug
susceptibility of strains. Clustering was significantly greater in the
capital, Antananarivo, than in the other cities, suggesting a higher
rate of transmission. However, most of the patients in clusters were living in different areas, and, within a distance of 0.7 km, we did not
find epidemiologically unrelated strains with the same restriction
fragment length polymorphism profile. Despite an apparently low
polymorphism, genetic markers such as IS6110 are
potentially valuable for monitoring TB transmission. However, the high
proportion of Malagasy isolates with a single IS6110 copy
makes this marker alone unsuitable for typing. Additional markers such
as DR are necessary for the differentiation of the isolates and for
epidemiological surveys.
| |
INTRODUCTION |
Since the discovery of repetitive
elements associated with polymorphism and their use as genetic markers
for Mycobacterium tuberculosis, strain differentiation by
DNA typing has greatly facilitated epidemiological studies (7, 8,
35). To type M. tuberculosis complex strains, the
most extensively used method has been a standardized protocol of
restriction fragment length polymorphism (RFLP) analysis with insertion
sequence IS6110 as a marker (29, 31). This
method has also been used successfully in confirming epidemics and
nosocomial infections and in studies on transmission of tuberculosis
(TB) in high-risk communities (5, 11, 13, 15, 17, 24).
Another marker often used for discriminating strains is the direct
repeat (DR) region, which contains multiple 36-bp DRs separated by
variable spacers (31 to 45 bp in length), which are sources of
diversity (21).
In Madagascar (about 13 million inhabitants), the incidence of
pulmonary tuberculosis is very high (about 150 cases per 100,000 people) (9). In contrast, the prevalence of human
immunodeficiency virus (HIV) is low, and between 1989 and 1994 only six
of a total of 3,168 tuberculous patients tested were HIV seropositive
(4). RFLP studies of clinical isolates in countries with a
high incidence of TB describe limited polymorphism of TB genetic
markers such as IS6110. To determine the usefulness of this
marker to monitor transmission in these countries, we studied the
diversity of M. tuberculosis complex strains from pulmonary
patients (PTM+) in four big cities in Madagascar. We
have correlated strain polymorphism with geographic
areas. Such data will allow the detection of epidemics and an
understanding of TB transmission in this country.
| |
MATERIALS AND METHODS |
Study population.
This study was carried out in the capital,
Antananarivo, and in three other large cities, Antsirabe, Fianarantsoa,
and Mahajanga, and was conducted jointly with a survey of M. tuberculosis primary resistance in 1994 to 1995 (10).
Between August 1994 and December 1995, of the 1,389 PTM+
patients identified in eight diagnostic and treatment centers, 1,108 new patients (81.5%) were included. For DNA fingerprinting, 316 patients were randomly sampled. They were representative of the eight
centers: 153 patients from Antananarivo, 27 from Antsirabe, 64 from
Fianarantsoa, and 72 from Mahajanga. The age of the patients was 11 to
74 years (mean age: 34 years). The male-to-female ratio was 1.53:1.
Mycobacterium bovis BCG status was known for 306 patients, of whom 223 were vaccinated.
All patients included in this study were Malagasy and HIV seronegative.
Bacteriology.
All clinical specimens were cultured on
standard Lowenstein-Jensen (LJ) medium (Diagnostics Pasteur, Paris,
France) and on LJ medium without glycerol but supplemented with 0.5%
pyruvate. Mycobacterial isolates were identified according to growth on LJ medium, colony morphology, and biochemical tests for the following: niacin production, catalase, urease, and nitrate reductase
(20). Drug susceptibility of the PTM+ isolates
to streptomycin, isoniazid, rifampin, and ethambutol was tested using
the proportion method (6), as recommended by the Global
Tuberculosis Programme of the World Health Organization and the
International Union against Tuberculosis and Lung Disease (19).
RFLP typing.
Genomic DNA from only one strain from each
PTM+ patient (316 isolates) was extracted according to the
method described by van Soolingen et al. (36) and tested
by RFLP analysis. DNA fingerprints were obtained using a standardized
RFLP technique with the IS6110 insertion sequence
(IS6110 pattern) (31). Briefly, chromosomal DNA
was digested with restriction endonuclease PvuII (Pharmacia Biotech) and was hybridized with the 807-bp
PvuII-XhoI fragment of IS6110
(29). For strains with one to four copies of
IS6110, DNA was also digested with AluI
(Pharmacia Biotech) and hybridized with the 36-bp DR sequence probe
(5'GTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC3') (21). All probes were labeled with horseradish
peroxidase and detected with the enhanced chemiluminescence system
(ECL; Amersham).
Analysis of RFLP patterns.
The Taxotron software (P. A. D. Grimont, Institut Pasteur, Paris, France) was used for
computer-assisted analysis of the RFLP patterns. Patterns were
compared by the unweighted pair group clustering method of averages,
and matching was further confirmed by visual examination. A cluster of
M. tuberculosis strains was defined as two or more isolates
with identical RFLP patterns. A cluster of patients was defined as two
or more patients with identical strains. Epidemiological relationships
between patients belonging to a cluster were also investigated. The
geographical distribution of the clusters was assessed on the basis of
the place of residence of the patients. The characteristics of
clustered patients and nonclustered patients were compared. For
assessing differences between percentages, we used the 
2
test or Fischer's exact test for values 
5. Differences were considered significant if P values were <0.05.
| |
RESULTS |
DNA polymorphism of the M. tuberculosis complex strains
isolated from PTM+ patients.
The IS6110
RFLP types for 316 PTM+ strains, a representative sample
corresponding to 28.5% of the patients included (and 23% of the
patients identified in the four cities for the 1994 to 1995 period),
were determined. Of these strains, 312 were identified as M. tuberculosis and 4 were identified as M. bovis.
One strain from Antananarivo had no hybridizing band, suggesting that
it did not contain the IS6110 element. One hundred and seventy-seven isolates (56%) had unique IS6110 patterns,
and 138 (43.6%) were assigned to 28 IS6110 clusters of 2 to
52 strains (Fig. 1). The number of
IS6110 copies per strain was between 1 and 22 (Fig.
2). The number of bands in the 177 isolates with unique banding patterns also varied from 1 to 22, and in
the clustered isolates the number varied from 1 to 17. Sixty-six
strains (20.8%) had a pattern with only one hybridizing band,
suggesting that they contained a single IS6110 copy. The
proportion of strains with a single IS6110 copy was the
highest in Mahajanga (36.1%); the proportions were 17.6, 15.6, and
11.1% in Antananarivo, Fianarantsoa, and Antsirabe, respectively.
Among these 66 strains, seven fragment sizes were observed: 1.35 (1 strain), 1.45 (52 strains), 1.56 (1 strain), 1.8 (4 strains identified
as M. bovis), 4.1 (1 strain), 4.8 (6 strains), and 5.1 kb (1 strain). Moreover, 30 strains had a pattern with two to four bands
containing IS6110. The strains with zero to four
IS6110 copies were further genotyped with the DR marker
(Fig. 3) (one strain of IS6110
cluster 4 was not viable and, therefore, could not be DR typed). Among
those strains with zero to four IS6110 copies, from 4 to 14 restriction fragments were hybridized with the DR probe, producing 46 different DR patterns. Thirty-seven isolates had unique DR patterns,
and 59 fell into nine clusters of 2 to 10 strains. There were isolates
having the same DR pattern but having different IS6110
profiles (Table 1; Fig. 3). DR cluster A,
for example, contained 19 isolates that could be differentiated into
nine IS6110 profiles. However, for those strains with one
IS6110 copy, strains with different IS6110 profiles also had different DR patterns (Table
2; Fig. 3A). Likewise, the same DR
pattern was observed for all M. bovis strains, and it was
different from the DR patterns of M. tuberculosis isolates. The strain without the IS6110 element had a DR profile
different from that of all other strains.
View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2.
Numbers of IS6110 copies in 316 M. tuberculosis complex strains isolated from PTM+
patients in Madagascar.
|
|
View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
(A) DR patterns of the isolates with zero or one
IS6110 copy. (B) DR patterns of the isolates with two to
four IS6110 copies. The numbers of IS6110
clusters are given on the left. U1 to U29, strains with unique
IS6110 profiles; A through I, DR clusters; (1), M. bovis strains; (2), strain of IS6110 cluster 4 not
viable and not available for DR typing.
|
|
On the basis of both IS6110 and DR patterns, 197 PTM+ patients (62.3%) gave isolates that were not
clustered and 119 (37.7%) gave isolates that were contained within 34 clusters of 2 to 10 isolates (Table 3).
The 19 additional strains demonstrating a unique profile with two
markers were composed of two groups: (i) 17 strains with one
IS6110 band (Fig. 3A) and (ii) 2 strains with two
IS6110 bands (Fig. 3B). Therefore, it appears that DR typing is especially useful for discrimination between isolates with one
IS6110 copy. The small clusters were the most frequently
observed group, accounting for 68% of the clusters but less than 50%
of the isolates. These were further broken down as 21 clusters of two
patients and 2 clusters of three patients. In comparing the characteristics of the clustered and the nonclustered patients (Table
4), we found that clusters of patients
did not differ significantly in age, sex ratio, and BCG status and that
the drug susceptibility patterns of the isolates also did not differ
significantly. Similarly, no significant difference between the two
groups within any of the individual cities was found (data not shown).
Finally, a comparison of the RFLP profiles of drug-resistant and
drug-susceptible strains revealed no correlation between drug
resistance and RFLP pattern (36).
Geographical distribution of the clusters.
One hundred and
thirty-eight strains (43.6% of the studied strains) were assigned to
28 IS6110 patterns. Thirteen of them (eight clusters of two
patients and five with more than two patients) were recovered in at
least two different cities (Fig. 1). One IS6110 pattern (two
patients) was found only in Antsirabe, 4 were found only in
Fianarantsoa, and 10 were found only in Antananarivo. An RFLP pattern
with an IS6110 band at 1.45 kb (IS6110 cluster 3)
was the only profile found in all four cities. Of the 46 DR patterns of
the strains with one IS6110 copy, only 6 were found in two
or more cities (data not shown).
When both the IS6110 and DR markers were used together, the
proportion of clustered patients differed significantly between the
cities. It was higher in Antananarivo (38.5%; 59 of 153) than in the
three other cities (P = 0.003): 26.5% (17 of 64) in
Fianarantsoa, 25% (18 of 72) in Mahajanga, and 7.4% (2 of 27) in
Antsirabe. In Antsirabe, Fianarantsoa, and Mahajanga, the patients
belonging to any single cluster lived in different areas of the city.
In Antananarivo, except for two patients living at the same address and
eight patients in Antananarivo prison, all the patients within clusters
lived in different districts of the city. The two closest patients
within the same cluster lived in different districts, within a distance
of about 0.7 km (IS6110 cluster 3; DR pattern A). Although
the polymorphism of strains in these cities seems relatively low, RFLP
typing may be a valuable epidemiological tool for identifying transmission.
| |
DISCUSSION |
The present study is the first on DNA polymorphism of the M. tuberculosis complex strains in Madagascar, a country in which TB
is hyperendemic (3). Four of the largest cities
(Antananarivo, Antsirabe, Fianarantsoa, and Mahajanga) were
chosen for this study. Using a two-genetic-marker typing method
(IS6110 and DR), we found three IS6110 clusters
containing strains that were differentiated using the second marker.
There were two IS6110 clusters with isolates having one
IS6110 band pattern (clusters 2 and 3) and one cluster with
two-band-pattern isolates (cluster 5). Moreover, for some isolates
having an IS6110 profile with two to four bands, some DR
clusters contained isolates with different IS6110 patterns (Table 1). These results indicate that the changes in the DR and the
IS6110 profiles are independent events and that only
isolates with the same IS6110 and DR patterns can be
considered identical strains. Our results can be favorably compared
with those of Gillespie et al., who used the IS6110 and the
PGRS markers for typing isolates from Tanzania with six or more band
profiles (18). They found that only 1 of 13 IS6110 clusters contained isolates with different PGRS
patterns. In this study, genotyping with a second marker was done only
on isolates with patterns of less than five IS6110 bands.
Thus, both our results and those of Gillespie et al. showed the
usefulness of two-marker genotyping. An additional advantage of typing
with the DR sequence that we chose as a second marker is that it can be
performed using the PCR technique, avoiding large-scale cultures of
M. tuberculosis (23).
The overall polymorphism of the strains as assessed by the number of
clustered strains for the two genetic markers, IS6110 and
DR, was low (37.7% for PTM+ strains). This is similar to
results reported from other African and Asian countries but differs
from what is observed in Europe or North America (16, 22, 35,
36,). The majority of the clusters (21 of 34) contained only two
strains, probably due to the limited sample size. Only 42% (13 of 28)
of the IS6110 patterns and 13% (6 of 46) of the DR patterns
were found in more than one city, suggesting limited transmission
between patients from different cities. Moreover, most patients
contained within specific clusters lived in different areas in their
city rather than in close proximity. The minimum distance between two
clustered patients without any reported epidemiological link was 0.7 km. Despite the finding that the clustering of these patients was not
related to risk, it is apparent that the polymorphism of markers used
for M. tuberculosis strains is sufficient for detecting
epidemics, for monitoring the transmission of resistant strains, and
for tracking TB transmission in high-risk groups within particular
areas (26).
Molecular epidemiology studies can lead to two hypotheses: first, that
the degree of clustering can be used as a measure of recent and active
transmission of TB (2, 28, 30), and second, that more
young patients than old patients have recent infections and thus are
more likely to belong to clusters. In our study, we found that the
proportion of clustered patients was higher in Antananarivo than in the
other cities, suggesting a more-active transmission of TB in the
capital. However, ages of clustered and nonclustered patients were not
significantly different. There are several possible explanations for
this: (i) the population in the capital is highly mobile, (ii) the
incubation time after an infection is highly variable, (iii) the
prevalence of TB and the circulation of strains are so high that the
risk of reinfection is the same throughout the population, and (iv) the
reactivation of old infections is less frequent than expected
(32). Another possibility is based on a recent study in
Malaysia (12), where the authors reported an apparent
increase in clustering with the age of the patients and suggested that
strains with stable RFLP patterns may be in circulation for longer
periods and thus may contribute to clustering. Differences in virulence
among the strains could also explain the presence of some clusters. For
example, a virulent strain would be isolated more frequently than a
nonvirulent strain and thus would produce larger clusters.
Only one isolate did not contain the IS6110 genetic element.
Zero-copy strains have previously been described, with slightly higher
frequencies noted in patients from Vietnam, China, Thailand, and India
(1, 14, 25, 36). One interesting characteristic of the
Malagasy strains was the high proportion of
single-IS6110-copy strains (21.6% of the PTM+
sampled strains) including seven different positions of the
single-hybridizing band. These strains could be easily differentiated
by using the DR marker. The strains having an RFLP pattern with a
single-hybridizing band at 1.8 kb were all identified as M. bovis. This pattern is the same as that described for the majority
of M. bovis strains elsewhere (27, 34). Several
of the one-IS6110-band patterns have previously been found
with similar frequencies in: Vietnam (12%) (37), India
(30 to 40%) (14, 34), Thailand (20%) (25), and Malaysia (17.5%) (16). Thus, there appears to be a
similarity between Asiatic and Malagasy strains (zero- or
single-IS6110-band strains). This is not surprising because
the Malagasy population is descended from African, Asian, and Arabic
peoples who migrated to Madagascar several centuries ago, and there
have been extensive economic and tourist contacts between countries of
the Indian Ocean and Madagascar for centuries. It would be interesting
to use other genetic markers or the spoligotyping method
(23) to compare the Malagasy and Asiatic
single-IS6110-copy strains and to look for the presence of
other typical Asiatic patterns such as the Beijing and Nonthaburi
groups (25, 33).
| |
ACKNOWLEDGMENTS |
We are grateful to Elie J. Vololonirina, T. Rasolonavalona, and
P. Ravololonandriana for technical assistance and to F. Rakotomanana and M. Ratsitorahina for providing information about the patients. We
also thank the physicians of the diagnostic and treatment centers of
Antananarivo, Antsirabe, Fianarantsoa, and Mahajanga. We thank Isabelle
Jeanne and the Bureau de I'Urbanisme d'Antananarivo for providing the
Antananarivo city map.
The French National Reference Center for Mycobacteria (V. Vincent,
Pasteur Institute, Paris, France) was the reference laboratory for the
quality control of strain identification and drug susceptibility tests.
This study was supported by the French Cooperation (grant 93008) and
the Raoul Follereau Foundation.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Unité
Tuberculose, Institut Pasteur, B.P. 1274, 101 Antananarivo, Madagascar.
Phone: 261-20-22-401 64. Fax: 261-20-22-415 34. E-mail:vrasolof{at}pasteur.mg.
Present address: Programme Lèpre/Tuberculose, Ouagadougou 01, Burkina-Faso.
| |
REFERENCES |
| 1.
|
Agasino, C. B.,
A. Ponce de Leon,
R. M. Jasmer, and P. M. Small.
1998.
Epidemiology of Mycobacterium tuberculosis strains in San Francisco that do not contain IS6110.
Int. J. Tuberc. Lung Dis.
2:518-520[Medline].
|
| 2.
|
Alland, D.,
G. E. Kalkut,
A. R. Moss,
R. A. McAdam,
J. A. Hahn,
W. Bosworth,
E. Drucker, and B. R. Bloom.
1994.
Transmission of tuberculosis in New York City. An analysis by DNA fingerprinting and conventional epidemiologic methods.
N. Engl. J. Med.
17:1710-1716.
|
| 3.
|
Aurégan, G.,
D. Rakotondramarina,
J. Razafinimanana,
H. Ramarokoto,
O. Ratsirahonana, and M. Ralamboson.
1995.
Le Programme National de Lutte Anti-Tuberculeuse (PNLAT) à Madagascar.
Arch. Inst. Pasteur Madagascar
62:4-12[Medline].
|
| 4.
|
Aurégan, G.,
J. Morvan,
H. Zeller, and A. Rasamindrakotroka.
1995.
SIDA et tuberculose: la situation à Madagascar.
Arch. Inst. Pasteur Madagascar
62:24-25[Medline].
|
| 5.
|
Bergmire-sweat, D.,
B. J. Barnett,
S. L. Harris,
J. P. Taylor,
G. H. Mazurek, and V. Reddy.
1996.
Tuberculosis outbreak in a Texas prison, 1994.
Epidemiol. Infect.
117:485-492[Medline].
|
| 6.
|
Canetti, G.,
N. Rist, and J. Grosset.
1963.
Mesure de la sensibilité du bacille tuberculeux aux drogues antibacillaires par la méthode des proportions.
Rev. Tuberc. Pneumol.
27:217-272.
|
| 7.
|
Cave, M. D.,
K. D. Eisenach,
G. Templeton,
M. Salfinger,
G. Mazurek,
J. Bates, and J. T. Crawford.
1994.
Stability of DNA fingerprint pattern produced with IS6110 in strains of Mycobacterium tuberculosis.
J. Clin. Microbiol.
32:262-266[Abstract/Free Full Text].
|
| 8.
|
Cave, M. D.,
K. D. Eisenach,
P. F. McDermott,
J. H. Bates, and J. T. Crawford.
1991.
IS6110: conservation of sequence in the Mycobacterium tuberculosis complex and its utilization in DNA fingerprinting.
Mol. Cell. Probes
5:73-80[CrossRef][Medline].
|
| 9.
|
Champetier de Ribes, G.,
G. Ranaivoson,
E. Rakotoherisoa,
B. Andriamahefazafy, and S. Blanchy.
1997.
Le risque annuel d'infection tuberculeuse à Madagascar: étude réalisée de 1991 à 1994.
Bull. Soc. Pathol. Exot. Fil.
90:349-352.
|
| 10.
|
Chanteau, S.,
V. Rasolofo,
H. Ramarokoto,
T. Rasolonavalona,
O. Ratsirahonana,
M. Ratsitorahina,
F. Rakotomanana,
P. Boisier,
B. Cauchoix, and G. Aurégan.
1997.
Anti-tuberculosis drug resistance in Madagascar in 1994-95.
Int. J. Tuberc. Lung Dis.
1:405-410[Medline].
|
| 11.
|
Chaves, F.,
F. Dronda,
M. D. Cave,
M. Alonso-Sanz,
A. Gonzalez-Lopez,
K. D. Eisenach,
A. Ortega,
L. Lopez-Cubero,
I. Fernandez-Martin,
S. Catalan, and J. H. Bates.
1997.
A longitudinal study of transmission of tuberculosis in a large prison population.
Am. J. Respir. Crit. Care Med.
155:719-725[Abstract].
|
| 12.
|
Dale, J. W.,
R. M. Nor,
S. Ramayah,
T. H. Tang, and Z. F. Zainudin.
1999.
Molecular epidemiology of tuberculosis in Malaysia.
J. Clin. Microbiol.
37:1265-1268[Abstract/Free Full Text].
|
| 13.
|
Daley, C. L.,
P. M. Small,
G. F. Schecter,
K. Schoolnik,
R. A. McAdam,
W. R. Jacobs, and P. C. Hopewell.
1992.
An outbreak of tuberculosis with accelerated progression among persons infected with human immunodeficiency virus.
N. Engl. J. Med.
326:231-235[Abstract].
|
| 14.
|
Das, S.,
C. N. Paramasivan,
D. B. Lowrie,
R. Prabhakar, and P. R. Narayanan.
1995.
IS6110 restriction fragment length polymorphism typing of clinical isolates of Mycobacterium tuberculosis from patients with pulmonary tuberculosis in Madras, south India.
Tuberc. Lung Dis.
76:550-554[CrossRef][Medline].
|
| 15.
|
Dwyer, B.,
K. Jackson,
K. Raios,
A. Sievers,
E. Wilshire, and B. Ross.
1993.
DNA restriction fragment analysis to define an extended cluster of tuberculosis in homeless men and their associates.
J. Infect. Dis.
167:490-494[Medline].
|
| 16.
|
Fomukong, N. G.,
T. H. Tang,
S. Al-Maamary,
W. A. Ibrahim,
S. Ramayah,
M. Yates,
F. Zainuddin, and J. W. Dale.
1994.
Insertion typing of Mycobacterium tuberculosis: characterization of a widespread subtype with a single copy of IS6110.
Tuberc. Lung Dis.
75:435-440[CrossRef][Medline].
|
| 17.
|
Genewein, A.,
A. Telenti,
C. Bernasconi,
C. Mordasini,
S. Weiss,
A.-M. Maurer,
H. Rieder,
K. Schopfer, and T. Bodmer.
1993.
Molecular approach to identifying route of transmission of tuberculosis in the community.
Lancet
342:841-844[CrossRef][Medline].
|
| 18.
|
Gillespie, S. H.,
A. Dickens, and T. D. McHugh.
2000.
False molecular clusters due to nonrandom association of IS6110 with Mycobacterium tuberculosis.
J. Clin. Microbiol.
38:2081-2086[Abstract/Free Full Text].
|
| 19.
|
Global Tuberculosis Programme World Health Organisation (WHO) Geneva, and International Union Against Tuberculosis and Lung Disease (IUATLD) Paris.
1997.
Guidelines for surveillance of drug susceptibility resistance in tuberculosis.
Int. J. Tuberc. Lung Dis.
2:72-89.
|
| 20.
|
Helali, N. E., and P. Vergez.
1993.
Identification des mycobactéries.
Feuill. Biol.
190:5-18.
|
| 21.
|
Hermans, P. W. M.,
D. van Soolingen,
E. M. Bilk,
P. E. W. de Haas,
J. W. Dale, and J. D. A. van Embden.
1991.
Insertion element IS687 from Mycobacterium bovis is located in a hot-spot integration region for insertion elements in Mycobacterium tuberculosis complex strains.
Infect. Immun.
59:2695-2705[Abstract/Free Full Text].
|
| 22.
|
Hermans, P. W. M.,
F. Messadj,
H. Guebrexabher,
D. van Soolingen,
P. E. W. de Haas,
H. Heersam,
H. de Neeling,
A. Ayoub,
F. Portaels,
D. Frommel,
M. Zribi, and J. D. A. van Embden.
1995.
Analysis of the population structure of Mycobacterium tuberculosis in Ethiopia, Tunisia, and The Netherlands: usefulness of DNA typing for global tuberculosis epidemiology.
J. Infect. Dis.
171:1504-1513[Medline].
|
| 23.
|
Kamerbeek, J.,
L. Schouls,
A. Kolk,
M. van Agterveld,
D. van Soolingen,
S. Kuijper,
A. Bunschoten,
H. Molhuizen,
R. Shaw,
M. Goyal, and J. D. A. van Embden.
1997.
Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology.
J. Clin. Microbiol.
35:907-914[Abstract].
|
| 24.
|
Lemaître, N.,
W. Sougakoff,
C. Truffot-Pernot,
E. Cambeau,
J.-P. Derenne, and F. Bricaire.
1998.
Use of DNA fingerprinting for primary surveillance of nosocomial tuberculosis in a large urban hospital: detection of outbreaks in homeless people and migrant workers.
Int. J. Tuberc. Lung Dis.
2:390-396[Medline].
|
| 25.
|
Palittapongarnpim, P.,
P. Luangsook,
S. Tansuphaswadikul,
C. Chuchottaworn,
R. Prachaktam, and B. Sathapatayavongs.
1997.
Restriction fragment length polymorphism study of Mycobacterium tuberculosis in Thailand using IS6110 as probe.
Int. J. Tuberc. Lung Dis.
1:370-376[Medline].
|
| 26.
|
Rasolofo-Razanamparany, V.,
D. Ménard,
M. Ratsitorahina,
G. Aurégan,
B. Gicquel, and S. Chanteau.
2000.
Transmission of tuberculosis in the prison of Antananarivo, Madagascar.
Res. Microbiol.
151:785-795[Medline].
|
| 27.
|
Skuce, R. A.,
D. Brittain,
M. S. Hughes,
L.-A. Beck, and S. D. Neill.
1994.
Genomic fingerprinting of Mycobacterium bovis from cattle by restriction fragment length polymorphism analysis.
J. Clin. Microbiol.
32:2387-2392[Abstract/Free Full Text].
|
| 28.
|
Small, P. M.,
P. C. Hopewell,
S. P. Singh,
A. Paz,
J. Parsonnet,
D. C. Ruston,
G. F. Schecter,
C. L. Daley, and G. K. Schoolnik.
1994.
The epidemiology of tuberculosis in San Francisco. A population-based study using conventional and molecular methods.
N. Engl. J. Med.
330:1703-1709[Abstract/Free Full Text].
|
| 29.
|
Thierry, D.,
A. Brisson-Noël,
V. Vincent-Levy-Frebault,
S. Nguyen,
J.-L. Guesdon, and B. Gicquel.
1990.
Characterization of a Mycobacterium tuberculosis insertion sequence, IS6110, and its application in diagnosis.
J. Clin. Microbiol.
28:2668-2673[Abstract/Free Full Text].
|
| 30.
|
Torrea, G.,
G. Levée,
P. Grimont,
C. Martin,
S. Chanteau, and B. Gicquel.
1995.
Chromosomal DNA fingerprinting analysis using the insertion sequence IS6110 and the repetitive element DR as strain-specific markers for epidemiological study of tuberculosis in French Polynesia.
J. Clin. Microbiol.
33:1899-1904[Abstract].
|
| 31.
|
van Embden, J. D. A.,
M. D. Cave,
J. T. Crawford,
J. W. Dale,
K. D. Eisenach,
B. Gicquel,
P. W. M. Hermans,
C. Martin,
R. McAdam,
T. M. Shinnick, and P. M. Small.
1993.
Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology.
J. Clin. Microbiol.
31:406-409[Abstract/Free Full Text].
|
| 32.
|
van Rie, A.,
R. Waren,
M. Ricardson,
T. C. Victor,
R. P. Gie,
D. A. Enarson,
N. Beyers, and P. D. van Helden.
1999.
Exogenous reinfection as a cause of recurrent tuberculosis after curative treatment.
N. Engl. J. Med.
341:1174-1179[Abstract/Free Full Text].
|
| 33.
|
van Soolingen, D.,
L. Qian,
P. E. W. de Haas,
J. T. Douglas,
H. Traore,
F. Portaels,
H. Z. Qing,
D. Enkhsaikan,
P. Nymadawa, and J. D. A. van Embden.
1995.
Predominance of a single genotype of Mycobacterium tuberculosis in countries of east Asia.
J. Clin. Microbiol.
33:3234-3238[Abstract].
|
| 34.
|
van Soolingen, D.,
P. E. W. de Haas,
J. Haagsma,
T. Eger,
P. W. M. Hermans,
V. Ritacco,
A. Alito, and J. D. A. van Embden.
1994.
Use of various genetic markers in differentiation of Mycobacterium bovis strains from animals and humans and for studying epidemiology of bovine tuberculosis.
J. Clin. Microbiol.
32:2425-2433[Abstract/Free Full Text].
|
| 35.
|
van Soolingen, D.,
P. E. W. de Haas,
P. W. M. Hermans,
P. M. A. Groenen, and J. D. A. van Embden.
1993.
Comparison of various repetitive DNA elements as genetic markers for strain differentiation and epidemiology of Mycobacterium tuberculosis.
J. Clin. Microbiol.
31:1987-1995[Abstract/Free Full Text].
|
| 36.
|
van Soolingen, D.,
P. W. M. Hermans,
P. E. W. de Haas,
D. R. Soll, and J. D. A. van Embden.
1991.
Occurrence and stability of insertion sequences in Mycobacterium tuberculosis complex strains: evaluation of an insertion sequence-dependant DNA polymorphism as a tool in the epidemiology of tuberculosis.
J. Clin. Microbiol.
29:2578-2586[Abstract/Free Full Text].
|
| 37.
|
Yuen, L. K. W.,
B. C. Ross,
K. M. Jackson, and B. Dwyer.
1993.
Characterization of Mycobacterium tuberculosis strains from Vietnamese patients by Southern blot hybridization.
J. Clin. Microbiol.
31:1615-1618[Abstract/Free Full Text].
|
Journal of Clinical Microbiology, April 2001, p. 1530-1535, Vol. 39, No. 4
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.4.1530-1535.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Richardson, M., van der Spuy, G. D., Sampson, S. L., Beyers, N., van Helden, P. D., Warren, R. M.
(2004). Stability of Polymorphic GC-Rich Repeat Sequence-Containing Regions of Mycobacterium tuberculosis. J. Clin. Microbiol.
42: 1302-1304
[Abstract]
[Full Text]
-
Ruiz, M., Rodriguez, J. C., Rodriguez-Valera, F., Royo, G.
(2003). Amplified-Fragment Length Polymorphism as a Complement to IS6110-Based Restriction Fragment Length Polymorphism Analysis for Molecular Typing of Mycobacterium tuberculosis. J. Clin. Microbiol.
41: 4820-4822
[Abstract]
[Full Text]
-
Rasolofo Razanamparany, V., Menard, D., Auregan, G., Gicquel, B., Chanteau, S.
(2002). Extrapulmonary and Pulmonary Tuberculosis in Antananarivo (Madagascar): High Clustering Rate in Female Patients. J. Clin. Microbiol.
40: 3964-3969
[Abstract]
[Full Text]
-
Burgos, M.V., Pym, A.S.
(2002). Molecular epidemiology of tuberculosis. Eur Respir J
20: 54S-65s
[Abstract]
[Full Text]
Top
Abstract
Introduction
