Previous Article | Next Article 
Journal of Clinical Microbiology, July 2001, p. 2405-2411, Vol. 39, No. 7
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.7.2405-2411.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Genetic Diversity and Biochemical Characteristics of
Trichosporon asahii Isolated from Clinical Specimens,
Houses of Patients with Summer-Type-Hypersensitivity Pneumonitis, and
Environmental Materials
Takashi
Sugita,1,*
Tomoe
Ichikawa,1
Manami
Matsukura,1
Mika
Sueda,1
Masako
Takashima,2
Reiko
Ikeda,1
Akemi
Nishikawa,3 and
Takako
Shinoda1
Department of
Microbiology1 and Department of
Immunobiology,3 Meiji Pharmaceutical
University, Kiyose, Tokyo, and Japan Collection of
Microorganisms, RIKEN (The Institute of Physical and Chemical
Research), Wako, Saitama,2 Japan
Received 19 October 2000/Returned for modification 8 February
2001/Accepted 24 April 2001
 |
ABSTRACT |
Trichosporon asahii, which is distributed in the
environment, is the major causative agent of the opportunistic
infection trichosporonosis, and it also causes summer-type
hypersensitivity pneumonitis (SHP). Random amplification of polymorphic
DNA analysis was used to determine the intraspecies diversity of 39 T. asahii isolates from clinical specimens, SHP
patients' houses, and environmental materials. The three primers
used revealed 46 polymorphic bands. A phenogram was generated by
the unweighted pair-group method with arithmetic mean. Clinical
isolates formed a cluster, characterized by a 90% matching
coefficient, but they did not cluster with strains isolated from SHP
patients' houses or environmental sources. In addition, the
biochemical characteristics of 86 strains from three sources were
examined with 31 compounds using an ID32C kit, and a phenogram was
constructed. The phenogram consisted of three major clusters. Cluster I
included most of the clinical SHP isolates, and cluster II included
most of the environmental isolates. Cluster III contained only one
strain. A remarkable difference was found in the abilities of the
strains belonging to clusters I and II to utilize six compounds. These
results suggest that the genetic diversity and biochemical
characteristics of T. asahii seem to be related to the
source of the isolate. We also found a specific DNA fragment for the
clinical isolates and strains isolated from SHP patients' houses.
 |
INTRODUCTION |
The basidiomycetous anamorphic yeast
Trichosporon asahii Akagi ex Sugita et al. is the
major causative agent of fungemia due to
Trichosporon species in immunocompromised patients
(7, 8). This infection is associated with a high mortality
rate and a poor prognosis (20). Neutropenia due to
cytotoxic chemotherapy is the most common risk factor for deep-seated
trichosporonosis, and neutropenic patients are more likely to
have fungemia or disseminated infection than nonneutropenic patients.
T. asahii also causes summer-type hypersensitivity
pneumonitis (SHP) (1, 2). SHP follows the development of
type III or type IV allergies by repeated inhalation of
Trichosporon arthroconidia, which often contaminate home environments during the summer months. In western and southern Japan, the summer is hot, humid, and rainy. Such conditions favor the
growth of Trichosporon species, and most patients
initially experience symptoms during the summer. Although SHP is
considered peculiar to Japan, a case was recently reported in a
neighboring country (22). Trichosporon
is widely distributed throughout the environment, especially in soil.
We have previously reported that T. asahii is a common
environmental pathogen (19).
Many investigations of the intraspecies diversity and epidemiology of
Candida albicans and Cryptococcus neoformans
using random amplified polymorphic DNA (RAPD) analysis, hybridization
with specific probes such as Ca3, and multilocus enzyme electrophoresis (MLEE) have been reported (3-5, 12-15, 21). They include
studies examining the origins of nosocomial infection
(12), a generic comparison between bloodstream and
nonbloodstream isolates (5), a study of the hospital
specificity or regional specificity of the isolates (14),
and comparison of the genotypes and fluconazole susceptibilities of the
isolates (13, 21). In contrast, there are only a few
reports for Trichosporon species. Isoenzyme
profiles, restriction fragment length polymorphisms (RFLP) of ribosomal DNA (rDNA), and analysis of glucuronoxylomannan polysaccharide antigen
revealed that blood, superficial, and environmental isolates of
Trichosporon beigelii (synonymous with
Trichosporon cutaneum) were distinct from each other
(9, 10). However, T. beigelii is a
taxonomically highly heterogeneous species; at present, this species
has been reclassified into more than 10 species (6).
In this study, we examined the genetic diversity and biochemical
characteristics of T. asahii strains isolated from
various sources, including clinical specimens, SHP patients'
houses, and environmental materials.
 |
MATERIALS AND METHODS |
T. asahii isolates.
Of the 86 isolates
identified as T. asahii, 42 were derived from clinical
specimens (ascites, blood, feces, lung, pleural fluid, skin, and
urine). They were obtained from eight centers in Japan and the United
States. Seventeen were from the homes of 17 SHP patients, and 27 were
from soil (Table 1). They
were identified by PCR with T. asahii-specific primers or by
direct sequence analysis of internal transcribed spacer (ITS) regions of the rRNA gene (17, 18)
RAPD analysis.
Nuclear DNA was extracted by the method of
Makimura et al. (11). Eleven oligonucleotides (15,
21) were preliminarily investigated for reactivity and
reproducibility using T. asahii DNA: M13
(GAGGGTGGCGGTTCT), T3B (AGGTCGCGGGTTCGAATCC),
(GACA)4 (GACAGACAGACAGACA), TELO1
(TGGGTGTGTGGGTGTGTGGGTGTG), (CAG)4
(CAGCAGCAGCAG), OPE1 (CCCAAGGTCC), OPE2
(GGTGCGGGAA), OPE3 (CCAGATGCAC), OPE4 (GTGACATGCC), R28 (ATGGATCCGC), and RC8
(GGATGTCGAA). Three oligonucleotides, M13, OPE1, and RC8,
were selected as single primers for PCR fingerprinting of 39 representative isolates. The three PCRs were individually optimized,
and the reaction parameters for each primer were critical. Amplifications were performed in a total buffer volume of 50 µl containing 5 µl of 10× PCR buffer (100 mM Tris-HCl [pH 8.3], 500 mM KCl, 15 mM MgCl2; Nippon Gene, Toyama, Japan), 4 µl of
200 µM deoxynucleoside triphosphates (equimolar dNTPs; Nippon Gene), 30 pmol of each primer, and 2.5 U of Gene Taq DNA polymerase
(Nippon Gene). Gene Taq DNA polymerase was developed for
RAPD analysis. For primer M13, PCR was performed in a thermocycler
(model 9700; Perkin-Elmer Applied Biosystems, Foster City, Calif.) with
an initial denaturation at 94°C for 3 min, followed by 40 cycles of
20 s at 94°C, 60 s at 50°C, and 20 s at 72°C, and
a final extension at 72°C for 10 min. For primers OPE1 and RC8, PCR
was performed with an initial denaturation at 94°C for 3 min,
followed by 40 cycles consisting of 20 s at 94°C, 60 s at
36°C, and 20 s at 72°C, and a final cycle of 10 min at 72°C.
Amplification products were separated by 1.5% agarose gel
electrophoresis in 1× TAE (Tris-acetate EDTA) buffer. Electrophoretic
bands were sized automatically using Digital Science Image Analysis
Software (Eastman Kodak, Rochester, N.Y.). Each DNA fragment was scored
as present or absent. The intensities of the PCR fragments were not
measured. A phenogram showing the similarities of isolates was
generated by the unweighted pair group method with arithmetic mean
(UPGMA phenogram), based on the pairwise similarity coefficient matrix.
The PAUP program (version 4.0b2; Phylogenetic Analysis Using Parsimony;
David L. Swofford, Laboratory of Molecular Systematics, National Museum of Natural History, Smithsonian Institution) was used to calculate similarity values and to generate the UPGMA phenogram. A similarity value (SAB) was calculated for each pair of
patterns, based on matching fragment positions. Eighteen clinical
isolates from eight centers, 9 isolates from SHP patients' houses, and
12 environmental isolates were analyzed by RAPD analysis.
Origin-specific DNA sequences from RAPD fingerprinting.
Forty-six polymorphic bands were used to determine whether there was an
origin-specific DNA band. Although three origin-specific DNA bands were
not found, we observed a specific 330-bp band (see Fig. 1) for the
clinical isolates and the strains obtained from the homes of SHP
patients in RAPD fingerprinting using primer M13. The 330-bp DNA
fragment was extracted from an agarose gel using a NucleoSpin kit
(Clontech Laboratories Inc., Palo Alto, Calif.) according to the
manufacturer's instructions. The fragment was cloned into pCR-2.1
using a TA cloning kit (Invitrogen Corp., Carlsbad, Calif.) and was
sequenced with an ABI PRISM Cycle-Sequencing kit (Applied Biosystems).
From these DNA sequences, two oligonucleotide primers were designed:
M13-7F (TGCGCTCATGCGCTCATGAC) and M13-7R (TCCGCTGAGGAAGGAAGAGC). The PCR conditions were as follows:
initial denaturation at 94°C for 3 min, followed by 30 cycles of
20 s at 94°C, 60 s at 50°C, and 20 s at 72°C, and a
final cycle of 10 min at 72°C. For this PCR, Takara (Shiga, Japan) Ex
Taq polymerase was used. Table
2 shows the strains used for specificity
of PCR.
Biochemical characteristics.
The isolates were examined with
an ID32C kit (bioMérieux SA, Marcy I'Etoile, France) in
accordance with the manufacturer's instructions. A total of 42 clinical isolates, 17 SHP isolates, and 27 environmental isolates were
examined. The PAUP program was used to calculate similarity values and
to construct a UPGMA phenogram.
Nucleotide sequence accession number.
The sequences of
specific DNA fragments obtained by PCR of T. asahii clinical
isolates and strains isolated from SHP patients' houses have been
deposited in the DNA Data Bank of Japan under accession number
AB049759.
 |
RESULTS |
RAPD analysis.
The three primers produced 46 polymorphic
bands, as shown in Table 1. A representative photograph of the PCR
products for primer M13 is presented in Fig.
1. The similarities of the polymorphic bands within the clinical isolates, strains isolated from SHP patients' houses, and environmental isolates were 91.3, 74.5, and
72.0%, respectively (Table 3). Clinical
isolates were more similar to each other than to the strains of the two
other origins (P < 0.01). and they formed two clusters
(Fig. 2). Although the clinical isolates
were obtained from eight different Japanese and U.S. centers, there was
no relationship between the RAPD fingerprinting pattern and the source
hospital. Neither environmental isolates nor strains isolated from SHP
patients' houses formed a cluster (P > 0.1).

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 1.
Representative electrophoresis gel of PCR fingerprints
obtained from T. asahii isolates using primer M13. Mw,
molecular weight marker. A 330-bp DNA fragment (arrow) shows
specificity for the clinical isolates and strains isolated from SHP
patients' houses.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 2.
UPGMA phenogram of T. asahii isolates
calculated from DNA fingerprinting patterns obtained with primers M13,
OPE1, and RC8.
|
|
Origin-specific DNA fragment.
An origin-specific 330-bp DNA
fragment was obtained. Newly designed oligonucleotide primers amplified
all T. asahii clinical isolates. PCRs were positive for the
strains isolated from SHP patients' houses, with the exception of
strain SHP 1. DNA from environmental isolates, excluding strain E.I.3,
was amplified by PCR and was negative for all other
Trichosporon species and other medically relevant
yeasts (Table 2). A representative electrophoretic gel of the PCR
product is shown in Fig. 3. The sequences
obtained from specific DNA fragments have been deposited in the DNA
Data Bank of Japan (accession number AB049759).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
Representative electrophoretic gel of PCR products using
primers M13-7F and M13-7R. A 225-bp PCR product was amplified.
|
|
Biochemical characteristics determined by using the ID32 kit.
The biochemical characteristics of the isolates are listed as an API
profile in Table 1. The phenogram shown in Fig.
4 was generated using 31 characteristics
and consists of three major clusters: I, II, and III. Cluster I
includes most of the clinical and SHP strains (93%; 55 of 59), and
cluster II comprises most of the environmental isolates (85%; 23 of
27). Cluster III contains only one strain, C.I.28. The ability to
utilize 25 of 31 compounds was almost the same for strains belonging to
clusters I and II; however, remarkable differences were found in
the ability to utilize the other 6 compounds, as shown in Table
4.
 |
DISCUSSION |
Because T. asahii is responsible for both opportunistic
fungal infections and allergies and is also distributed in the
environment, it is interesting to examine the genetic diversity of
strains obtained from different sources. RAPD analysis suggested that the clinical isolates were distinct from isolates obtained from SHP
patients' houses and the environmental isolates. While the assimilation patterns of clinical isolates and strains obtained from
SHP patients' houses were similar, they were notably different from
those of environmental isolates. Comparison of Fig. 2 and 4 shows that
the figures are not entirely correlated with each other in the
phenogram. However, it is obvious that the clinical and
environmental isolates have distinct RAPD profiles and
biochemical characteristics. A similar finding was reported by Bertout
et al. (3), who found that C. neoformans isolates formed three clusters in an MLEE data
analysis. The first cluster contained clinical isolates, the second
included environmental isolates, and the third contained strains
isolated from either patients or the environment. In 1991, blood,
superficial, and environmental isolates of T. beigelii were
reported to be distinct, based on RFLP of rDNA and isoenzyme profiles
(9). Subsequently, T. beigelii has been divided
into more than 10 species, and some of the superficial and
environmental isolates have been reidentified as
Trichosporon aquatile, T. cutaneum, T. domesticum,
and T. ovoides according to current taxonomical
criteria (16; see also the American Type Culture
Collection [ATCC, Rockville, Md.] catalog at http://www.atcc.org/). In addition to the correlation between the genotype and the origin of a
strain, RAPD can be used to differentiate genotype and drug susceptibility. Xu et al. (21) showed that
fluconazole-resistant C. albicans strains isolated from
patients infected with human immunodeficiency virus formed a cluster
distinct from that of fluconazole-sensitive strains by RAPD. Strains
C.I.16, C.I.17, and C.I.18 were resistant to fluconazole (data not
shown). We have not yet determined the drug susceptibilities of
all T. asahii isolates, but they were in the same
subcluster. No correlation between the RAPD fingerprinting pattern and
the hospital was found for T. asahii isolates, whereas
for C. albicans, there is hospital, regional, and country
specificity among isolates. In this study, 11 oligonucleotides that had
been widely used for C. albicans and C. neoformans were tested against T. asahii DNA. Of these 11 oligonucleotides, PCR parameters could not be optimized for 8. The
development of a highly or specifically reactive oligonucleotide primer
would permit an intensive epidemiological study of disease due to
T. asahii.
In this study, we obtained DNA fragments specific for clinical isolates
and strains isolated from SHP patients' houses. We previously reported
species-specific DNA sequences derived from T. asahii by ITS
sequence analysis (17, 18). Since
Trichosporon species are phylogenetically closely
related, it is difficult to design species-specific primers. Our
T. asahii-specific primers designed from ITS-derived
sequences amplify DNA of T. faecale (Trichosporon asahii var. faecalis), and
T. coremiiforme (Trichosporon asahii var.
coremiiformis). The latter two species are nonpathogenic and
are not known to cause clinical problems. If new oligonucleotide primers are designed, it should be possible to detect T. asahii with high specificity. No similar sequence was found
in GenBank by a BLAST search (http://www.ncbi.nlm.nih.gov/BLAST/).
 |
ACKNOWLEDGMENTS |
This study was supported in part by a Grant for the Promotion of
the Advancement of Education and Research in Graduate Schools from the
Ministry of Education, Culture, Sports, Science, and Technology of Japan.
We thank the physicians who provided us with T. asahii isolates.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, Meiji Pharmaceutical University, 2-522-1 Noshio, Kiyose, Tokyo, 204-8588 Japan. Phone: 81-424-95-8762. Fax:
81-424-95-8762. E-mail: sugita{at}my-pharm.ac.jp.
 |
REFERENCES |
| 1.
|
Ando, M.,
T. Sakata,
K. Yoshida,
H. Yamasaki,
S. Araki,
K. Onoue, and T. Shinoda.
1990.
Serotype-related antigen of Trichosporon cutaneum in the induction of summer-type hypersensitivity pneumonitis: correlation between serotype of inhalation challenge-positive antigen and that of the isolates from patients' homes.
J. Allergy Clin. Immunol.
85:36-44[CrossRef][Medline].
|
| 2.
|
Ando, M.,
K. Arima,
R. Yoneda, and M. Tamura.
1991.
Japanese summer-type hypersensitivity pneumonitis: geographic distribution, home environment, and clinical characteristics of 621 cases.
Am. Rev. Respir. Dis.
144:765-769[Medline].
|
| 3.
|
Bertout, S.,
F. Renaud,
D. Swinne,
M. Mallie, and J. M. Bastide.
1999.
Genetic multilocus studies of different strains of Cryptococcus neoformans: taxonomy and genetic structure.
J. Clin. Microbiol.
37:715-720[Abstract/Free Full Text].
|
| 4.
|
Clemons, K. V.,
F. Feroze,
K. Holmberg, and D. A. Stevens.
1997.
Comparative analysis of genetic variability among Candida albicans isolates from different geographic locales by three genotypic methods.
J. Clin. Microbiol.
35:1332-1336[Abstract].
|
| 5.
|
Dalle, F.,
N. Franco,
J. Lopez,
O. Vagner,
D. Caillot,
P. Chavanet,
B. Cuisenier,
S. Aho,
S. Lizard, and A. Bonnin.
2000.
Comparative genotyping of Candida albicans bloodstream and nonbloodstream isolates at a polymorphic microsatellite locus.
J. Clin. Microbiol.
38:4554-4559[Abstract/Free Full Text].
|
| 6.
|
Guého, E.,
M. T. Smith,
G. S. de Hoog,
G. Billon-Grand,
R. Christen, and W. H. Batenburg-van der Vegte.
1992.
Contributions to a revision of the genus Trichosporon.
Antonie Leeuwenhoek
61:289-316.
|
| 7.
|
Guého, E.,
L. Improvisi,
G. S. de Hoog, and B. Dupont.
1994.
Trichosporon on humans: a practical account.
Mycoses
37:3-10[Medline].
|
| 8.
|
Herbrecht, R.,
H. Koening,
K. Waller,
L. Liu, and E. Guého.
1993.
Trichosporon infections: clinical manifestations and treatment.
J. Mycol. Med.
3:129-136.
|
| 9.
|
Kemker, B. J.,
P. F. Lehmann,
J. W. Lee, and T. J. Walsh.
1991.
Distinction of deep versus superficial clinical and nonclinical isolates of Trichosporon beigelii by isoenzymes and restriction fragment length polymorphisms of rDNA generated by polymerase chain reaction.
J. Clin. Microbiol.
29:1677-1683[Abstract/Free Full Text].
|
| 10.
|
Lyman, C. A.,
S. J. Devi,
J. Nathanson,
C. E. Frasch,
P. A. Pizzo, and T. J. Walsh.
1995.
Detection and quantitation of the glucuronoxylomannan-like polysaccharide antigen from clinical and nonclinical isolates of Trichosporon beigelii and implications for pathogenicity.
J. Clin. Microbiol.
33:126-130[Abstract].
|
| 11.
|
Makimura, K.,
Y. S. Murayama, and H. Yamaguchi.
1994.
Detection of a wide range of medically important fungal species by polymerase chain reaction (PCR).
J. Med. Microbiol.
40:358-364[Abstract].
|
| 12.
|
Marco, F.,
S. R. Lockhart,
M. A. Pfaller,
C. Pujol,
M. S. Rangel-Frausto,
T. Wiblin,
H. M. Blumberg,
J. E. Edwards,
W. Jarvis,
L. Saiman,
J. E. Patterson,
M. G. Rinaldi,
R. P. Wenzel, and D. R. Soll.
1999.
Elucidating the origins of nosocomial infections with Candida albicans by DNA fingerprinting with the complex probe Ca3.
J. Clin. Microbiol.
37:2817-2828[Abstract/Free Full Text].
|
| 13.
|
Pfaller, M. A.,
R. N. Jones,
G. V. Doern,
H. S. Sader,
R. J. Hollis, and S. A. Messer.
1998.
International surveillance of bloodstream infections due to Candida species: frequency of occurrence and antifungal susceptibilities of isolates collected in 1997 in the United States, Canada, and South America for the SENTRY Program. The SENTRY Participant Group.
J. Clin. Microbiol.
36:1886-1889[Abstract/Free Full Text].
|
| 14.
|
Pfaller, M. A.,
S. R. Lockhart,
C. Pujol,
J. A. Swails-Wenger,
S. A. Messer,
M. B. Edmond,
R. N. Jones,
R. P. Wenzel, and D. R. Soll.
1998.
Hospital specificity, region specificity, and fluconazole resistance of Candida albicans bloodstream isolates.
J. Clin. Microbiol.
36:1518-1529[Abstract/Free Full Text].
|
| 15.
|
Pujol, C.,
S. Joly,
S. R. Lockhart,
S. Noel,
M. Tibayrenc, and D. R. Soll.
1997.
Parity among the randomly amplified polymorphic DNA method, multilocus enzyme electrophoresis, and Southern blot hybridization with the moderately repetitive DNA probe Ca3 for fingerprinting Candida albicans.
J. Clin. Microbiol.
35:2348-2358[Abstract].
|
| 16.
|
Sugita, T.,
A. Nishikawa,
T. Shinoda, and H. Kume.
1995.
Taxonomic position of deep-seated, mucosa-associated, and superficial isolates of Trichosporon cutaneum from trichosporonosis patients.
J. Clin. Microbiol.
33:1368-1370[Abstract].
|
| 17.
|
Sugita, T.,
A. Nishikawa, and T. Shinoda.
1998.
Identification of Trichosporon asahii by PCR based on sequences of the internal transcribed spacer regions.
J. Clin. Microbiol.
36:2742-2744[Abstract/Free Full Text].
|
| 18.
|
Sugita, T.,
A. Nishikawa,
R. Ikeda, and T. Shinoda.
1999.
Identification of medically relevant Trichosporon species based on sequences of internal transcribed spacer regions and construction of a database for Trichosporon identification.
J. Clin. Microbiol.
37:1985-1993[Abstract/Free Full Text].
|
| 19.
|
Sugita, T.,
A. Nishikawa,
T. Ichikawa,
R. Ikeda, and T. Shinoda.
2000.
Isolation of Trichosporon asahii from environmental materials.
Med. Mycol.
38:27-30[Medline].
|
| 20.
|
Tashiro, T.,
H. Nagai,
P. Kamberi,
Y. Goto,
H. Kikuchi,
M. Nasu, and S. Akizuki.
1994.
Disseminated Trichosporon beigelii infection in patients with malignant diseases: immunohistochemical study and review.
Eur. J. Clin. Microbiol. Infect. Dis.
13:218-224[CrossRef][Medline].
|
| 21.
|
Xu, J.,
A. R. Ramos,
R. Vilgalys, and T. G. Mitchell.
2000.
Clonal and spontaneous origins of fluconazole resistance in Candida albicans.
J. Clin. Microbiol.
38:1214-1220[Abstract/Free Full Text].
|
| 22.
|
Yoo, C. G.,
Y. W. Kim,
S. K. Han,
K. Nakagawa,
M. Suga,
Y. Nishiura,
M. Ando, and Y. S. Shim.
1997.
Summer-type hypersensitivity pneumonitis outside Japan: a case report and the state of the art.
Respirology
2:75-77[Medline].
|
Journal of Clinical Microbiology, July 2001, p. 2405-2411, Vol. 39, No. 7
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.7.2405-2411.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ahmad, S., Al-Mahmeed, M., Khan, Z. U
(2005). Characterization of Trichosporon species isolated from clinical specimens in Kuwait. J Med Microbiol
54: 639-646
[Abstract]
[Full Text]