Previous Article | Next Article 
Journal of Clinical Microbiology, July 2001, p. 2466-2476, Vol. 39, No. 7
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.7.2466-2476.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Serodiagnosis of Human Granulocytic Ehrlichiosis by Using
Novel Combinations of Immunoreactive Recombinant Proteins
Michael J.
Lodes,1,*
Raodoh
Mohamath,1
Lisa D.
Reynolds,1
Patricia
McNeill,1
Christopher P.
Kolbert,2
Elizabeth S.
Bruinsma,2
Darin R.
Benson,1
Eric
Hofmeister,2
Steven G.
Reed,1,3,4
Raymond L.
Houghton,1 and
David H.
Persing1,3,*
Corixa Corporation1
and Infectious Disease Research
Institute,3 Seattle, Washington 98104;
University of Washington, Department of
Pathobiology, Seattle, Washington 981954; and
Department of Laboratory Medicine and Pathology, Mayo
Foundation, Rochester, Minnesota 559052
Received 31 October 2000/Returned for modification 28 January
2001/Accepted 8 April 2001
 |
ABSTRACT |
A panel of seven recombinant antigens, derived from
Ehrlichia phagocytophila (the agent of human
granulocytic ehrlichiosis), was evaluated by class-specific
enzyme-linked immunosorbent assays (ELISAs) for utility in the
diagnosis of the infection. Fourteen genomic fragments, obtained by
serologic expression screening, contained open reading frames (ORFs)
encoding 16 immunodominant antigens. Eleven of these antigens were
members of the major surface protein (MSP) multigene family.
Alignment of their predicted protein sequences revealed a pattern of
conserved sequences, which contained short direct repeats, flanking a
variable region. In addition, two genomic clones contained two and
three MSP ORFs, respectively, indicating that these genes are clustered
in tandem copies. The implications for this pattern of both genomic and
protein arrangements in antigenic variations of MSPs and in their
utilities in a diagnostic assay are discussed. In addition to two MSP
recombinant antigens (rHGE-1 and -3) and a fusion protein of these
antigens (rErf-1), five further recombinants were evaluated by ELISA.
Two of these antigens (rHGE-14 and -15) were novel, while a third
(rHGE-2), with no known function, has been described. The final two
recombinant antigens (rHGE-9 and -17) represent overlapping segments of
the ankyrin gene (ank). The addition of rHGE-9 ELISA data
resulted in the detection of 78% (21 of 27) of acute-phase
sera. When serologic data for all recombinants are combined,
96.2% (26 of 27) of convalescent-phase patient serum samples and
85.2% (23 of 27) of acute-phase patient serum samples are detected,
indicating the potential of these antigens for use in the development
of a rapid serologic assay for the detection of E.
phagocytophila infection.
 |
INTRODUCTION |
Ehrlichia species have
become recognized as major tick-borne pathogens of humans in both the
United States and Europe (2, 12, 14). Human granulocytic
ehrlichiosis (HGE) was first described in the United States in 1994 in
patients from Minnesota and Wisconsin (2, 3, 7) and
differed from infections due to the previously described
Ehrlichia chaffeensis (human monocytic ehrlichiosis [HME]) in infecting only granulocytic hematopoietic cells. HGE appears to result from the attachment of infected tick vectors including the deer tick (Ixodes scapularis [also called
Ixodes dammini]), while HME has been associated with the
Amblyomma americanum tick (3, 15, 33, 34, 38).
Increases in the prevalence of ehrlichiosis cases over time can be
attributed to awareness of these pathogens by health care practitioners
and to better diagnostic tools. However, human ehrlichiosis might also
be occurring more frequently because of the steady encroachment of
susceptible humans and pets into habitats occupied by the infected tick
vectors (35). Recently, a study conducted in Sweden
revealed that 11.4% of 185 individuals tested were seropositive for
HGE, while 1.1% were positive for HME (13).
Because these organisms can cause fever or even fatal disease if they
are not detected early, the development of rapid, sensitive, and
specific diagnostic assays is needed for timely and efficacious therapy
(4, 11, 13, 18, 23, 35). However, diagnostic tests for
both HGE and HME are labor-intensive, expensive, and time-consuming. Tests include, roughly in order of their
availability, examination of peripheral blood smears, serology, PCR,
and isolation and culture of the organism (39). Serologic
diagnosis of E. chaffeensis infection by using the
Ehrlichia canis organism was standard until E. chaffeensis was isolated and cultured and it was determined that
E. canis-containing material lacked optimal sensitivity. The
use of whole organisms for diagnosis lacks specificity, and thus,
confirmation depends upon protein immunoblotting, which is
time-consuming and expensive (11). Antibodies from the
serum of patients infected with the agent of HGE (referred to here as Ehrlichia phagocytophila) do not react with E. chaffeensis proteins but do react with proteins of approximately
44 kDa from either Ehrlichia equi or E. phagocytophila by Western blot analysis (10, 35).
However, tests with these antigens or antigens from different strains
of E. phagocytophila derived from either horses or cultured HL-60 cells give variable results, possibly due to the expression of
variant forms of the immunodominant proteins (1, 21).
Diagnosis of HGE is further complicated by the potential coinfection of
patients with the tick-borne pathogens of human babesiosis and Lyme
borreliosis (25, 27). These tick-borne diseases share many
of the same symptoms, making it difficult to differentiate between the
infections in their early stages (5). Serologic cross-reactivity among members of the genus Ehrlichia is
well known, and over one-third of patients with HME have concurrent diagnostic titers of antibodies to agents of other infections including
Rocky Mountain spotted fever, murine typhus, Q fever, Lyme disease,
babesiosis, and brucellosis (9, 40). Also complicating diagnosis is the possibility for false-positive Lyme disease serology in patients with HGE by using enzyme-linked immunosorbent assay (ELISA)
or immunoblot assays (40). False-positive antibody assays for Lyme disease are also documented to occur in patients with a
variety of other infections and autoimmune diseases (25). All of these complications can affect the accuracy of the overall diagnosis, particularly in the early stages of disease, when the appropriate therapeutic regimen needs to be determined. The use of a
recombinant protein-based ELISA with E. phagocytophila major outer membrane proteins shows potential for
use in the development of a rapid serodiagnostic test (21,
37). A rapid test with high degrees of sensitivity and
specificity, however, ultimately may depend on the use of multiple
recombinant proteins or a fusion protein consisting of several proteins
or epitopes (19). In this report we describe a
comprehensive effort to identify diagnostically relevant proteins of a
human isolate of E. phagocytophila, along with initial
efforts to characterize the serologic response to these proteins.
 |
MATERIALS AND METHODS |
Culture and isolation of E. phagocytophila genomic
DNA.
A strain of E. phagocytophila (isolate WI 1),
isolated from a west-central Wisconsin (Spooner, Wis., area) patient
with clinical and laboratory-confirmed HGE, was grown in and purified
from human promyelocytic leukemia cell line HL-60 (ATCC CCL 240) by a
previously described protocol (17, 24). Genomic DNA was
isolated from a fifth-passage culture with an IsoQuick Nucleic Acid
Extraction kit (Orca Research Inc., Bothell, Wash.).
Genomic expression library construction.
Twenty micrograms
of E. phagocytophila genomic DNA was resuspended in 400 µl
of TE (Tris-EDTA) buffer and sonicated for 5 s at 50% continuous
power with a Labsonic sonicator (B. Braun Biotech, Inc., Allentown,
Pa.) to generate fragments of approximately 0.5 to 5.0 kbp. DNA
fragments were blunted with T4 DNA polymerase (Gibco BRL) and ligated
to EcoRI adapters (Stratagene) with T4 ligase (Stratagene).
The adapted inserts were then phosphorylated with T4 polynucleotide
kinase (Stratagene) and size selected with a Sephacryl S-400-HR column
(Sigma). Approximately 0.25 µg of insert was ligated to a 1.0-µg
Lambda ZAP II, EcoRI/calf intestinal alkaline
phosphatase-treated vector (Stratagene), and the ligation mixture was packaged with Gigapack II Gold packaging extract
(Stratagene) following the manufacturer's instructions.
Expression screening.
Immunoreactive proteins were screened
from approximately 4 × 105 PFU. Twenty
150-mm petri dishes were plated with approximately 2 × 104 PFU and incubated at 42°C until plaques
formed. Nitrocellulose filters (Schleicher & Schuell, Keene, N.H.)
prewetted with 10 mM isopropyl-
-D-thiogalactopyranoside
(IPTG) were placed on the plates, and the plates were then incubated
overnight at 37°C. The filters were then washed three times with
phosphate-buffered saline (PBS) containing 0.1% Tween 20 (PBST;
Sigma), blocked with 1.0% bovine serum albumin (Sigma) in PBST, and
washed three times with PBST. The filters were next incubated overnight
with Escherichia coli-adsorbed, E. phagocytophila-infected BALB/c mouse serum (24), washed three times with PBST, and incubated with a goat anti-mouse immunoglobulin G (IgG; heavy and light chains), alkaline
phosphatase-conjugated secondary antibody (diluted 1:1,000 with PBST)
for 1 h. The filters were finally washed three times with PBST and
two times with alkaline phosphatase buffer (pH 9.5) and developed with
nitroblue tetrazolium-5-bromo-4-chloro-3-indolylphosphate (Gibco BRL).
Reactive plaques were then excised, and a second or a third plaque
purification was performed. Excision of phagemid followed the
Stratagene Lambda ZAP II protocol, and the resulting plasmid DNA was
sequenced with an automated sequencer (Perkin-Elmer ABI PRISM
377; Applied Biosystems, Inc.) with M13 forward, reverse, and internal
DNA sequencing primers. Initial nucleic acid and protein homology
searches were performed with DNA Star (Madison, Wis.) against
the EMBL and GenBank (release 99) and the Swiss, Protein Information
Resource (PIR), and Translated (release 97) databases. Protein
analysis was performed with the PSORT program (National Institute for
Basic Biology, Okazaki, Japan) and with the IDENTIFY program of EMOTIF
(Department of Biochemistry, Stanford University). Sequence
alignments were produced with the Megalign program (Clustal) of DNA Star.
Expression and purification of recombinant protein.
Expression of recombinant E. phagocytophila proteins
(HGE-2, HGE-3, HGE-9, full-length HGE-14 [HGE-14fl] and the
carboxy terminus of HGE-14 [HGE-14c], HGE-15, and HGE-17) was
accomplished by amplifying the cloned plasmid inserts with
Pfu polymerase (Stratagene) and the primers HGE-2 HIS
(CAATTACATATGCATCACCATCACCATCACTATGGTATAGATATAGAGCTAA GTG)
and HGE-2 TERM (CGAGAAAGAATTCCTAATAACTTAGAACATC), HGE-3 HIS
(CAATTACATATGCATCACCATCACCATCACTTCTATATTGGTTTGGATTACAGTCCAG) and HGE-3 TERM
(CTACGGGATCCGGTATTCAGAGTTAAAGATGG), HGE-9 HIS
(CAATTAGCTAGCCATCACCATCACCATCACAAAGGGGCTCCAGCAACGCAG) and HGE-9 TERM
(ACTACGGAATTCTAACGAGTAGCTGGAACCTGAGG), HGE-14fl HIS
(CAAT TAGC TAGCCATCACCATCACCATCAC TC TGCGGAATATAAAGAAACTG) and HGE-14 TERM (ACTACGAATTCCAAGATCATGCTCTTCGCG),
HGE-14c HIS (pGACAAGAAATACGGAAGATATTTCAATGC), HGE-15 HIS
(CAATTACATATGCATCACCATCACCATCACAAGTTGTCTAATTCTGGCAACGGAC) and HGE-15 TERM
(ACTATTGGATCCTAAATGTATACAGTCTCAGATTC), and HGE-17
HIS
(CAATTACATATGCATCACCATCACCATCACAACATTGCAGATAAAGTGTATGGC) and HGE-17 TERM
(GAGATAGAATTCTTACTTATATAGCTTACCGTC). Primers contained restriction sites for cloning (boldface) and a 6-histidine tag (italic) for protein purification (amino terminus). The
amplification product was digested with the restriction enzymes
NdeI or NheI and BamHI or
EcoRI, depending on the primer set used, isolated by gel
electrophoresis, and ligated to a pET17b plasmid vector (Novagen) previously cut with NdeI or NheI and
BamHI or EcoRI and dephosphorylated. HGE-14c was
cloned as a blunt-EcoRI fragment into a pET28 plasmid
vector (Novagen), modified to include an amino-terminal 6-histidine
tag. The ligation mixture was transformed into XL1-Blue competent cells
(Stratagene), and plasmid DNA was prepared for sequencing (Qiagen).
Recombinant protein was expressed by transforming plasmid DNA into BL21
pLysS competent cells (Novagen) and inducing a single-colony cell
culture with 2 mM IPTG (Sigma). Recombinant protein was recovered from
cell lysate with Ni-nitrilotriacetic acid agarose beads
(Qiagen), following the manufacturer's instructions, and dialyzed in
10 mM Tris (pH 9.0). Recombinant proteins were quality checked for
purity by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE), followed by staining with Coomassie blue stain and
N-terminal protein sequencing (26), and were quantified by
a Micro bicinchoninic acid assay (Pierce, Rockford, Ill.).
Recombinants were assayed for endotoxin contamination by the
Limulus assay (Bio Whittaker, Walkersville, Md.).
Recombinant HGE-1 protein was expressed in XL1-Blue cells
(Stratagene) as a lacZ fusion protein and then isolated by
gel electrophoresis with a Whole Gel Eluter (Bio-Rad). A fusion
construct composed of the HGE-1- and HGE-3-coding sequences was
constructed by amplifying the HGE-1 sequence with primers PDM-208
(GAGCTTGAGATTGGTTACGAGCGCTTC) and PDM-265
(CAATTACTCGAGAATTCATTAAAAAGCGAGCC) and the HGE-3 sequence with primers PDM-263
(CTACATCACGTGTTCTATATTGGTTTGGATTAC) and PDM-264
(GGTTAACTCGAGTACTAAGATGGTTTGTGTAATG) (restriction sites for cloning are indicated in boldface). The HGE-3 product was digested with the restriction enzymes Eco72I and
XhoI and cloned into a pET28 plasmid vector (Novagen)
modified to include an amino-terminal 6-histidine tag (pPDM). The HGE-1
product was then cloned into the ScaI site in the
HGE-3-pPDM construct and then screened for correct orientation.
Study population.
The 43 serum samples from HGE patients
used in the present study were positive by IgG-based immunofluorescence
assay (IFA; ICN Pharmaceuticals, Inc., Costa Mesa, Calif.) and
clinical history at the Mayo Clinic, and the results were verified by
IFA at the Centers for Disease Control and Prevention with cultured
E. equi and E. chaffeensis IFA substrates. Eleven
of these patients provided both acute-phase and convalescent-phase
serum samples, giving a total of 54 serum samples: 27 acute-phase serum
samples and 27 convalescent-phase serum samples. Acute-phase patients
were defined as infected individuals at 1 to 10 days after the onset of
symptoms, and convalescent-phase patients were defined as those at 11 days to several weeks or months after the onset of symptoms. Random
donor serum samples, used for development of cutoff values and for
assay specificity, were purchased from Boston Biomedica (West
Bridgewater, Mass.).
ELISA.
Each well of 96-well microtiter plates (Costar;
Corning, Cambridge, Mass.) was coated overnight at 4°C with 200 ng of
the recombinant proteins HGE-1, -2, -3, -9, -14c, -15, and -17 and Erf-1. The plates were then aspirated and blocked with PBS containing 1% (wt/vol) bovine serum albumin (BSA) for 2 h at room
temperature. This was followed by washing in PBST. Serum diluted
(1/100) in PBS containing 0.1% BSA was added to the wells, and the
plates were incubated for 30 min at room temperature, followed by
washing of the plates six times with PBST and then incubation with
protein A-horseradish peroxidase conjugate (1/20,000 dilution; Sigma
Chemical Co., St. Louis, Mo.) for 30 min. The plates were then washed
six times in PBST and then incubated with tetramethylbenzidine
substrate (Kirkegaard & Perry Laboratories, Gaithersburg, Md.) for 15 min. The reaction was stopped by the addition of 1 N sulfuric acid, and
the plates were read at 450 nm with an ELISA plate reader (EL311;
Biotek Instruments, Hyland Park, Va.). The cutoff for the assays was
determined from the mean for the negative population plus 3 standard
deviations of the mean.
Western blot analysis.
Recombinant antigens (200 ng/lane)
were subjected to SDS-PAGE analysis with 15% polyacrylamide minigels.
The antigens were transferred to nitrocellulose BA-85 (Schleicher & Schuell) and blocked for 1 h at room temperature with PBS
containing 1% Tween 20. The blots were then washed three times for 10 min each time in PBST-0.5 M sodium chloride (wash buffer). Next, the
blots were probed for 1 h at room temperature with serum diluted
1:500 in wash buffer, followed by three washes (10 min each time) in
wash buffer. The blots were then incubated for 45 min at room
temperature with protein A-horseradish peroxidase diluted 1:20,000 in
wash buffer and again washed three times for 10 min each time in wash buffer. Finally, the blots were incubated in chemiluminescent substrate
(ECL; Amersham Plc, Little Charlton, United Kingdom) for ~1 min and
were then exposed to X-ray film (XAR5) for 10 to 60 s, as required.
Nucleotide sequence accession numbers.
The GenBank
accession numbers for clones hge-1, -2,
-3, -14, -15, and -17 are
AF356507, AF356508, AF356509, AF356510, AF356511, and AF356512, respectively.
 |
RESULTS |
Expression cloning and molecular characterization of E.
phagocytophila antigens.
Serologic expression screening
resulted in the cloning of 14 genomic DNA fragments containing
predicted protein coding regions. Eight clones, hge-1,
-3, -6, -7, -8,
-12, -23, and -24, contained open
reading frames (ORFs) encoding 11 members of the major surface protein
(MSP) gene family (hge-7, two copies; hge-23,
three copies). The predicted protein sequence for clone
hge-3 (HGE-3) showed 98% identity over 323 amino acid
residues (aa) with the sequence for GenBank entry MSP-2C (accession
number AF029323), while the predicted protein sequences for the other
10 ORFs showed lower degrees of homology due to a variable region
within the ORFs. Alignment of the predicted protein sequences for the
11 ORFs showed high degrees of homology at the amino and carboxy
regions with central and carboxy-terminal variable regions (Fig.
1). Amino-terminal variations were due
primarily to truncations in ORFs that produced MSP copies with no
obvious initiation codons (i.e., pseudogenes). Two clones contained
multiple copies of the MSP-like genes: hge-7 contained two
copies (HGE-7.1 and -7.2) and hge-23 contained three copies
(HGE-23.1, -23.2, and -23.3) aligned in tandem (Fig.
2). One ORF, HGE-23.2, contained a
predicted full-length protein, while other ORFs were truncated at the
amino terminus (HGE-1, -3, -7.1, and -23.1) or the carboxy terminus
(HGE-8, -7.2, and -23.3), or both termini (HGE-6, -12, and -24).
Predicted ATG initiation sites were obvious only for ORFs HGE-7.2 and
HGE-8. ORFs containing amino termini that did not have initiation sites
included HGE-23.2 and -23.3. Variable regions, contained in each ORF,
were flanked by direct repeats (4 aa, 12 nucleotides [nt])
approximately 49 aa upstream and 25 aa downstream (LLAK). A second set
of direct repeats occurred approximately 28 aa upstream and 26 aa
downstream of the variable region (LAKT), with the two downstream
repeats overlapping (LLAKT; arrows and arrowheads, Fig. 1 and 2,
respectively). Direct repeats for each MSP copy (Table
1) show approximately 83% conservation
of the consensus nucleotide sequence over 12 nt and 100%
conservation of the consensus nucleotide sequence over 10 nt.
Conservation of these repeats may have relevance to antigenic variation
of these molecules (see below).

View larger version (88K):
[in this window]
[in a new window]
|
FIG. 1.
Alignment of partial ORFs representing the variable
regions and flanking conserved regions of 10 MSP antigens. The protein
sequence, if available, extends from an upstream direct repeat (LLAK;
arrow) to a downstream direct repeat (LLAKT; arrows). A second upstream
direct repeat (LAKT) is also indicated by an arrow. Identity (in amino
acid residues) is indicated by a black background, and conserved
residues are indicated by shading. Gaps in sequences are indicated by
dashes. The amino acid residue number is indicated on the left side,
and the sequence identity is indicated on the right side.
Sequence identity includes the MSP clone number (HGE-N)
and MSP copy number (vN), as shown in Fig. 2.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
Diagram of the orientation of MSP ORFs in two genomic
clones, hge-7 and hge-23. The locations
of variable regions (VAR) are indicated by shaded boxes, and
the locations of direct repeats are indicated by arrowheads. A
potential initiation start codon is indicated by an M. The scale for
the sizes of the clones (in base pairs) is indicated below.
|
|
Clone
hge-2 codes for a polypeptide of 578 aa predicted to
be 61.4 kDa. Searches of the GenBank protein database resulted
in a
99% identity of the sequence with that of an
E. phagocytophila 100-kDa antigen (
36), a protein of
unknown function (GenBank
accession number
AF020523). The predicted
protein sequence
for HGE-2 contained three degenerate repeats of 124 aa
and an
additional repeat of 12 aa (VS VEADAGMQQE) found within two of
the three repeats of 124 aa. The HGE-2 sequence contained no predicted
signal or transmembrane regions, and the cellular location was
predicted to be
cytoplasmic.
Clones
hge-9 and
hge-17 code for overlapping
segments of the
E. phagocytophila ankyrin gene
(
36). The predicted protein
sequence for both clones is
identical to a product of 1,231 aa
from a Wisconsin isolate deposited
in the GenBank database (GenBank
accession number
AAF42730). The HGE-17
protein sequence
aligns with aa 178 to 1231 of the Wisconsin isolate,
while HGE-9
aligns with aa 735 to 1110 of this sequence, suggesting
that the
antigenic region of this protein lies within the shared
sequence.
Clone
hge-14 (3,735 bp) encodes a predicted 81.1-kDa
polypeptide of 752 aa to which no sequences in the GenBank database are
identical. Protein analysis indicates that the polypeptide contains
no
leader sequence but does contain one or two transmembrane domains
(the
second one has a lower probability score) and is predicted
to be a type
II membrane protein. The carboxy half of the polypeptide
sequence
contains four conserved repeats of 41 aa that are followed
by two
similar truncated repeats of 7 and 14 aa (Fig.
3). Additional
degenerate repeats are
seen within the sequence before and after
the repeats of 41 aa.

View larger version (89K):
[in this window]
[in a new window]
|
FIG. 3.
Sequence of the HGE-14 protein gene. The nucleotide
sequence number is shown on the right, and two potential ATG initiation
codons are shown in italics and underlined. The predicted amino acid
sequence is translated beneath the nucleotide sequence, and the amino
terminus of the recombinant protein (HGE-14c) is indicated by an
arrowhead. Potential transmembrane stretches are indicated by double
underlining, and four repeats of 41 aa are italicized and indicated by
arrowheads. Two truncated repeats that follow the four repeats of 41 aa
are also indicated by arrowheads. Additional degenerate repeats are
indicated by a dashed underline.
|
|
Clones
hge-15 (2,322 bp) and
hge-25 (5,521 bp)
encode overlapping segments of a predicted 66.1-kDa (HGE-15)
polypeptide with
no identical sequences in the GenBank database. Both
ORFs are
truncated at the carboxy terminus, with HGE-15 having 590 aa and
HGE-25 having 530 aa. Protein analysis indicates a
potential cleavable
(first ATG codon) or uncleavable (second ATG codon)
amino-terminal
signal sequence (Fig.
4).
A search of the sequences in the GenBank
protein database showed
similarity with
Vibrio cholerae (23% identity
and 41%
similarity over 530 aa; GenBank accession number
AAF95066),
Haemophilus influenzae (21% identity and 45% similarity
over 357
aa; GenBank accession number
P44092), and
Rhodabacter
sphaeroides (22% identity and 39% similarity over 560 aa
[YbaU]; GenBank accession
number
AAD09115) peptidyl-prolyl
cis-
trans isomerase D
(PpiD). In
E. coli, this protein is anchored to the inner membrane,
facing the
periplasm, and is required for the proper folding of
outer membrane
proteins (
8). Consistent with this potential
PpiD
homology, motif searches indicate putative chaperonin signatures
(chaperonin 10 and chaperonin T-complex polypeptide 1) and two
potential peptidyl-prolyl isomerase C peptidyl-prolyl isomerase
(PPIase) signatures (Fig.
4).

View larger version (77K):
[in this window]
[in a new window]
|
FIG. 4.
Sequence of the HGE-15 protein gene. The nucleotide
sequence number is shown on the right. Two potential ATG initiation
codons are shown in italics and underlined, and potential
ribosome-binding sites are underlined. The predicted amino acid
sequence is translated beneath the nucleotide sequence, and potential
transmembrane stretches are underlined. The amino terminus of the
recombinant protein (rHGE-15) is indicated by an arrowhead. Putative
chaperonin signatures (chaperonin 10 and chaperonin TCP-1,
respectively) are shown in italics and underlined. Potential PPIC
PPIase signatures are shown in italics and are underlined with a dashed
line.
|
|
Recombinant protein expression and purification.
Seven clones
were chosen for recombinant protein expression in E. coli
(proteins HGE-1, -2, -3, -9, -14, -15, and -17). These expression
constructs were engineered to include an N-terminal 6-histidine tag for
ease of purification with an Ni-nitrilotriacetic acid agarose column.
Recombinant expression constructs contained specific E. phagocytophila DNA inserts of 972, 1,731, 969, 1,128, 2,193, 1,049, 1,632, and 1,326 nt that coded for predicted proteins of 34.9 (38.9 as a LacZ fusion), 61.3, 34.5, 39.8, 78.8, 36.3, 61.0, and 46.7 kDa, respectively, for HGE-1, -2, -3, -9, -14fl, -14c, -15, and -17, respectively. Recombinant proteins HGE-2 and HGE-3 correspond to aa 2 to 578 and 42 to 364 of a 100-kDa protein (GenBank accession
number AF020523 [36]) and MSP-2C (GenBank accession
number AF029323 [28]), respectively. Recombinant HGE-1
is missing 119 aa of the amino-terminal conserved sequence found in
MSP-2C. Recombinants HGE-9 and -17 represent two overlapping (overlap
of 28 aa) segments of the E. phagocytophila ankyrin-like protein (GenBank accession numbers AF047897 and AF020521). Recombinant
HGE-17 (rHGE-17) comprises amino acid residues 322 to 763, while rHGE-9 covers residues 735 to 1111 of the ankyrin-like protein of
1,232 aa. Recombinant HGE-14fl includes aa 22 to 752, and HGE-14c
includes aa 410 to 752 of the full-length protein sequence (Fig. 3).
Recombinant HGE-15 comprises aa 32 to 575 of the sequence shown in Fig.
4. HGE-1 and -3, two distinct members of the MSP gene family, were also
engineered as a fusion polypeptide (Erf-1). This expression construct
contained a sequence of 1,950 nt that coded for a predicted 69.7-kDa
polypeptide with an additional 6-histidine tag at the amino terminus.
All recombinant proteins were tested for purity by N-terminal
sequencing and Coomassie blue staining and were determined to be over
90% pure.
Western blot analysis.
Western blot analysis was used to
assess the expression levels and qualities of the recombinant proteins
and to monitor recombinant protein purification. Most recombinants
migrated in an SDS-polyacrylamide gel to positions of the predicted
size. However, some recombinants, such as HGE-14c, migrated to
positions of a higher relative molecular size, possibly due to a high
proline content (13.4%). rHGE-14fl was not expressed at a level
sufficient for purification. Western blot analysis, however, revealed
significant reactivity of the recombinant protein with a pool of five
serum samples from HGE patients (data not shown). Because of this
reactivity and difficulty with full-length protein expression and
purification, we chose to express and purify the more hydrophilic
HGE-14c.
ELISA.
Comparison of ELISA results for recombinant proteins
HGE-1, HGE-3, and Erf-1 (HGE-1-HGE-3 fusion protein) by using
a panel of IFA-reactive sera from HGE patients demonstrated that rHGE-1 and rHGE-3 were reactive with overlapping subsets of patient sera and
that the Erf-1 fusion polyprotein provided the greatest sensitivity. rHGE-1 was reactive with 14 of 27 acute-phase serum samples from HGE
patients and 21 of 27 convalescent-phase serum samples from HGE
patients, while rHGE-3 was reactive with 14 of 27 acute-phase serum
samples and 25 of 27 convalescent-phase serum samples in an IgG-based
assay. The reactivity of recombinant fusion polyprotein Erf-1 (rErf-1)
was similar to the reactivities of rHGE-1 and rHGE-3, as determined
from combined ELISA values, and thus, we chose to develop
rErf-1 in subsequent experiments. The ELISA reactivities for
recombinant proteins Erf-1, HGE-2, HGE-9, HGE-14c, HGE-15, and HGE-17
in both IgG- and IgM-based assays are summarized in Table
2 and Fig.
5. rErf-1 was reactive with 55.6% of
acute-phase serum samples (15 of 27 in an IgM-based assay) from HGE
patients and 92.6% of convalescent-phase serum samples (25 of 27 in an IgG-based assay) and gave relatively high mean assay values (Fig. 5).
The other recombinant E. phagocytophila proteins showed
variable sensitivities relative to that of rErf-1; however, most of the recombinant proteins added theoretically to the sensitivity of rErf-1.
Although rHGE-2 was reactive with a relatively high percentage of
acute-phase (55.6%) and convalescent-phase (77.8%) patient sera and
gave a high mean optical density value by IgG-based ELISA, it adds
little (one acute-phase serum sample from an HGE patient) to the
sensitivity of rErf-1. However, the theoretical addition of rHGE-9 to
the rErf-1 assay increased its sensitivity by adding five additional
acute-phase patient samples (Table 2). Recombinant HGE-14c, while being
reactive with three additional acute-phase patient samples in an
IgG-based assay, shows an overall weak reactivity, as seen in Fig. 5.
Recombinants HGE-15 and -17 each provided one additional patient sample
to the theoretical rErf-1 combination IgG-based assay. The five
recombinant proteins add little to the reactivity of rErf-1in IgM-based
assays. Recombinants HGE-2, -9, -14c, -15, and -17 gave sensitivities
of 55.6, 74.1, 51.8, 48.1, and 55.6%, respectively, for acute-phase
serum samples in theoretically combined IgM- and IgG-based assays, and
they gave sensitivities of 77.8, 74.1, 48.1, 70.4, and 70.4%,
respectively, for convalescent-phase serum samples. When the data are
combined, the six recombinant antigens are reactive with 85.2 and
96.2% of acute- and convalescent-phase serum samples, respectively,
and 94.1 and 96% of acute- and convalescent-phase serum samples,
respectively, with an IgG-based IFA titer equal to or greater than 64. The five acute-phase serum samples not detected by ELISAs with the six
recombinants had IFA titers of 64 or less (64, 32, 16, <16, and <16,
respectively). The one convalescent-phase serum sample missed had an
IFA titer of 64. Conversely, of 12 samples that were negative by IFA
(IFA titer,
32), 8 were detected with these recombinant antigens.
Three serum samples that were not detected in the acute phase were
detected in the convalescent phase. The specificities for the
recombinants ranged from 94 to 100%, depending on the antigen and the
secondary antibody used (Table 2).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 5.
Mean values of the optical density at 450 nm
(OD450) obtained by ELISA are provided for
convalescent-phase sera from HGE patients (A) and acute-phase sera from
HGE patients (B) for the six recombinant E.
phagocytophila proteins. Arrows indicate values for IgG- and
IgM-based assays, and the vertical lines on each bar give the
respective standard error of the mean for each mean value. Recombinant
protein identities are shown below, and mean values of the optical
density at 450 nm are shown to the left. These data were normalized to
a cutoff value of 1.0 (optical density at 450 nm values/cutoff value),
as indicated by the horizontal line. The original cutoff values (mean
for the random donor population plus 3 standard deviations of the mean)
for each assay are 0.271, 0.218, 0.485, 0.314, 0.532, and 0.918, respectively, for IgG-based assays and 0.160, 0.538, 0.364, 0.245, 0.312, and 0.554, respectively, for IgM-based assays.
|
|
 |
DISCUSSION |
The MSPs of E. phagocytophila have been demonstrated to
be the immunodominant antigens in HGE infections (20, 21, 22, 28,
37, 42, 43, 44). Although these antigens are reported to have
high sensitivities (87% [21] and 89.7%
[37]) and specificities (98%) in ELISAs, additional
antigens might be necessary to achieve optimal sensitivity, especially
for acute-phase patient sera. In the present study we identified, by
serologic expression screening, 14 genomic clones containing one or
more ORFs encoding immunoreactive proteins. Eight of these clones
encoded 11 unique members of the MSP multigene family; one clone
contained two MSP copies and a second clone contained three MSP copies.
The occurrence of multiple, tandem copies of the MSP ORFs has been
described previously for E. phagocytophila (28,
43) and for Ehrlichia chaffeensis (30) and E. canis (29). Also previously reported is
the observation that while some ORFs contain an ATG initiation codon,
other ORFs do not (42). Of the MSP ORFs reported here that
have complete amino termini, two contained initiation codons and two
had no obvious start codon. Alignment of the predicted polypeptides
from the 11 ORFs resulted in a pattern of conserved and variable
regions. The predicted amino termini are well conserved except for
variability at the extreme amino end due to variations in ORF size
(i.e., amino-terminal truncations). This conserved region is followed by a variable region of approximately 71 to 91 aa and then a second conserved region near the carboxy termini. The extreme carboxy termini
are variable in sequence and in length. The conserved regions have been
suggested to be involved in rearrangements, through genomic
recombination, that might result in antigenic variation
(16). Of interest is the finding of direct repeats of 12 bp (4 aa) that flank the central variable region (Fig. 1 and 2 and
Table 1). A similar genomic arrangement is seen in Borrelia
burgdorferi, which is probably involved in antigenic variation of
the surface-exposed lipoprotein VlsE (41). In this system,
a vls expression site is closely associated with 15 additional, tandemly arranged, silent vls cassettes.
Conserved sequences, on either side of the variable region, are thought
to facilitate recombination between the expressed and silent
vls sequences, and conserved 17-bp direct repeats that flank
all variable regions may be involved in alignment or in binding of a
proposed site-specific recombinase (41). In E. phagocytophila one finds (i) tandemly arranged silent and
expressed MSP copies, (ii) a variable region flanked by conserved
regions in each copy, and (iii) in-frame, direct repeats of 12 nt (4 aa) that flank the variable regions. This system of antigenic variation
through recombination of variable regions could produce variability in
the MSPs and thus aid in immune evasion. In the closely related
organism Anaplasma marginale, investigators
(16, 31, 32) demonstrate that true MSP2 structural antigenic variants emerge during each cycle of persistent rickettsemia. They also show that the MSP central hydrophilic variable region is the
sole site of MSP2 structural polymorphism among expressed variants and
that the structure of the MSP2 genes (i.e., variable region flanked by
conserved regions) provides the basis for homologous recombination by
gene conversion. From a practical standpoint, inclusion of the most
common variants initially encountered in human infection may be an
important consideration in serologic test design.
Three clones, hge-2, hge-9, and
hge-17, contain ORFs encoding antigens that have been
described previously (6, 36). HGE-2, a predicted 61.4-kDa
protein of unknown function with three repeats of 124 aa, differs by 1 aa from the 100-kDa antigen described by Storey et al.
(36). They show that the 100-kDa antigen shares similarities with a 120-kDa antigen of E. chaffeensis and
might be surface associated. Clones hge-9 and
hge-17 encode partial ORFs for the E. phagocytophila ankyrin gene (6). The HGE-17 sequence
is identical to 86% of the sequence of the carboxy end of the E. phagocytophila ankyrin protein, and the HGE-9 sequence is
identical to 30% of the central region of the E. phagocytophila ankyrin protein (GenBank accession number
AAF42730).
Three additional clones, hge-14, hge-15, and
hge-25, contained ORFs with no identities in the GenBank
database. ORFs encoded by hge-15 and hge-25 are
identical, and both are truncated at the carboxy terminus. Predicted
protein HGE-14 is an 81.1-kDa polypeptide with four repeats of 41 aa
that are bordered by degenerate repeats. It is predicted to be a type
II transmembrane protein, with the carboxy 600 aa potentially being
extracellular. HGE-15 also has an amino-terminal leader sequence or
transmembrane domain that is predicted to be cleavable or uncleaved,
depending on the initiation codon used. Interestingly, this antigen has
homology with bacterial PpiD at both the amino acid sequence level and at the structural level and contains both chaperonin and potential PPIC
PPIase signatures (Fig. 4). E. coli ppiD encodes a
periplasmic peptidyl-prolyl isomerase that is required for proper
folding of the outer membrane proteins (8). E. coli
ppiD is under control of the sigma factor regulon transcribing
cytosolic heat shock proteins and participates in the folding of
noncytoplasmic proteins. In E. coli, elevated temperatures
(37°C or greater) lead to the aggregation of proteins in general and
also to changes in the composition of the outer membrane and in the
abundance of outer membrane proteins. Thus, E. coli uses
this important catalyst of folding, needed for membrane biogenesis,
which is regulated by a classical heat shock sigma factor
(
32) (8). One might speculate
that in Ehrlichia spp. potential host-related changes in
membrane composition are partly due to the different temperatures of
vertebrate and invertebrate hosts and are regulated by similar stress
regulons and PPIase activities, possibly including HGE-15.
To assay for immunogenicity and the potential use of E. phagocytophila recombinant proteins in a serum-based immunoassay, seven ORFs were reengineered for expression in E. coli. Two
of the MSP ORFs, HGE-1 and HGE-3, were reconstructed for recombinant protein expression. These proteins were also expressed as a fusion protein, rErf-1. ORFs HGE-9 and -17 were expressed as overlapping portions of the ankyrin gene. HGE-2, HGE-14, and HGE-15 were also expressed as recombinant proteins. Initial ELISA data indicated that
the rErf-1 fusion protein was as reactive as rHGE-1 and -3 combined
were with sera from patients with HGE. rErf-1 detected 92.6% of
convalescent-phase sera from HGE patients and only 55.6% of
acute-phase sera from HGE patients in an IgG- and IgM-based assay.
However, rHGE-9 detected 74% of acute-phase sera from HGE patients and
detected 77.8% of acute-phase sera from these patients when it was
theoretically combined with rErf-1. rHGE-2, rHGE-14c, and rHGE-15
detected 78, 48, and 70% of convalescent-phase sera, respectively, and
56, 52, and 48% of acute-phase sera, respectively. When the data for
both the IgM- and the IgG-based assays were combined, the antigens
detected 96.2% of convalescent-phase sera from HGE patients and 85.2%
of acute-phase sera from HGE patients. The percentage of acute-phase
patient sera detected rose to 94.1% when an IFA titer of
64 in serum
was used as a cutoff for use in the assay. The five patient serum
samples not detected with these recombinant antigens had IFA titers of
64 or less, and ELISA values for these sera were just under the cutoff
values, suggesting that greater sensitivity might be obtained with an
increase in recombinant protein purity. Our data indicate that
additional, non-MSP recombinant proteins can add to the sensitivity of
a serum-based assay for the detection of HGE without compromising
specificity. Additional efforts are under way to optimize assay
conditions and recombinant protein purity and to select the appropriate
cocktail of recombinant antigens for a fusion polyprotein that would be most useful for the detection of both convalescent-phase and
acute-phase E. phagocytophila infection.
 |
ACKNOWLEDGMENTS |
We thank Thomas Vedvick and Darrick Carter for protein sequence
data and Dan Hoppe and Joe Parsons for assistance with DNA sequencing.
We also thank Jonathan Clapper and Peter Phan for performing
lipopolysaccharide assays with purified recombinant protein.
M.J.L. and R.L.H. contributed equally to the data presented here.
This work was supported by NIH grants AI42416 (to M.J.L.) and AI32403
(to D.H.P.), as well as cooperative agreement U50/CCU-510343 from the
Centers for Disease Control and Prevention (to D.H.P.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Corixa
Corporation, 1124 Columbia St., Suite 200, Seattle, WA 98104. Phone:
(206) 754-5797 or (206) 754-5879. Fax: (206) 754-5715. E-mail for
Michael J. Lodes: lodes{at}corixa.com. E-mail for David H. Persing: persing{at}corixa.com.
 |
REFERENCES |
| 1.
|
Aguero-Rosenfeld, M. E.,
F. Kalantarpour,
M. Baluch,
H. W. Horowitz,
D. F. McKenna,
J. T. Raffalli,
T. C. Hsieh,
J. Wu,
J. S. Dumler, and G. P. Wormser.
2000.
Serology of culture-confirmed cases of human granulocytic ehrlichiosis.
J. Clin. Microbiol.
38:635-638[Abstract/Free Full Text].
|
| 2.
|
Bakken, J. S.
1998.
The discovery of human granulocytotropic ehrlichiosis.
J. Lab. Clin. Med.
132:175-180[CrossRef][Medline].
|
| 3.
|
Bakken, J. S.,
J. S. Dumler,
S.-M. Chen,
M. R. Eckman,
L. L. Van Etta, and D. H. Walker.
1994.
Human granulocytic ehrlichiosis in the upper Midwest United States.
JAMA
272:212-218[Abstract/Free Full Text].
|
| 4.
|
Bakken, J. S.,
J. Krueth,
C. Wilson-Nordskog,
R. L. Tilden,
K. Asanovich, and J. S. Dumler.
1996.
Clinical and laboratory characteristics of human granulocytic ehrlichiosis.
JAMA
275:199-205[Abstract/Free Full Text].
|
| 5.
|
Belongia, E. A.,
K. D. Reed,
P. D. Mitchell,
P. H. Chyou,
N. Mueller-Rizner,
M. F. Finkel, and M. E. Schriefer.
1999.
Clinical and epidemiological features of early Lyme disease and human granulocytic ehrlichiosis in Wisconsin.
Clin. Infect. Dis.
29:1472-1477[CrossRef][Medline].
|
| 6.
|
Caturegli, P.,
K. M. Asanovich,
J. J. Walls,
J. S. Bakken,
J. E. Madigan,
V. L. Popov, and J. S. Dumler.
2000.
AnkA: an Ehrlichia phagocytophila group gene encoding a cytoplasmic protein antigen with ankyrin repeats.
Infect. Immun.
68:5277-5283[Abstract/Free Full Text].
|
| 7.
|
Chen, S.-M.,
J. S. Dumler,
J. S. Bakken, and D. H. Walker.
1994.
Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease.
J. Clin. Microbiol.
32:589-595[Abstract/Free Full Text].
|
| 8.
|
Dartigalongu, C., and S. Raina.
1998.
A new heat-shock gene, ppiD, encodes a peptidyl-prolyl isomerase required for folding of outer membrane proteins in Escherichia coli.
EMBO J.
17:3968-3980[CrossRef][Medline].
|
| 9.
|
Dawson, J. E.,
Y. Rikihisa,
S. A. Ewing, and D. B. Fishbein.
1991.
Serologic diagnosis of human ehrlichiosis using two Ehrlichia canis isolates.
J. Infect. Dis.
163:564-567[Medline].
|
| 10.
|
Dumler, J. S.,
K. M. Asanovich,
J. S. Bakken,
P. Richter,
R. Kimsey, and J. E. Madigan.
1995.
Serologic cross-reactions among Ehrlichia equi. Ehrlichia phagocytophila, and human granulocytic ehrlichia.
J. Clin. Microbiol.
33:1098-1103[Abstract].
|
| 11.
|
Dumler, J. S., and J. S. Bakken.
1995.
Ehrlichial diseases of humans: emerging tick-borne infections.
Clin. Infect. Dis.
20:1102-1110[Medline].
|
| 12.
|
Dumler, J. S., and J. S. Bakken.
1996.
Human granulocytic ehrlichiosis in Wisconsin and Minnesota: a frequent infection with the potential for persistence.
J. Infect. Dis.
173:1027-1030[Medline].
|
| 13.
|
Dumler, J. S.,
L. Dotevall,
R. Gustafson, and M. Granström.
1997.
A. population-based seroepidemiologic study of human granulocytic ehrlichiosis and Lyme borreliosis on the west coast of Sweden.
J. Infect. Dis.
175:720-722[Medline].
|
| 14.
|
Eng, T. R.,
J. R. Harkess,
D. B. Fishbein,
J. E. Dawson,
C. N. Greene,
M. A. Redus, and F. T. Satalowich.
1990.
Epidemiologic, clinical, and laboratory findings of human ehrlichiosis in the United States, 1988.
JAMA
264:2251-2258[Abstract/Free Full Text].
|
| 15.
|
Fishbein, D. B.,
J. E. Dawson, and L. E. Robinson.
1994.
Human ehrlichiosis in the United States.
Ann. Intern. Med.
120:736-743[Abstract/Free Full Text].
|
| 16.
|
French, D. M.,
W. C. Brown, and G. H. Palmer.
1999.
Emergence of Anaplasma marginale antigenic variants during persistent rickettsemia.
Infect. Immun.
67:5834-5840[Abstract/Free Full Text].
|
| 17.
|
Goodman, J. L.,
C. Nelson,
B. Vitale,
J. E. Madigan,
J. S. Dumler,
T. J. Kurtti, and U. G. Munderloh.
1996.
Direct cultivation of the causative agent of human granulocytic ehrlichiosis.
N. Engl. J. Med.
334:209-215[Abstract/Free Full Text].
|
| 18.
|
Hardalo, C. J.,
V. Quagliarello, and J. S. Dumler.
1995.
Human granulocytic ehrlichiosis in Connecticut: report of a fatal case.
Clin. Infect. Dis.
21:910-914[Medline].
|
| 19.
|
Houghton, R. L.,
D. R. Benson,
L. D. Reynolds,
P. D. McNeill,
P. Sleath,
M. J. Lodes,
Y. A. Skeiky,
D. Leiby,
R. Badaro, and S. G. Reed.
1999.
A. multiepitope synthetic peptide and recombinant protein for the detection of antibodies to Trypanosoma cruzi in radioimmunoprecipitation-confirmed and consensus-positive sera.
J. Infect. Dis.
179:1226-1234[CrossRef][Medline].
|
| 20.
|
IJdo, J. W.,
W. Sun,
Y. Zhang,
L. A. Magnarelli, and E. Fikrig.
1998.
Cloning of the gene encoding the 44-kilodalton antigen of the agent of human granulocytic ehrlichiosis and characterization of the humoral response.
Infect. Immun.
66:3264-3269[Abstract/Free Full Text].
|
| 21.
|
IJdo, J. W.,
C. Wu,
L. A. Magnarelli, and E. Fikrig.
1999.
Serodiagnosis of human granulocytic ehrlichiosis by a recombinant HGE-44-based enzyme-linked immunosorbent assay.
J. Clin. Microbiol.
37:3540-3544[Abstract/Free Full Text].
|
| 22.
|
IJdo, J. W.,
Y. Zhang,
E. Hodzic,
L. A. Magnarelli,
M. L. Wilson,
S. R. Telford III,
S. W. Barthold, and E. Fikrig.
1997.
The early humoral response in human granulocytic ehrlichiosis.
J. Infect. Dis.
176:687-692[Medline].
|
| 23.
|
Jahangir, A.,
C. Kolbert,
W. Edwards,
P. Mitchell,
J. S. Dumler, and D. H. Persing.
1998.
Fatal pancarditis associated with human granulocytic ehrlichiosis in a 44-year-old man.
Clin. Infect. Dis.
27:1424-1427[Medline].
|
| 24.
|
Kolbert, C. P.,
E. S. Bruinsma,
A. S. Abdulkarim,
E. K. Hofmeister,
R. B. Tompkins,
S. R. Telford III,
P. D. Mitchell,
J. Adams-Stich, and D. H. Persing.
1997.
Characterization of an immunoreactive protein from the agent of human granulocytic ehrlichiosis.
J. Clin. Microbiol.
35:1172-1178[Abstract].
|
| 25.
|
Magnarelli, L. A.,
J. S. Dumler,
J. F. Anderson,
R. C. Johnson, and E. Fikrig.
1995.
Coexistence of antibodies to tick-borne pathogens of babesiosis, ehrlichiosis, and Lyme borreliosis in human sera.
J. Clin. Microbiol.
33:3054-3057[Abstract].
|
| 26.
|
Matsudaira, P.
1987.
Sequence from picomole quantities of proteins electroblotted onto polyvinylidene difluoride membranes.
J. Biol. Chem.
262:10035-10038[Abstract/Free Full Text].
|
| 27.
|
Mitchell, P. D.,
K. D. Reed, and J. M. Hofkes.
1996.
Immunoserologic evidence of coinfection with Borrelia burgdorferi, Babesia microti, and human granulocytic Ehrlichia species in residents of Wisconsin and Minnesota.
J. Clin. Microbiol.
34:724-727[Abstract].
|
| 28.
|
Murphy, C. I.,
J. R. Storey,
J. Recchia,
L. A. Doros-Richert,
C. Gingrich-Baker,
K. Munroe,
J. S. Bakken,
R. T. Coughlin, and G. A. Beltz.
1998.
Major antigenic proteins of the agent of human granulocytic ehrlichiosis are encoded by members of a multigene family.
Infect. Immun.
66:3711-3718[Abstract/Free Full Text].
|
| 29.
|
Ohashi, N.,
A. Unver,
N. Zhi, and Y. Rikihisa.
1998.
Cloning and characterization of multigenes encoding the immunodominant 30-kilodalton major outer membrane proteins of Ehrlichia canis and application of the recombinant protein for serodiagnosis.
J. Clin. Microbiol.
36:2671-2680[Abstract/Free Full Text].
|
| 30.
|
Ohashi, N.,
N. Zhi,
Y. Zhang, and Y. Rikihisa.
1998.
Immunodominant major outer membrane proteins of Ehrlichia chaffeensis are encoded by a polymorphic multigene family.
Infect. Immun.
66:132-139[Abstract/Free Full Text].
|
| 31.
|
Palmer, G. H.,
W. C. Brown, and F. R. Rurangirwa.
2000.
Antigenic variation in the persistence and transmission of the ehrlichia Anaplasma marginale.
Microbes Infect.
2:167-176[CrossRef][Medline].
|
| 32.
|
Palmer, G. H.,
G. Eid,
A. F. Barbet,
T. C. McGuire, and T. F. McElwain.
1994.
The immunoprotective Anaplasma marginale major surface protein 2 is encoded by a polymorphic multigene family.
Infect. Immun.
62:3808-3816[Abstract/Free Full Text].
|
| 33.
|
Pancholi, P.,
C. P. Kolbert,
P. D. Mitchell,
K. D. Reed,
J. S. Dumler,
J. S. Bakken,
S. R. Telford, and D. H. Persing.
1995.
Ixodes dammini as a potential vector of human granulocytic ehrlichiosis.
J. Infect. Dis.
172:1007-1012[Medline].
|
| 34.
|
Piesman, J.,
T. N. Mather,
S. R. Telford, and A. Spielman.
1986.
Concurrent Borrelia burgdorferi and Babesia microti infection in nymphal Ixodes dammini.
J. Clin. Microbiol.
24:446-447[Abstract/Free Full Text].
|
| 35.
|
Schaffner, W., and S. M. Standaert.
1996.
Ehrlichiosis in pursuit of an emerging infection.
N. Engl. J. Med.
334:262-263[Free Full Text].
|
| 36.
|
Storey, J. R.,
L. A. Doros-Richert,
C. Gingrich-Baker,
K. Munroe,
T. N. Mather,
R. T. Coughlin,
G. A. Beltz, and C. I. Murphy.
1998.
Molecular cloning and sequencing of three granulocytic Ehrlichia genes encoding high-molecular-weight immunoreactive proteins.
Infect. Immun.
66:1356-1363[Abstract/Free Full Text].
|
| 37.
|
Tajima, T.,
N. Zhi,
Q. Lin,
Y. Rikihisa,
H. W. Horowitz,
J. Ralfalli,
G. P. Wormser, and K. E. Hechemy.
2000.
Comparison of two recombinant major outer membrane proteins of the human granulocytic ehrlichiosis agent for use in an enzyme-linked immunosorbent assay.
Clin. Diagn. Lab. Immunol.
7:652-657[Abstract/Free Full Text].
|
| 38.
|
Telford, S. R., III,
J. E. Dawson,
P. Katavolos,
C. K. Warner,
C. P. Kolbert, and D. H. Persing.
1996.
Perpetuation of the agent of human granulocytic ehrlichiosis in a deer tick-rodent cycle.
Proc. Natl. Acad. Sci. USA
93:6209-6214[Abstract/Free Full Text].
|
| 39.
|
Walls, J. J.,
P. Caturegli,
J. S. Bakken,
K. M. Asanovich, and J. S. Dumler.
2000.
Improved sensitivity of PCR for diagnosis of human granulocytic ehrlichiosis using epank1 genes of Ehrlichia phagocytophila-group ehrlichiae.
J. Clin. Microbiol.
38:354-356[Abstract/Free Full Text].
|
| 40.
|
Wormser, G. P.,
H. W. Horowitz,
J. S. Dumler,
I. Schwartz, and M. Aguero-Rosenfeld.
1996.
False-positive Lyme disease serology in human granulocytic ehrlichiosis.
Lancet
347:981-982[CrossRef][Medline].
|
| 41.
|
Zhang, J.-R.,
J. M. Hardham,
A. G. Barbour, and S. J. Norris.
1997.
Antigenic variation in Lyme disease borreliae by promiscuous recombination of VMP-like sequence cassettes.
Cell
89:275-285[CrossRef][Medline].
|
| 42.
|
Zhi, N.,
N. Ohashi, and Y. Rikihisa.
1999.
Multiple p44 genes encoding major outer membrane proteins are expressed in the human granulocytic ehrlichiosis agent.
J. Biol. Chem.
274:17828-17836[Abstract/Free Full Text].
|
| 43.
|
Zhi, N.,
N. Ohashi,
Y. Rikihisa,
H. W. Horowitz,
G. P. Wormser, and K. Hechemy.
1998.
Cloning and expression of the 44-kilodalton major outer membrane protein of the human granulocytic ehrlichiosis agent and application of the recombinant protein to serodiagnosis.
J. Clin. Microbiol.
36:1666-1673[Abstract/Free Full Text].
|
| 44.
|
Zhi, N.,
Y. Rikihisa,
H. Y. Kim,
G. P. Wormser, and H. W. Horowitz.
1997.
Comparison of major antigenic proteins of six strains of the human granulocytic ehrlichiosis agent by Western immunoblot analysis.
J. Clin. Microbiol.
35:2606-2611[Abstract].
|
Journal of Clinical Microbiology, July 2001, p. 2466-2476, Vol. 39, No. 7
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.7.2466-2476.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zhang, C., Xiong, Q., Kikuchi, T., Rikihisa, Y.
(2008). Identification of 19 Polymorphic Major Outer Membrane Protein Genes and Their Immunogenic Peptides in Ehrlichia ewingii for Use in a Serodiagnostic Assay. CVI
15: 402-411
[Abstract]
[Full Text]
-
Park, J., Choi, K. S., Dumler, J. S.
(2003). Major Surface Protein 2 of Anaplasma phagocytophilum Facilitates Adherence to Granulocytes. Infect. Immun.
71: 4018-4025
[Abstract]
[Full Text]
-
Lin, Q., Zhi, N., Ohashi, N., Horowitz, H. W., Aguero-Rosenfeld, M. E., Raffalli, J., Wormser, G. P., Rikihisa, Y.
(2002). Analysis of Sequences and Loci of p44 Homologs Expressed by Anaplasma phagocytophila in Acutely Infected Patients. J. Clin. Microbiol.
40: 2981-2988
[Abstract]
[Full Text]