Previous Article | Next Article 
Journal of Clinical Microbiology, August 2001, p. 2987-2990, Vol. 39, No. 8
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.8.2987-2990.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Mutations in the rpoB Gene of
Multidrug-Resistant Mycobacterium tuberculosis Clinical
Isolates from India
Cheruvu
Mani,
N.
Selvakumar,*
Sujatha
Narayanan, and
P. R.
Narayanan
Tuberculosis Research Centre, Chetput,
Chennai 600 031, Tamil Nadu, India
Received 27 November 2000/Returned for modification 28 March
2001/Accepted 23 April 2001
 |
ABSTRACT |
Mutations in the 81-bp rifampin resistance-determining region
(RRDR) of the rpoB gene were analyzed by DNA sequencing of
50 Mycobacterium tuberculosis clinical isolates (44 resistant and 6 sensitive) from various parts of India. Fifty-three
mutations of 18 different kinds, 17 point mutations and one deletion,
were observed in 43 of 44 resistant isolates. Three novel mutations and
three new alleles within the RRDR, along with two novel mutations outside the RRDR, are reported in this study.
 |
TEXT |
Tuberculosis (TB), though curable,
still remains a major killer disease worldwide. The magnitude of the
problem is reflected in estimates of new cases, which are predicted to
number around 10 million in the year 2000 and 12 million by 2005 (7). Global prevalence of infection due to
Mycobacterium tuberculosis is 32%. Eighty percent of all
new TB cases are found in around 22 countries, with more than half the
cases occurring in 5 Southeast Asian countries (6). Thirty
percent of the world's TB-infected population is in India. The
enormity of the problem has increased with the emergence of
multidrug-resistant (MDR) strains of M. tuberculosis. Dual infection with human immunodeficiency virus and MDR TB is a virtual death sentence in this era.
Rifampin (RIF) resistance serves as a surrogate marker for the
detection of MDR TB, as 90% of Rifr isolates are
also isoniazid resistant (5). RIF interferes with
transcription and elongation of RNA by binding to the DNA-dependent RNA
polymerase. It was observed that resistance to RIF follows a
single-step, high-level resistance pattern in which mutations occur
spontaneously at a frequency of 10
9. The genetic basis
for RIF resistance in approximately 95% of the cases is due to
mutations in an 81-bp RIF resistance-determining region (RRDR) of the
rpoB gene, corresponding to codons 507 to 533 (Escherichia coli numbering system), which codes for the
beta subunit of the RNA polymerase of M. tuberculosis.
Different groups of workers from diverse regions of the world (4,
8-12, 14, 16, 19, 20, 21, 23, 24) have thus far reported around
65 substitutions, 12 deletions, and 4 insertions in the RRDR of the
rpoB gene. Only one of these earlier reports is concerned
with Indian isolates, and in that study rpoB mutations were
observed in three Rifr isolates (8).
Determination of the mutation patterns among large numbers of isolates
from different parts of India is essential, since this would help not
only in the design of a suitable diagnostic method for rapid detection
of MDR TB but also in the identification of any hot-spot regions in the
country for proper implementation of TB control programs. It would also
help in understanding whether mutated alleles arise independently or
due to the spread of a particular genotype. Moreover, it is well known
that clinical isolates from southern India are very different from
isolates from other parts of the world. The former have lower virulence in guinea pigs (2), higher susceptibility to hydrogen
peroxide (13, 18) and thiophene-2-carboxylic acid
hydrazide (TCH), lower sensitivity to p-aminosalicylic acid
(17) and thioacetazone, and an appreciably higher
proportion of phage type I (1). It is of interest to
determine whether these southern Indian isolates show any different
kinds of mutations in the RRDR region of the rpoB gene.
DNA sequencing of RRDR.
The following are the results of DNA
sequencing of the RRDR of 44 Rifr isolates (35 of
which were isolated from patients from southern India) and 6 Rifs isolates, all obtained from seven states in India.
(i) M. tuberculosis isolates.
Forty-four
Rifr and six Rifs strains were
isolated from 50 patients from seven states in India. Of the 44 Rifr strains, the numbers isolated from each state
were as follows: Andhra Pradesh (AP), 6; Delhi, 1; Goa, 3; Kerala, 4;
Karnataka, 5; Sikkim, 5; and Tamil Nadu (TN), 20. Of the six
Rifs strains, four were obtained from patients from
TN, while two were from AP. The drug susceptibility patterns of these
isolates are shown in Table 1.
(ii) Determination of sensitivity to RIF.
Conventional
indirect susceptibility testing was done using Lowenstein-Jensen
medium, and RIF sensitivity was determined by the MIC method.
Resistance was defined by a MIC equal to or greater than 128 mg/liter.
(iii) Sequencing of the RRDR of the rpoB gene.
The
RRDR of the rpoB gene was sequenced after amplification by
PCR to analyze the mutations associated with RIF resistance. Template
DNA for PCR was obtained using cetyltrimethylammonium bromide
(22). PCR was performed using primers rpo3 (5'
CAGACGTTGATCAACATCCG 3') and rpo4 (5' TACGGCGTTTCGATGAAC 3')
to generate a 305-bp product, which was purified and used for
sequencing. A T7 Sequenase v 2.0 PCR product sequencing kit (Amersham
Life Science) and primer TR9 (5' TCGCCGCGATCAAGGAGT 3') were
used for manual sequencing. In brief, 1 µl of exonuclease I (10 U/µl) and 1 µl of shrimp alkaline phosphatase (2 U/µl) were added
to 7 µl of PCR amplification mixture, and the mixture was incubated
at 37°C for 15 min. The reaction mixture was inactivated by heating
to 80°C for 15 min. To 9 µl of treated PCR product, 1 µl of
primer (10 pmol/µl) was added, and the mixture was incubated at
100°C for 3 min, followed by snap cooling. To this ice-cold annealed
DNA mixture, 2 µl of 5× T7 Sequenase reaction buffer, 1 µl of 0.1 M dithiothreitol, 2 µl of a 1:10-diluted labeling mixture, 5 µCi of
[35S]dATP, and 2 µl of T7 Sequenase v 2.0 DNA
polymerase were added, and the mixture was incubated at room
temperature for 2 min. Aliquots of this mixture (3.5 µl each) were
added to termination tubes containing 2.5 µl of each termination
mixture (G, A, T, and C) and incubated at 37°C for 10 min. The
reaction was stopped by adding 4 µl of stop solution. Samples were
heated to 75°C for 2 min and then loaded onto a sequencing gel. An
automated sequencer (ABI Prism model 377 version 3.0) was used with
primer TR8 (5' TGCACGTCGCGGACCTCCA 3') to confirm the
sequence in reverse order. The data obtained were compared with the
sequence obtained from the database at the Sanger Centre using the
BLAST program (www.sanger.ac.uk).
Molecular analysis.
The MIC of RIF for all 44 Rifr isolates was greater than 128 mg/liter, while
the MIC of RIF for all six Rifs isolates was less
than 32 mg/liter. DNA sequence analysis of the 44 Rifr isolates showed that 39 had a single mutation,
two had triple mutations, and two had quadruple mutations in the 81-bp
RRDR of the rpoB gene. One isolate did not contain any
mutation. Fifty-three mutations of 18 different kinds, 17 point
mutations and one deletion, were observed (Table
2). Two isolates from TN that contained four mutations had a novel mutation of GCG to GCA at codon 532. In
addition, one of the two TN isolates had mutations at codon 518 (AAC to
CAC), codon 531 (TCG to TTG), and codon 533 (CTG to CTT), while the
other had mutations at codon 511 (CTG to ATG), codon 512 (AGC
to AGG), and codon 526 (CAC to GAC). One isolate from AP that contained
a triple mutation had two mutations in codon 516 (GAC to AAA) and
another at codon 531 (TCG to TTG). This particular isolate also
contained a mutation outside the RRDR (CCC to CAC at codon 535). The
other isolate that contained a triple mutation was from TN and had
mutations at codon 508 (ACC to AGC), codon 512 (AGC to AGG), and codon
526 (CAC to GAC). In Karnataka, four isolates had the same mutation,
TCG to TTG, at codon 531, while the fifth exhibited a mutation at codon
526, CAC to GAC. None of the sensitive strains contained any mutation.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Distribution of mutations by state found in the RRDR of
the rpoB gene in Rifr M. tuberculosis isolates from India
|
|
Eighteen different types of mutations were identified in 44 Rif
r M. tuberculosis clinical isolates.
Ninety-five percent of these
were point mutations involving 10 codons,
while only one isolate
had a deletion. The codons most frequently
involved in mutation
were codon 531 (frequency, 53%) and codon 526 (19%). Among the
different mutations seen at codon 531, the mutation
of TCG (Ser)
to TTG (Leu) occurred at a very high frequency, 49%.
Matsiota-Bernard
et al. (
10) and Pozzi et al.
(
14) found similarly high frequencies
of this particular
mutation, 56 and 59%, respectively. Though
mutation of CAC to GAC at
codon 526 occurred at frequencies of
30% in Italian isolates
(
14) and 19% in Greek isolates (
10),
we
found a low frequency of this mutation, 6%. Previous workers
have
reported a wide range of frequencies for these particular
mutations at
codon 531 (20 to 71%) and codon 526 (0 to 30%) (
14).
Ramaswamy and Musser (
15) showed frequencies of 41 and
36% for
various mutations occurring at codons 531 and 526, respectively,
in 478 isolates obtained from various parts of the world.
Billington
et al. (
3) observed that mutants isolated more
frequently in
clinical practice have a higher mean relative fitness and
the
prevalence of each mutant type depends on its ability to survive.
This might be the reason for the higher occurrence of the mutation
of
TCG to TTG at codon 531 in isolates in the present study from
all the
states except those from AP, where codon 526 was the most
involved.
Five different types of mutations were seen at codon
526 (Fig.
1). Hirano et al. (
8)
reported mutations in Indian
isolates at codon 531 (TCG to TGG) and
codon 526 (CAC to GAC).
No mutation was observed in the RRDR of the six
Rif
s isolates analyzed in this study. One isolate,
although resistant
to RIF, did not show any mutation. Kapur et al.
(
9) also reported
such observations. The RIF resistance in
these isolates may be
due either to the presence of a mutation
elsewhere in this gene
or to some other resistance mechanism.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
Mutations in the RRDR of the rpoB gene of
M. tuberculosis Indian isolates. The bottom panel shows the
mutated codons with corresponding amino acids. The original sequence is
shown boxed. Numbers to the left of or below amino acid designations
indicate numbers of isolates showing the mutation, while percentages
denote the frequencies of occurrence of mutations at the particular
codon.
|
|
Mutations at codon 532 from GCG (Ala) to GCA (Ala) in two isolates and
at codon 508 from ACC (Thr) to AGC (Ser) and deletion
at codon 517 alone of CAG (Gln) have not been reported previously.
New alleles
reported in this study include mutations from AGC
(Ser) to AGG (Arg) at
codon 512, GAC (Asp) to AAA (Lys) at codon
516, and CTG (Leu) to CTT
(Leu) at codon 533. New mutations outside
the RRDR were also seen in
two isolates (GGG to GAG at codon 534
and CCC to CAC at codon 535).
Previous workers have also reported
mutations outside the RRDR (GAG to
GCG at codon 504 [
16], GAG
to GAT at codon 541 [
14], TCG to GCG at codon 553 [
14], and
ATC to TTC at codon 572 [
24]).
In contrast to the results obtained by Taniguchi et al.
(
19), our results showed high MICs for isolates with
mutations at
codon 516 or codon 533. In fact, a high MIC (>128
mg/liter) was
demonstrated even for an isolate with a silent mutation
at codon
532.
Forty-three Rif
r isolates in the present study
either showed a substitution(s) or a deletion in the RRDR. New alleles
as well
as novel mutations within as well as outside the RRDR have been
found in this study. The majority of the mutations map to codon
531, followed by codon 526. There was no specific geographical
clustering of
isolates in terms of mutations. Though the occurrence
of mutations at
codon 526 was high in AP compared to that in other
states, analysis
with a higher sample number needs to be done
to arrive at a definitive
conclusion.
Despite the large number of mutations already reported in other
studies, the evidence of new mutations in this study indicates
that
mutations continue to arise, probably due to the ability
of
M. tuberculosis to adapt to drug
exposure.
In this study, molecular analysis of the 81-bp RRDR of the
rpoB gene of 50
M. tuberculosis clinical isolates
from various
parts of India was carried out and the mutations were
identified.
Three novel mutations and three new alleles within the RRDR
and
two novel mutations outside the RRDR were identified. Although
the
Indian isolates exhibited few distinct characteristics, the
pattern of
mutations in the 81-bp RRDR is similar to that reported
for the
majority of clinical isolates in different parts of the
world.
Tests like Inno-LiPA Rif.TB (Innogenetics, Zwijndrecht, Belgium)
rapidly identify clinical isolates as members of the
M. tuberculosis complex and determine the presence of point mutations
within the
RRDR of the
rpoB gene. Such tests basically
exploit the principle
of hybridization, and the probes for such tests
are designed according
to the expected mutations. If the expected
mutations or their
frequencies of occurrence are different in different
countries,
such molecular diagnostic tests will have to be slightly
modified.
Further, knowledge of the mutations present in these isolates
would help in the use of
rpoB genotyping as an
epidemiological
tool for Rif
r M. tuberculosis isolates.
rpoB genotyping can also be used
for
discrimination of Rif
r M. tuberculosis isolates with identical IS6110 fingerprints.
Therefore, the new mutations reported here need to be considered
in the
development of new molecular diagnostic methods to be implemented
in
India. This study, though confirming the universal pattern
of mutations
in
rpoB, also reveals the presence of novel mutations
and
new alleles among Indian
isolates.
Nucleotide sequence accession numbers.
The sequences with
novel mutations found in this study are deposited in EMBL under
accession numbers AJ297922, AJ297923, and AJ297924; those with
mutations in the new alleles are deposited under accession numbers
AJ297925, AJ297926, and AJ297927; and those with mutations outside RRDR
are deposited under accession numbers AJ297928 and AJ297929.
 |
ACKNOWLEDGMENTS |
We thank Nalini Sundarmohan, V. Kripa, and S. K. Vasan for
technical assistance and William R. Jacobs, Jr., Howard Hughes Medical
Institute at Albert Einstein College of Medicine, Bronx, N.Y., for
providing the facilities for automated sequencing.
The Senior Research Fellowship extended by the Council of Scientific
and Industrial Research, Government of India, to C. Mani is gratefully acknowledged.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Tuberculosis
Research Centre (ICMR), Mayor V. R. Ramanathan Rd., Chetput,
Chennai 600 031, Tamil Nadu, India. Phone: 91-(44)-8265425. Fax:
91-(44)-8262137. E-mail: icmrtrc{at}vsnl.com.
 |
REFERENCES |
| 1.
|
Bhatia, A. L.
1961.
Characteristics of Indian tubercle bacilli.
Ind. J. Chest Dis.
3:147-153.
|
| 2.
|
Bhatia, A. L.,
A. Csillag,
D. A. Mitchison,
J. B. Selkon,
P. R. Somasundaram, and T. V. Subbaiah.
1961.
The virulence in the guinea-pig of tubercle bacilli isolated before treatment from South Indian patients with pulmonary tuberculosis. 2. Comparison with virulence of tubercle bacilli from British patients.
Bull. W. H. O.
25:313-322[Medline].
|
| 3.
|
Billington, O. J.,
T. D. McHugh, and S. H. Gillespie.
1999.
Physiological cost of rifampin resistance induced in vitro in Mycobacterium tuberculosis.
Antimicrob. Agents Chemother.
43:1866-1869[Abstract/Free Full Text].
|
| 4.
|
Donnabella, V.,
F. Martiniuk,
D. Kinney,
M. Bacerdo,
S. Bonk,
B. Hanna, et al.
1994.
Isolation of the gene for the subunit of RNA polymerase from rifampin-resistant Mycobacterium tuberculosis and identification of new mutations.
Am. J. Respir. Cell Mol. Biol.
11:639-643[Abstract].
|
| 5.
|
Drobniewski, F. A., and S. M. Wilson.
1998.
The rapid diagnosis of isoniazid and rifampin resistance in Mycobacterium tuberculosis a molecular story.
J. Med. Microbiol.
47:189-196[Abstract/Free Full Text].
|
| 6.
|
Dye, C.,
S. Scheele,
P. Dolin,
V. Pathania, and M. C. Raviglione.
1999.
Consensus statement. Global burden of tuberculosis: estimated incidence, prevalence, and mortality by country. WHO Global Surveillance and Monitoring Project.
JAMA
282:677-686[Abstract/Free Full Text].
|
| 7.
|
Heifets, L. B., and G. A. Cangelosi.
1999.
Drug susceptibility testing of Mycobacterium tuberculosis: a neglected problem at the turn of the century.
Int. J. Tuberc. Lung Dis.
3:564-581[Medline].
|
| 8.
|
Hirano, K.,
C. Abe, and M. Takahashi.
1999.
Mutations in the rpoB gene of rifampin-resistant Mycobacterium tuberculosis strains isolated mostly in Asian countries and their rapid detection by line probe assay.
J. Clin. Microbiol.
37:2663-2666[Abstract/Free Full Text].
|
| 9.
|
Kapur, V.,
L.-L. Li,
S. Iordanescu,
M. R. Hamrick,
A. Wanger,
B. N. Kreiswirth, and J. M. Musser.
1994.
Characterization by automated DNA sequencing of mutations in the gene (rpoB) encoding the RNA polymerase subunit in rifampin-resistant Mycobacterium tuberculosis strains from New York City and Texas.
J. Clin. Microbiol.
32:1095-1098[Abstract/Free Full Text].
|
| 10.
|
Matsiota-Bernard, P.,
G. Vrioni, and E. Marinis.
1998.
Characterization of rpoB mutations in rifampin-resistant clinical Mycobacterium tuberculosis isolates from Greece.
J. Clin. Microbiol.
36:20-23[Abstract/Free Full Text].
|
| 11.
|
Miller, L. P.,
J. T. Crawford, and T. M. Shinnick.
1994.
The rpoB gene of Mycobacterium tuberculosis.
Antimicrob. Agents Chemother.
38:805-811[Abstract/Free Full Text].
|
| 12.
|
Musser, J. M.
1995.
Antimicrobial agent resistance in mycobacteria: molecular genetic insights.
Clin. Microbiol. Rev.
8:496-514[Abstract].
|
| 13.
|
Narayanan Nair, C.,
E. M. Mackay-Scollay,
K. Ramachandran,
J. B. Selkon,
S. P. Tripathy,
D. A. Mitchison, et al.
1964.
Virulence in the guinea-pig and susceptibility to hydrogen peroxide of isoniazid-sensitive tubercle bacilli from South Indian patients.
Tubercle
45:345-353[Medline].
|
| 14.
|
Pozzi, G.,
M. Meloni,
E. Iona,
G. Orrù,
O. F. Thoresen,
M. L. Ricci,
M. R. Oggioni,
L. Fattorini, and G. Orefici.
1999.
rpoB mutations in multidrug-resistant strains of Mycobacterium tuberculosis isolated in Italy.
J. Clin. Microbiol.
37:1197-1199[Abstract/Free Full Text].
|
| 15.
|
Ramaswamy, S., and J. M. Musser.
1998.
Molecular genetic basis of antimicrobial agent resistance in Mycobacterium tuberculosis: 1998 update.
Tuber. Lung Dis.
79:3-29[CrossRef][Medline].
|
| 16.
|
Schilke, K.,
K. Weyer,
G. Bretzel,
B. Amthor,
J. Brandt,
V. Sticht-Groh,
P. B. Fourie, and W. H. Haas.
1999.
Universal pattern of rpoB gene mutations among multidrug-resistant isolates of Mycobacterium tuberculosis complex from Africa.
Int. J. Tuberc. Lung Dis.
3:620-626[Medline].
|
| 17.
|
Selkon, J. B.,
T. V. Subbaiah,
A. L. Bhatia,
S. Radhakrishna, and D. A. Mitchison.
1960.
A comparison of the sensitivity to p-aminosalicylic acid of tubercle bacilli from South Indian and British patients.
Bull. W. H. O.
23:599-611[Medline].
|
| 18.
|
Subbaiah, T. V.,
D. A. Mitchison, and J. B. Selkon.
1960.
The susceptibility of hydrogen peroxide of Indian and British isoniazid-sensitive and isoniazid-resistant tubercle bacilli.
Tubercle
41:323-333[CrossRef].
|
| 19.
|
Taniguchi, H.,
H. Aramaki,
Y. Nikaido,
Y. Mizuguchi,
M. Nakamura,
T. Koga, and S. Yoshida.
1996.
Rifampin resistance and mutation of the rpoB gene in Mycobacterium tuberculosis.
FEMS Microbiol. Lett.
144:103-108[CrossRef][Medline].
|
| 20.
|
Telenti, A.,
P. Imboden,
F. Marchesi,
D. Lowrie,
S. Cole,
M. J. Colston, et al.
1993.
Detection of rifampin-resistance mutations in Mycobacterium tuberculosis.
Lancet
341:647-650[CrossRef][Medline].
|
| 21.
|
Valim, A. R. M.,
M. L. R. Rossetti,
M. O. Ribeiro, and A. Zaha.
2000.
Mutations in the rpoB gene of multidrug-resistant Mycobacterium tuberculosis isolates from Brazil.
J. Clin. Microbiol.
38:3119-3122[Abstract/Free Full Text].
|
| 22.
|
van Embden, J. D. A.,
M. D. Cave,
J. T. Crawford,
J. W. Dale,
K. D. Eisenach,
B. Gicquel,
P. Hermans,
C. Martin,
R. McAdam,
T. M. Shinnick, and P. M. Small.
1993.
Strain identification of Mycobacterium tuberculosis by DNA finger printing: recommendations for a standardized methodology.
J. Clin. Microbiol.
31:406-409[Abstract/Free Full Text].
|
| 23.
|
Williams, D. L.,
C. Waguespack,
K. Eisenach,
J. T. Crawford,
F. Portaels,
M. Salfinger,
C. M. Nolan,
C. Abe,
V. Sticht-Groh, and T. P. Gillis.
1994.
Characterization of rifampin resistance in pathogenic mycobacteria.
Antimicrob. Agents Chemother.
38:2380-2386[Abstract/Free Full Text].
|
| 24.
|
Yuen, L. K. W.,
D. Leslie, and P. J. Coloe.
1999.
Bacteriological and molecular analysis of rifampin-resistant Mycobacterium tuberculosis strains isolated in Australia.
J. Clin. Microbiol.
37:3844-3850[Abstract/Free Full Text].
|
Journal of Clinical Microbiology, August 2001, p. 2987-2990, Vol. 39, No. 8
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.8.2987-2990.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bahrmand, A. R., Titov, L. P., Tasbiti, A. H., Yari, S., Graviss, E. A.
(2009). High-Level Rifampin Resistance Correlates with Multiple Mutations in the rpoB Gene of Pulmonary Tuberculosis Isolates from the Afghanistan Border of Iran. J. Clin. Microbiol.
47: 2744-2750
[Abstract]
[Full Text]
-
Bergval, I. L., Vijzelaar, R. N. C. P., Dalla Costa, E. R., Schuitema, A. R. J., Oskam, L., Kritski, A. L., Klatser, P. R., Anthony, R. M.
(2008). Development of Multiplex Assay for Rapid Characterization of Mycobacterium tuberculosis. J. Clin. Microbiol.
46: 689-699
[Abstract]
[Full Text]
-
Soudani, A., Hadjfredj, S., Zribi, M., Masmoudi, A., Messaoud, T., Tiouri, H., Fendri, C.
(2007). Characterization of Tunisian Mycobacterium tuberculosis Rifampin-Resistant Clinical Isolates. J. Clin. Microbiol.
45: 3095-3097
[Abstract]
[Full Text]
-
Ma, X., Wang, H., Deng, Y., Liu, Z., Xu, Y., Pan, X., Musser, J. M., Graviss, E. A.
(2006). rpoB Gene Mutations and Molecular Characterization of Rifampin-Resistant Mycobacterium tuberculosis Isolates from Shandong Province, China.. J. Clin. Microbiol.
44: 3409-3412
[Abstract]
[Full Text]
-
Cavusoglu, C., Turhan, A., Akinci, P., Soyler, I.
(2006). Evaluation of the Genotype MTBDR Assay for Rapid Detection of Rifampin and Isoniazid Resistance in Mycobacterium tuberculosis Isolates.. J. Clin. Microbiol.
44: 2338-2342
[Abstract]
[Full Text]
-
O'Sullivan, D. M., McHugh, T. D., Gillespie, S. H.
(2005). Analysis of rpoB and pncA mutations in the published literature: an insight into the role of oxidative stress in Mycobacterium tuberculosis evolution?. J Antimicrob Chemother
55: 674-679
[Abstract]
[Full Text]
-
Jou, R., Chen, H.-Y., Chiang, C.-Y., Yu, M.-C., Su, I.-J.
(2005). Genetic Diversity of Multidrug-Resistant Mycobacterium tuberculosis Isolates and Identification of 11 Novel rpoB Alleles in Taiwan. J. Clin. Microbiol.
43: 1390-1394
[Abstract]
[Full Text]
-
Herrera-Leon, L., Molina, T., Saiz, P., Saez-Nieto, J. A., Jimenez, M. S.
(2005). New Multiplex PCR for Rapid Detection of Isoniazid-Resistant Mycobacterium tuberculosis Clinical Isolates. Antimicrob. Agents Chemother.
49: 144-147
[Abstract]
[Full Text]
-
Varma-Basil, M., El-Hajj, H., Colangeli, R., Hazbon, M. H., Kumar, S., Bose, M., Bobadilla-del-Valle, M., Garcia, L. G., Hernandez, A., Kramer, F. R., Osornio, J. S., Ponce-de-Leon, A., Alland, D.
(2004). Rapid Detection of Rifampin Resistance in Mycobacterium tuberculosis Isolates from India and Mexico by a Molecular Beacon Assay. J. Clin. Microbiol.
42: 5512-5516
[Abstract]
[Full Text]
-
Yue, J., Shi, W., Xie, J., Li, Y., Zeng, E., Wang, H.
(2003). Mutations in the rpoB Gene of Multidrug-Resistant Mycobacterium tuberculosis Isolates from China. J. Clin. Microbiol.
41: 2209-2212
[Abstract]
[Full Text]
-
Hwang, H.-Y., Chang, C.-Y., Chang, L.-L., Chang, S.-F., Chang, Y.-H., Chen, Y.-J.
(2003). Characterization of rifampicin-resistant Mycobacterium tuberculosis in Taiwan. J Med Microbiol
52: 239-245
[Abstract]
[Full Text]
-
Cavusoglu, C., Hilmioglu, S., Guneri, S., Bilgic, A.
(2002). Characterization of rpoB Mutations in Rifampin-Resistant Clinical Isolates of Mycobacterium tuberculosis from Turkey by DNA Sequencing and Line Probe Assay. J. Clin. Microbiol.
40: 4435-4438
[Abstract]
[Full Text]
-
Qian, L., Abe, C., Lin, T.-P., Yu, M.-C., Cho, S.-N., Wang, S., Douglas, J. T.
(2002). rpoB Genotypes of Mycobacterium tuberculosis Beijing Family Isolates from East Asian Countries. J. Clin. Microbiol.
40: 1091-1094
[Abstract]
[Full Text]