Previous Article | Next Article 
Journal of Clinical Microbiology, September 2001, p. 3047-3051, Vol. 39, No. 9
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.9.3047-3051.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Rapid and Accurate Identification of
Coagulase-Negative Staphylococci by Real-Time PCR
K. J.
Edwards,1
M. E.
Kaufmann,2 and
N. A.
Saunders1,*
Molecular Biology Unit, Virus Reference
Division,1 and Laboratory of Hospital
Infection,2 Central Public Health
Laboratory, Colindale, London, NW9 5HT, United Kingdom
Received 9 April 2001/Returned for modification 30 May
2001/Accepted 8 July 2001
 |
ABSTRACT |
Biprobe identification assays based on real-time PCR were designed
for 15 species of coagulase-negative staphylococci (CNS). Three sets of
primers and four biprobes were designed from two variable regions of
the 16S rRNA gene. An identification scheme was developed based on the
pattern of melting peaks observed with the four biprobes that had been
tested on 24 type strains. This scheme was then tested on 100 previously identified clinical isolates and 42 blindly tested isolates.
For 125 of the 142 clinical isolates there was a perfect correlation
between the biprobe identification and the result of the ID 32 Staph
phenotypic tests and PCR. For 12 of the other isolates a 300-bp portion
of the 16S rRNA gene was sequenced to determine identity. The remaining
five isolates could not be fully identified. LightCycler real-time PCR
allowed rapid and accurate identification of the important CNS
implicated in infection.
 |
INTRODUCTION |
The genus Staphylococcus
currently includes 38 species (13), and coagulase-negative
staphylococci (CNS) are isolated frequently in clinical microbiology
laboratories (11, 12, 20). CNS are associated with the
normal skin flora and mucous membranes and can be isolated from many
other sources (including foodstuffs) such as meat, milk and cheese,
soil, sand, water, and air (12). CNS may cause bacteremia,
endocarditis, catheter-related infections, central nervous system shunt
infections, urinary tract infections, endophthalmitis, and infections
of prosthetic joints (9). CNS give rise to significant
hospital infections often associated with the use of medical devices
and immunocompromised patients (13).
With increasing numbers of CNS infections being recognized, it has
become necessary to have fast and reliable identification methods
(2, 11). Biochemical methods exist (2, 4, 10, 18), but none can reliably identify the important CNS because of
the variable expression of some phenotypic characters. Multilocus enzyme electrophoresis or analysis of cellular fatty acid composition have also been used, but identification remains incomplete
(21). Genotypic methods for identification have been
developed (5, 6,7, 15, 16, 23) but also have limitations.
For example, the individual PCRs designed by Gribaldo et al.
(6) to identify eight species of CNS are time-consuming
and expensive.
Real-time PCR and biprobe (3) assays have recently been
used to distinguish related bacterial species of, for example, the
genus Campylobacter (14). The aim of the
present study was to establish whether real-time PCR was suitable for
the identification of CNS involved in human infection.
The LightCycler (Bio/Gene Ltd., Kimbolton, England) is a real-time PCR
machine that allows both rapid PCR cycling and continuous monitoring of
product formation (24). The formation of double-stranded PCR products is detected by Sybr Green I. Sybr Green I is an
intercalating dye which fluoresces strongly when bound to
double-stranded DNA; thus, when PCR products are formed an increase in
fluorescence is observed (8, 19). After PCR amplification
the LightCycler can monitor melting of the DNA with increasing
temperature by measuring the decrease in fluorescence as Sybr Green I
is released. For convenience, the negative derivative of fluorescence
versus temperature is plotted to give a discrete melting peak. When the melting temperature of the PCR products is analyzed in this way, it is
not necessary to visualize the PCR products on agarose gels.
Sequence-specific detection of the amplicons can be
achieved by the addition of a short-labeled probe. When a probe is
included in the reaction, after the melt cycle two peaks can be
observed. One corresponds to a decrease in fluorescence due to the
melting of the PCR product, and the other is due to the release of the probe. Biprobes are sequence-specific probes labeled with the fluorophore Cy5. When the probe binds to the complementary sequence in
the PCR product, the Cy5 label is excited by the energy transfer from
Sybr Green I, resulting in an increase of light emitted by Cy5. This
fluorescence is measured at a different wavelength from that emitted by
Sybr Green I and so can be distinguished from it. Biprobes have another
useful feature: as well as hybridizing to a perfectly matched sequence,
they will also bind when there is some mismatch (usually up to five
mismatches). When the biprobe binds to a mismatched sequence, a melting
temperature lower than that of a perfectly matched sequence can be distinguished.
We designed different biprobes to bind to variable regions of the 16S
rRNA gene of staphylococci with various degrees of mismatch. We have
applied one to four probes to amplicons from 15 species of
staphylococci and confirmed melting peaks for a collection of 24 type
strains. Further, the identification results of 142 clinical isolates
determined by using the biprobes were compared with the results
obtained by biochemical and PCR identification.
 |
MATERIALS AND METHODS |
Bacterial strains, culture conditions, phenotypic tests, and
PCR.
Type strains used in the study are listed in Table
1 and were obtained from the National
Collection of Type Cultures (NCTC) (Central Public Health Laboratory,
London, United Kingdom). The 142 clinical isolates were selected from
those submitted for identification to the Laboratory of Hospital
Infection, Central Public Health Laboratory. All strains were grown
overnight on blood agar plates at 37°C. Colony suspensions of the
strains were made by suspending several colonies from one plate in 1 ml
of water, heating to 99°C for 5 min, and centrifuging at 3,000 × g for 2 min. The supernatant was then used in
LightCycler assays. Phenotypic identification of strains was made using
ID 32 Staph (bioMérieux) according to the manufacturer's
instructions (4). PCR identification was made using the
primers and conditions of Gribaldo et al. (6).
DNA extraction.
DNA was extracted from the type strains
using the Wizard Genomic DNA purification kit (Promega, Southampton,
United Kingdom) according to the manufacturer's instructions,
except that lysis was achieved by resuspending cells in 100 µl of
lysostaphin (1 mg/ml in Tris-EDTA [TE] buffer; Sigma) and 50 µl of
lysozyme (50 mg/ml in TE buffer; Sigma).
LightCycler primers and biprobes.
The sequences of all
primers and biprobes are shown in Table
2. All biprobes (3) were
labeled with Cy5 at the 5' end and with biotin at the 3' end to prevent
them from acting as primers. All primers and probes were synthesized by
MWG-Biotech UK Ltd. (Milton Keynes, England). CNS Probe A was used with
primers STAR1 (5 pmol/µl) and STAF1 (1 pmol/µl), CNS Probe B was
used with STAR1 (1 pmol/µl) and STAF2 (5 pmol/µl), CNS Probe C was
used with STBF1 (5 pmol/µl) and STBR1 (1 pmol/µl), and CNS Probe D
was used with primers STBF1 (1 pmol/µl) and STBR1 (5 pmol/µl).
LightCycler assays.
The LightCycler (Bio/Gene Ltd.) was used
for all biprobe assays. PCR mixtures (10 µl) contained 1 µl of
colony suspension or 10 ng of DNA, 500 mM Tris-HCl (pH 8.3),
MgCl2 (5 mM), bovine serum albumin (1 mg/ml), deoxynucleoside triphosphates (200 µM concentrations of each;
Gibco BRL), forward and reverse primers (one at 5 pmol/µl and the
other at 1 pmol/µl), platinum Taq polymerase (0.4 U; Gibco
BRL), Sybr Green I (Bio/Gene Ltd.) diluted 0.01%, and a biprobe (5 pmol/µl). The cycling parameters were one denaturation cycle at
94°C for 5 s and 40 amplification cycles (temperature transition
rate of 20°C/s) of 94°C for 0 s, 55°C for 1 s, 60°C for 15 s, and 74°C for 10 s. Fluorescence readings were
taken after annealing at 55°C for 1 s. PCR cycling was followed
by melting curve analysis of 40 to 95°C (temperature transition rate
of 0.2°C/s) with continuous fluorescence readings. For ease of
interpretation, controls for all of the peaks were run alongside the
samples being tested. For example, with CNS Probe A, three controls
were run, one for each of the three peaks. This allowed easy scoring of the results and corrected for slight variations in the melting temperatures which were observed from run to run.
DNA sequencing.
The primers Epsilon F
(AAGAGTTTGATCCTGGCTCAG) and 1510R
(GGTTACCTTGTTACGACTT) were used in a PCR to amplify a
1,500-bp amplicon of the 16S rRNA gene. The PCR mixtures (100 µl)
contained forward and reverse primers (20 pmol each), deoxynucleoside
triphosphates (200 µM concentrations of each), platinum
Taq polymerase (0.5 U), MgCl2 (3 mM),
1× PCR buffer (as supplied with platinum Taq polymerase),
and 5 µl of a colony suspension. The PCR was performed in a
Perkin-Elmer 9600 machine, and cycling consisted of 1 cycle of 95°C
for 5 min, 30 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C
for 1 min followed by final extension at 72°C for 5 min. The PCR
products were purified using the Wizard PCR Clean up kit (Promega) and
quantified by agarose gel electrophoresis. The PCR products were
sequenced according to the manufacturer's instructions for the ABI
prism sequencing kit (Perkin-Elmer) using the primers Epsilon F and
320R (TTGACCGTGTCTCAGTTCCA).
 |
RESULTS |
Biprobe and primer design.
The 16S rRNA gene sequences of 35 species of Staphylococcus, Stomatococcus
mucilaginosus, and Micrococcus luteus were
retrieved from the GenBank database. The sequences were aligned using
the Lasergene Dnastar computer package. Two variable regions
between bp 1 and 250 and between bp 970 and 1080 were identified as
being suitable for the design of biprobes. Four biprobes were designed, CNS Probe A and CNS Probe B from the region between bp 1 and 250 and
CNS Probe C and CNS Probe D from the region between bp 970 and 1080. CNS Probe A was designed to be a perfect match to Staphylococcus epidermidis, CNS Probe B was a perfect match to
Staphylococcus lugdunensis, CNS Probe C had no mismatches
with Staphylococcus warneri, Staphylococcus
sciuri, S. lugdunensis, Staphylococcus intermedius, and Staphylococcus schleiferi and CNS
Probe D was a perfect match with Staphylococcus capitis. All
other species had one or more mismatches with the probes. It was
predicted that for S. epidermidis it would be necessary to
use only one probe (CNS Probe A) to make an accurate
identification. Since S. epidermidis is the most
commonly found CNS in nosocomial infections the use of only one probe
would allow a fast and inexpensive identification. The probes were
all designed to have an annealing temperature at least 5°C higher
than that of the primers and were also predicted to have minimum
secondary structure that might prevent them from binding to the target sequence.
PCR primers were designed for use with the probes and were
checked with the computer program OLIGO. For CNS Probe A and CNS
Probe
B, three primers were designed: STAF1 and STAR1 for CNS
Probe A
and STAF2 and STAR1 for CNS Probe B. For CNS Probes C
and D two primers
were designed, STBF1 and STBR1. All primers
were designed to amplify an
approximately 100-bp amplicon, which
is the optimal size for use with a
biprobe and for optimal amplification
on the LightCycler. For ease of
use all of the primers were designed
to have an annealing temperature
of 55°C, thus allowing the same
cycling conditions to be used for all
four
PCRs.
Biprobe evaluation.
The four CNS biprobes were tested on DNA
extracted from the 15 type strains of staphylococcal species of
clinical interest. During the cycling step the temperature was held at
55°C to allow the primers to anneal. It was also found that for the
biprobe to anneal and hence fluoresce it was also necessary to hold the temperature at 60°C for 15 seconds. In addition, it was necessary to
reduce the concentration of the primer closest to the probe; otherwise,
the primer prevented the probe from binding.
After the melting step CNS Probe A gave three discrete melting peaks
(Fig.
1A). The first peak had a melting
temperature of
58°C (peak 0) and was seen with
S. epidermidis; the second peak
had a melting temperature of 52°C
(peak 1) and was seen with
S. warneri; and the third
peak melted at 50°C (peak 2) and was seen
with
S. sciuri,
S. lugdunensis,
S. aureus,
S. intermedius, and
S. chromogenes. Only 7 of the 15 type strains displayed a melting
peak with this probe and the remaining 8 gave a negative result.
The
second probe tested, CNS Probe B, displayed six discrete melting
peaks, designated 0 to 5 (Fig.
1B), melting at 64, 60, 56, 58,
53, and
52°C, respectively. CNS Probe B bound to and gave observable
melting
peaks with all 15 type strains and was found to be the
most
discriminatory of the four probes. CNS Probe C showed four
discrete
melting peaks (Fig.
1C) melting at 68, 60, 56, and 54°C,
respectively. As with CNS Probe B, each of the 15 type strains
showed a
melting peak with this probe. The final probe, CNS Probe
D, only
displayed two discrete melting peaks (Fig.
1D), and these
were observed
in only three of the type strains tested. Peak 0
had a melting
temperature of 60°C and was observed only with
S. capitis. Peak 1 was observed with
S. caprae and
S. epidermidis and had a melting temperature of 58°C.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
Biprobe peak profiles. (A) Peak profiles obtained with
biprobe A. Peak 0 melted at 58°C, peak 1 melted at 52°C, and peak 2 melted at 50°C. (B) Peak profiles obtained with biprobe B. Peak 0 melted at 64°C, peak 1 melted at 60°C, peak 2 melted at 56°C,
peak 3 melted at 58°C, peak 4 melted at 53°C, and peak 5 melted at
52°C. (C) Peak profiles obtained with biprobe C. Peak 0 melted at
68°C, peak 1 melted at 60°C, peak 2 melted at 56°C, and peak 3 melted at 54°C. (D) Peak profiles obtained with biprobe D. Peak 0 melted at 60°C, and peak 1 melted at 58°C.
|
|
Development of an identification scheme.
The four biprobes
were tested on 15 Staphylococcus species of interest,
namely, S. epidermidis, S. warneri,
S. lugdunensis, S. aureus,
S. intermedius, S. chromogenes,
S. sciuri, S. hominis, S. haemolyticus, S. capitis, S. caprae, S. schleiferi, S. simulans, S. saprophyticus, and S. cohnii. The results are shown in Table 3. Based on these results it was
concluded that CNS Probe A identified S. epidermidis
and S. warneri, and therefore it was not necessary to
use any of the other three probes for identification. CNS Probe B used
alone can identify S. lugdunensis and
S. haemolyticus, and the combination of CNS Probe A and
CNS Probe B allows identification of S. sciuri,
S. lugdunensis, S. aureus,
S. hominis, S. haemolyticus, and
S. cohnii. CNS Probe C in combination with Probes A and
B can be used to identify S. intermedius, S. chromogenes, S. schleiferi, and S. saprophyticus. The final probe, CNS Probe D, was designed to
distinguish S. capitis and S. caprae.
The four probes were also tested on nine other species of
staphylococci, namely,
S. kloosii,
S. arlettae,
S. lentus,
S. delphini,
S. equorum,
S. hyicus,
S. xylosus,
S. auricularis, and
S. gallinarum,
as well as
Stomatococcus mucilaginosus
and
Micrococcus luteus.
These strains were readily available
and were used to check for
any possible cross-reactions. Each of these
species gave a pattern
of reactions distinct from that of any of the
species required
to be identified (results not
shown).
Clinical isolate testing.
A total of 142 clinical isolates of
staphylococci were tested with all four CNS probes to determine whether
reactions observed with the type strains were consistent. Of the 142, 100 were tested as known isolates and 42 were tested as part of a blind
study. Where possible, at least 10 isolates of each species were
selected, but for six species only a few clinical isolates were
available, and for S. caprae none were obtainable. The
results are shown in Table 4. All of the
S. hominis, S. sciuri, S. cohnii, S. intermedius, and S. simulans strains showed complete agreement between biochemical identification and LightCycler identification. Four additional S. epidermidis isolates, one additional S. aureus isolate, and one additional S. saprophyticus isolate that were not identified by biochemical
tests were identified by real-time PCR.
Two of the
S. warneri isolates gave unknown profiles,
and so a variable region of the 16S rRNA gene was sequenced. Sequencing
results indicated that the most likely identification of one isolate
was
S. pasteuri, and the other isolate was identified
as a
Staphylococcus species. Three of the isolates
previously identified as
S. haemolyticus did not yield
the expected LightCycler pattern. One of these isolates
was identified
as
S. aureus, one as
S. epidermidis,
and the other
as an unknown strain by the LightCycler. The
S. aureus and
S. epidermidis
identifications were confirmed by DNA sequencing,
and sequencing
indicated that the likely identification of the
unknown isolate was
S. arlettae. One of the
S. schleiferi
isolates
was identified as
S. saprophyticus, and
another gave an unknown
profile. The
S. saprophyticus
identification was confirmed by
DNA sequencing, and the other isolate
was identified by sequencing
as
Acinetobacter lwoffii. Of
the 12
S. lugdunensis isolates tested,
one was
identified as
S. capitis and another gave an unknown
profile.
DNA sequencing identified the
S. capitis
strain as either
S. capitis or
S. caprae and the unknown strain as
Micrococcus luteus. Of
the 14
S. capitis isolates tested only 6 were correctly
identified,
5 being identified as
S. caprae and 3 being
identified as
S. epidermidis.
The three identified as
S. epidermidis were sequenced, and this
confirmed the
LightCycler identification. CNS Probe D is based
on the region of bp
1004 to 1025, within which at base 1011 the
type strain of
S. capitis has a T and
S. caprae has a
C. After
testing on the LightCycler, this region of the sequence was
examined
more closely and an alignment was formed using three sequences
of
S. capitis and three sequences of
S. caprae obtained from the
GenBank database. It was found that in
two of the three
S. capitis sequences a C was found at
position 1011 and not the T that the
probe was based on. It is
therefore not possible to distinguish
S. capitis from
S. caprae reliably using this probe. The 16S rRNA
gene sequences were examined for further differences, and
none
that would differentiate
S. capitis from
S. caprae could be
found.
 |
DISCUSSION |
We have described a rapid and accurate test for identification of
the main species of CNS of clinical interest, as well as S. aureus, S. intermedius, and S. schleiferi, which are or can be coagulase-positive species. It is
becoming increasingly important that reference laboratories identify
CNS accurately, particularly S. epidermidis
(11).
Of the 142 clinical isolates tested by the biprobe assays, 125 showed
concordance between the biprobe assay results and those of the
traditional PCR and phenotypic identification method. The 12 strains that did not correlate were further characterized by partial
sequencing of the 16S rRNA gene, and these results, except in the case
of the S. capitis strains, confirmed the biprobe assay result. There were five strains of S. capitis that were
identified by the biprobe assays as S. caprae, but
further examination of the 16S rRNA gene sequences indicated that it
was not possible to distinguish S. caprae from
S. capitis on the basis of 16S rRNA sequence. This has
been reported also by Takahashi et al. (22), who compared
16S rRNA gene sequences of 38 species of staphylococci, and by
Bannerman and Kloos (1), who carried out DNA-DNA
hybridization studies. It may be more convenient to report these
species as "S. capitis or S. caprae" or to use an alternative test to identify them.
Several methods are currently being used or have been evaluated to
identify CNS. The most common is the use of commercially available
biochemical tests that allow phenotypic identification, but these are
not always reliable and results are often operator dependent
(17). For example, phosphatase-negative variants of S. epidermidis can often be misidentified as
S. hominis (7, 13). The introduction of
molecular identification of CNS has improved the accuracy of results
and allows the identification of the more unusual CNS which
occasionally cause infection (6). Species-specific PCRs
can be used to replace the phenotypic tests or be used in conjunction
with them, but this can require the use of several primer sets, which
is time-consuming and expensive. Furthermore, primers are not available
for all of the species of CNS that can be implicated in infection.
Several genotypic tests are available for the identification of
S. epidermidis only (7, 16, 23), but with
increasing numbers of the other CNS being implicated in infection it is
necessary to have available a fuller range of identification tests.
The real-time PCR and biprobe approach to identifying staphylococci to
the species level has several advantages. LightCycler tests can be
completed in 30 to 40 min, and it is not necessary to open the tubes
after amplification. The risk of contamination is therefore reduced.
The assay requires easily prepared colony suspensions, and it is not
necessary to perform time-consuming DNA extractions. Only three PCRs
need to be performed to characterize up to 15 species of CNS. The
more widespread use of these assays is constrained by the initial
expense of the LightCycler, and only 32 samples can be included in one
run compared to 96 samples in most conventional PCR systems. With
future generations of real-time PCR machines having the capacity for
additional fluorescence channels, there will be the opportunity to
include more than one probe in each reaction, thus reducing the number
of PCRs required.
The biprobe assays proved to be accurate and robust, and by using a
series of control strains in each experiment the assays are easy to
interpret. The rapid identification of S. epidermidis using only one PCR and only one probe will significantly improve the
turnaround time for identification to the species level of the most
common CNS.
 |
ACKNOWLEDGMENT |
This work was partially funded by the Biotechnology and
Biological Sciences Research Council (BBSRC).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Molecular
Biology Unit, Virus Reference Division, Central Public Health
Laboratory, 61 Colindale Ave., Colindale, London, NW9 5HT, United
Kingdom. Phone: 020 8200 4400, ext. 3070. Fax: 020 8200 1569. E-mail:
nsaunders{at}phls.org.uk.
 |
REFERENCES |
| 1.
|
Bannerman, T. L., and W. E. Kloos.
1991.
Staphylococcus capitis subsp. ureolyticus subsp. nov. from human skin.
Int. J. Syst. Bacteriol.
41:144-147[Abstract/Free Full Text].
|
| 2.
|
Bannerman, T. L.,
K. T. Kleeman, and W. E. Kloos.
1993.
Evaluation of the Vitek Systems Gram-Positive Identification card for species identification of coagulase-negative staphylococci.
J. Clin. Microbiol.
31:1322-1325[Abstract/Free Full Text].
|
| 3.
| Bio/Gene Ltd. and The Secretary of State for Defense.
July 1999. Nucleic acid detection system. Great Britain patent
GB2333359A.
|
| 4.
|
Brun, Y.,
M. Bes,
J. M. Boeufgras,
D. Monget,
J. Fleurette,
R. Auckenthaler,
L. A. Devriese,
M. Kocur,
R. R. Marples, and Y. Piemont.
1990.
International collaborative evaluation of the ATB 32 staph gallery for identification of the Staphylococcus species.
Zentbl. Bakteriol.
273:319-326.
|
| 5.
|
Goh, S. H.,
S. Potter,
J. O. Wood,
S. M. Hemmingsen,
R. P. Reynolds, and A. W. Chow.
1996.
HSP60 gene sequences as universal targets for microbial species identification: studies with coagulase-negative staphylococci.
J. Clin. Microbiol.
34:818-823[Abstract].
|
| 6.
|
Gribaldo, S.,
B. Cookson,
N. Saunders,
R. Marples, and J. Stanley.
1997.
Rapid identification by specific PCR of coagulase-negative staphylococcal species important in hospital infection.
J. Med. Microbiol.
46:45-53[Abstract/Free Full Text].
|
| 7.
|
Hedin, G.
1994.
Comparison of genotypic and phenotypic methods for species identification of coagulase-negative staphylococcal isolates from blood cultures.
APMIS
102:855-864[Medline].
|
| 8.
|
Higuchi, R.,
C. Fockler,
G. Dollinger, and R. Watson.
1993.
Kinetic PCR analysis: real-time monitoring of DNA amplification reactions.
Bio/Technology
11:1026-1030[CrossRef][Medline].
|
| 9.
|
Huebner, J., and D. A. Goldmann.
1999.
Coagulase-negative staphylococci: role as pathogens.
Annu. Rev. Med.
50:223-236[CrossRef][Medline].
|
| 10.
|
Ieven, M.,
J. Verhoeven,
S. R. Pattyn, and H. Goossens.
1995.
Rapid and economical method for species identification of clinically significant coagulase-negative staphylococci.
J. Clin. Microbiol.
33:1060-1063[Abstract].
|
| 11.
|
Kleeman, K. T.,
T. L. Bannerman, and W. E. Kloos.
1993.
Species distribution of coagulase-negative staphylococcal isolates at a community hospital and implications for selection of staphylococcal identification procedures.
J. Clin. Microbiol.
31:1318-1321[Abstract/Free Full Text].
|
| 12.
|
Kloos, W. E.,
K. H. Schleifer, and F. Gotz.
1991.
The genus Staphylococci, p. 1369-1420.
In
A. Balows, H. G. Truper, M. Dworkin, W. Harder, and K. H. Schleifer (ed.), The prokaryotes. Springer-Verlag, New York, N.Y.
|
| 13.
|
Kloos, W. E., and T. L. Bannerman.
1994.
Update on clinical significance of coagulase-negative staphylococci.
Clin. Microbiol. Rev.
7:117-140[Abstract/Free Full Text].
|
| 14.
|
Logan, J. M. J.,
K. J. Edwards,
N. A. Saunders, and J. Stanley.
2001.
Rapid identification of Campylobacter spp. by melting peak analysis of biprobes in real-time PCR.
J. Clin. Microbiol.
39:2227-2232[Abstract/Free Full Text].
|
| 15.
|
Maes, N.,
Y. De Gheldre,
R. De Ryck,
M. Vaneechoutte,
H. Meugnier,
J. Etienne, and M. J. Struelens.
1997.
Rapid and accurate identification of Staphylococcus species by tRNA intergenic spacer length polymorphism analysis.
J. Clin. Microbiol.
35:2477-2481[Abstract].
|
| 16.
|
Martineau, F.,
F. J. Picard,
P. H. Roy,
M. Ouellette, and M. G. Bergeron.
1996.
Species-specific and ubiquitous DNA-based assays for rapid identification of Staphylococcus epidermidis.
J. Clin. Microbiol.
34:2888-2893[Abstract].
|
| 17.
|
Pfaller, M. A., and L. A. Herwaldt.
1988.
Laboratory, clinical, and epidemiological aspects of coagulase-negative staphylococci.
Clin. Microbiol. Rev.
1:281-299[Abstract/Free Full Text].
|
| 18.
|
Renneberg, J.,
K. Rieneck, and E. Gutschik.
1995.
Evaluation of Staph ID 32 system and Staph-Zym system for identification of coagulase-negative staphylococci.
J. Clin. Microbiol.
33:1150-1153[Abstract].
|
| 19.
|
Ririe, K. M.,
R. P. Rasmussen, and C. T. Wittwer.
1997.
Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.
Anal. Biochem.
245:154-160[CrossRef][Medline].
|
| 20.
|
Sewell, C. M.,
J. E. Clarridge,
E. J. Young, and R. K. Guthrie.
1982.
Clinical significance of coagulase-negative staphylococci.
J. Clin. Microbiol.
16:236-239[Abstract/Free Full Text].
|
| 21.
|
Stoakes, L.,
M. A. John,
R. Lannigan,
B. C. Schieven,
M. Ramos,
D. Harley, and Z. Hussain.
1994.
Gas-liquid chromatography of cellular fatty acids for identification of staphylococci.
J. Clin. Microbiol.
32:1908-1910[Abstract/Free Full Text].
|
| 22.
|
Takahashi, T.,
I. Satoh, and N. Kikuchi.
1999.
Phylogenetic relationships of 38 taxa of the genus Staphylococcus based on 16S rRNA gene sequence analysis.
Int. J. Syst. Bacteriol.
49:725-728[Abstract/Free Full Text].
|
| 23.
|
Wieser, M., and H. J. Busse.
2000.
Rapid identification of Staphylococcus epidermidis.
Int. J. Syst. Evol. Microbiol.
50:1087-1093[Abstract].
|
| 24.
|
Wittwer, C. T.,
M. G. Herrmann,
A. A. Moss, and R. P. Rasmussen.
1997.
Continuous fluorescence monitoring of rapid cycle DNA amplification.
BioTechniques
22:130-138[Medline].
|
Journal of Clinical Microbiology, September 2001, p. 3047-3051, Vol. 39, No. 9
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.9.3047-3051.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pinsky, B. A., Samson, D., Ghafghaichi, L., Baron, E. J., Banaei, N.
(2009). Comparison of Real-Time PCR and Conventional Biochemical Methods for Identification of Staphylococcus lugdunensis. J. Clin. Microbiol.
47: 3472-3477
[Abstract]
[Full Text]
-
Iwase, T., Seki, K., Shinji, H., Mizunoe, Y., Masuda, S.
(2007). Development of a real-time PCR assay for the detection and identification of Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri. J Med Microbiol
56: 1346-1349
[Abstract]
[Full Text]
-
Chiquet, C., Pechinot, A., Creuzot-Garcher, C., Benito, Y., Croize, J., Boisset, S., Romanet, J. P., Lina, G., Vandenesch, F., for the French Institutional Endophthalmitis Study,
(2007). Acute Postoperative Endophthalmitis Caused by Staphylococcus lugdunensis. J. Clin. Microbiol.
45: 1673-1678
[Abstract]
[Full Text]
-
Schabereiter-Gurtner, C., Selitsch, B., Rotter, M. L., Hirschl, A. M., Willinger, B.
(2007). Development of Novel Real-Time PCR Assays for Detection and Differentiation of Eleven Medically Important Aspergillus and Candida Species in Clinical Specimens. J. Clin. Microbiol.
45: 906-914
[Abstract]
[Full Text]
-
Skow, A., Mangold, K. A., Tajuddin, M., Huntington, A., Fritz, B., Thomson, R. B. Jr., Kaul, K. L.
(2005). Species-Level Identification of Staphylococcal Isolates by Real-Time PCR and Melt Curve Analysis. J. Clin. Microbiol.
43: 2876-2880
[Abstract]
[Full Text]
-
Heikens, E., Fleer, A., Paauw, A., Florijn, A., Fluit, A. C.
(2005). Comparison of Genotypic and Phenotypic Methods for Species-Level Identification of Clinical Isolates of Coagulase-Negative Staphylococci. J. Clin. Microbiol.
43: 2286-2290
[Abstract]
[Full Text]
-
Sakai, H., Procop, G. W., Kobayashi, N., Togawa, D., Wilson, D. A., Borden, L., Krebs, V., Bauer, T. W.
(2004). Simultaneous Detection of Staphylococcus aureus and Coagulase-Negative Staphylococci in Positive Blood Cultures by Real-Time PCR with Two Fluorescence Resonance Energy Transfer Probe Sets. J. Clin. Microbiol.
42: 5739-5744
[Abstract]
[Full Text]
-
McNeil, M. M., Brown, J. M., Carvalho, M. E., Hollis, D. G., Morey, R. E., Reller, L. B.
(2004). Molecular Epidemiologic Evaluation of Endocarditis Due to Oerskovia turbata and CDC Group A-3 Associated with Contaminated Homograft Valves. J. Clin. Microbiol.
42: 2495-2500
[Abstract]
[Full Text]