Previous Article | Next Article ![]()
Journal of Clinical Microbiology, September 2001, p. 3052-3055, Vol. 39, No. 9
Department of Medical Microbiology, Royal Free and
University College Medical School,1 and
Helicobacter Reference Unit, Central Public Health
Laboratory,2 London, and Institute of
Infections and Immunity, University of Nottingham,
Nottingham,4 United Kingdom, and
Unité de Pathogénie Bactérienne des
Muqueuses, Institut Pasteur, Paris, France3
Received 27 March 2001/Returned for modification 23 April
2001/Accepted 14 June 2001
Antimicrobial resistance in Helicobacter pylori is a
serious and increasing problem, and the development of rapid, reliable methods for detecting resistance would greatly improve the selection of
antibiotics used to treat gastric infection with this organism. We
assessed whether detection of the RdxA protein could provide the basis
for determining the susceptibility of H. pylori to
metronidazole. In order to raise polyclonal antisera to RdxA, we cloned
the rdxA gene from H. pylori strain 26695 into
the commercial expression vector pMAL-c2, purified the resultant fusion
protein by affinity chromatography, and used this recombinant RdxA
preparation to immunize rabbits. We then used this specific anti-RdxA
antibody to perform immunoblotting on whole bacterial cell lysates of
17 metronidazole-sensitive and 27 metronidazole-resistant clinical isolates of H. pylori. While a 24-kDa immunoreactive band
corresponding to the RdxA protein was observed in all
metronidazole-sensitive strains, this band was absent in 25 of 27 resistant isolates. Our results indicate that testing for the absence
of the RdxA protein would identify the majority of clinical isolates
that will respond poorly to metronidazole-containing eradication
regimens and have implications for the development of assays capable of detecting metronidazole resistance in H. pylori.
Helicobacter pylori is a
gram-negative, microaerobic, spiral bacterium that colonizes the
stomachs of approximately half the world's population
(7). Infection with H. pylori is associated with chronic gastritis and peptic ulceration, and the bacterium is also
considered a risk factor for the development of gastric adenocarcinoma
and mucosa-associated lymphoid tissue lymphoma (2, 25,
26). Modern triple-drug regimens are highly effective for
treating H. pylori infection, but bacterial resistance to the two most effective antibiotics, metronidazole and clarithromycin, is a serious and increasing problem. It has been estimated that 11 to
70% of clinical strains isolated in western Europe and the United
States are resistant to the 5-nitroimidazoles, and this prevalence is
far higher in developing countries and in certain immigrant populations
(7). Although there have been conflicting reports
concerning the clinical impact of metronidazole resistance in H. pylori, many studies have now demonstrated that resistance to this
class of antibiotics does reduce the efficacy of
metronidazole-containing eradication regimens and is therefore an
important predictor of treatment failure (3, 6, 11, 12, 15,
16). Several reports also suggest that the prevalence of
metronidazole resistance is rising and is likely to become an
increasingly important problem in the clinical management of H. pylori infection (23, 34).
Because H. pylori is slow growing, susceptibility testing by
culture-based methods is cumbersome and in practice rarely performed before empirical antibiotic treatment is commenced (24).
However, many centers are reassessing the importance of routine
susceptibility testing, appreciating that this will provide a far more
rational approach to the use of antibiotics. However, cost
implications, ease of access to noninvasive tests, and practical
problems, such as exist for the determination of metronidazole
resistance, mean that it is unlikely that routine testing for
antimicrobial susceptibility will be universally adopted. A rapid and
useful alternative is to identify resistance markers directly in
gastric biopsy specimens, and several tests have been developed to
detect the limited number of the point mutations within the
peptidyltransferase region of 23S rRNA that are associated with
macrolide resistance in this organism (27, 30, 33).
However, it has not been possible to develop similar genotype-based
tests for metronidazole, since resistance is associated with many
different alterations of the rdxA gene (which encodes an
oxygen-insensitive NADPH nitroreductase), including missense and
frameshift mutations and deletions and insertion of transposable
elements (5, 10, 14, 20, 29, 31). Furthermore, recent
reports have demonstrated that inactivation of other reductase-encoding
genes, including fdxB (which encodes ferredoxin-like
protein) and frxA (which encodes NADPH flavin oxidoreductase), are also associated with resistance to metronidazole (17-19). While the precise contribution of other
mechanisms to the resistant phenotype remains unclear, current evidence
suggests that secondary mutations in these genes result in transition
to high-level resistance once inactivation of rdxA has
occurred. Although the development of a simple assay capable of
detecting metronidazole resistance does not appear straightforward, it
would represent a major advance in the antibiotic management of
patients with H. pylori infection. We hypothesized that such
a system could be developed based on the detection of the RdxA protein
of H. pylori. Our strategy for detection of the RdxA protein
was to use immunoblotting with specific anti-RdxA antibody.
Bacteria and growth conditions.
Escherichia coli
strain TG1 (9) was grown at 37°C in L broth (10 g of
tryptone, 5 g of yeast extract, and 5 g of NaCl per liter, pH
7.0) or on L agar plates (1.5% agar) at 37°C. The antibiotic carbenicillin (100 µg/ml) was added as required.
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.9.3052-3055.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Differentiation of Metronidazole-Sensitive and -Resistant
Clinical Isolates of Helicobacter pylori by
Immunoblotting with Antisera to the RdxA Protein
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Susceptibility testing.
Susceptibility to metronidazole of
the isogenic strains and French and North African isolates was assessed
by agar dilution determination of the MIC. Susceptibility to
metronidazole of the United Kingdom strains was assessed by the E-test
(AB Biodisk, Solna, Sweden). For agar dilution, inoculates yielding
104 CFU/spot were inoculated onto plates of
IsoSensitest agar (Oxoid) enriched with 10% horse blood containing
doubling dilutions of metronidazole. The MIC was defined as the lowest
concentration of antibiotic inhibiting growth when the plates were read
after 72 h incubation under microaerobic conditions (generated as
described above) at 37°C. The E-test was performed according to the
manufacturer's instructions. Isolates were considered resistant to
metronidazole if the MIC was
8 µg/ml (36).
General molecular biology techniques and cloning of the rdxA gene. We used the alkaline lysis procedure (28) for small-scale and MIDI Qiagen (Crawley, United Kingdom) columns for large-scale plasmid preparation. Genomic DNA from individual H. pylori strains was extracted using the QIAamp tissue kit (Qiagen) according to the manufacturer's instructions. All DNA manipulations and analyses were performed using standard protocols (28).
The rdxA gene (HP0954) of strain 26695 (32) was amplified by PCR using the oligonucleotide primers HP0954-5 (GGAATTCTTTTTGGATCAAGAAAAAAGAAGACAA) and HP0954-6 (AAAACTGCAGTTTAAACAAAATGCCACTCCTTGA). The 695-bp PCR product was then electroeluted, purified, and restricted with EcoRI and PstI. Finally, the restricted fragment was ligated into EcoRI-PstI-restricted pMAL-c2 (a commercial expression vector available from New England Biolabs, Beverly, Mass.) and transformed into E. coli TG1.Expression and purification of recombinant RdxA fusion
protein.
Recombinant H. pylori RdxA protein was
expressed as a MalE-RdxA fusion (of 66 kDa) and purified as described
previously (8). Briefly, fresh 500-ml volumes of L broth,
containing carbenicillin (100 µg/ml) and 30% (wt/vol) glucose, were
inoculated with overnight cultures (5 ml) of strain TG1 harboring the
recombinant plasmid and incubated with shaking at 37°C. When the
optical density at 600 nm of the culture reached 0.5, isopropyl
-D-thiogalactopyranoside (IPTG) (final concentration, 1 mmol/liter) was added, and the cells were incubated for a further
4 h. Following induction with IPTG, the cells were harvested by
centrifugation (10,000 × g for 30 min at 4°C) and
resuspended in 25 ml of column buffer (200 mmol of NaCl, 1 mmol EDTA in
10 mmol Tris-HCl/liter [pH 7.4]) containing (per liter) the
following protease inhibitors (supplied by Boehringer, Mannheim,
Germany): 2 µmol of leupeptin, 2 µmol of pepstatin, and 1 µmol of
phenylmethylsulfonyl fluoride. The recombinant protein was purified
from E. coli cell extracts by affinity chromatography on
amylose columns. First, intact cells were lysed by passage through a
French pressure cell (16,000 lb/in2). Cell debris was
removed by centrifugation (20,000 × g for 20 min at
4°C), and the lysate was diluted in column buffer to give a final
concentration of 25 mg of protein per ml prior to loading on a column
(20 by 2.6 cm) of amylose resin (New England Biolabs). The resin was
washed with column buffer at 0.5 ml/min until the A280 returned to baseline levels. Finally, the
MalE-fused recombinant protein was eluted from the column by washing
with column buffer containing 10 mmol of maltose solution/liter.
Fractions containing the fusion proteins were pooled, dialyzed against
distilled water, and lyophilized. The fusion protein was resuspended in
distilled water at the final concentration of 1 mg of lyophilized
material/ml and stored at
20°C. The purity of the recombinant
protein preparation was controlled by the Bradford assay (Sigma
Chemicals) and SDS-PAGE analyses.
Generation of polyclonal rabbit antisera against RdxA.
Polyclonal antisera against recombinant MalE-RdxA was produced by
immunizing rabbits with 100 µg of purified recombinant protein in
Freund's complete adjuvant. Four weeks later, the rabbits were booster
immunized with 100 µg of protein in Freund's incomplete adjuvant. At
week 6, the animals were terminally bled and the sera were stored at
20°C.
Protein analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblotting. Two-day cultures of H. pylori were harvested, washed in sterile distilled water, and suspended in double-strength sample buffer (62.5 mmol of Tris base/liter [pH 6.8], 4.0% sodium dodecyl sulfate, 5.0% mercaptoethanol, 30% gycerol, 0.025% bromophenol blue), prior to solubilization by boiling for 5 min. Protein concentrations were estimated using a commercial version of the Bradford assay (Sigma Chemicals). Solubilized bacterial cell extracts, containing 20 µg of protein, were analyzed on slab gels, comprising a 4.5% acrylamide stacking gel and a 17.5% resolving gel, according to the procedure of Laemmli (21). Electrophoresis was performed at 200 V in a Mini-PROTEAN II electrophoresis cell (Bio-Rad Laboratories, Hemel Hempstead, United Kingdom). Molecular weight standards from Bio-Rad were run on each gel.
Proteins were transferred to nitrocellulose paper in a Mini Trans-Blot transfer cell (Bio-Rad) set at 0.8 mA/cm for 1 h, with cooling. Nitrocellulose membranes were blocked with 5% milk powder (Sigma Chemicals) and 1% Tween prepared in phosphate-buffered saline, with gentle shaking at room temperature for 2 h. Membranes were reacted at 4°C overnight with antisera that had been diluted 1:100 in 50% E. coli TG1 extract, 5% milk powder, and 0.2% Tween in phosphate-buffered saline and incubated for 4 h at room temperature to remove nonspecific antibodies to E. coli. Immunoreactants were detected with anti-rabbit peroxidase-linked immunoglobulin (Amersham, Little Chalfont, United Kingdom) diluted 1:10,000 and reaction products were visualized on autoradiographic film by chemiluminescence using the ECL Western blotting detection system (Amersham).| |
RESULTS |
|---|
|
|
|---|
Generation of polyclonal rabbit antisera against RdxA.
To
assess the specificity of the antisera we performed immunoblot analysis
of the MalE-RdxA fusion protein as well as whole-cell extracts of the
well-characterized, metronidazole-sensitive H. pylori
strains SS1, G27, and HAS-141. The antisera reacted strongly with the
MalE-RdxA fusion protein, and in H. pylori strains SS1, G27,
and HAS-141 a band of approximately 24 kDa (equivalent to the predicted
molecular mass of the RdxA protein of H. pylori [10]) was visualized (Fig.
1). In contrast, this 24-kDa band was
absent from solubilized protein preparations prepared from isogenic
H. pylori strains in which the rdxA gene had been
disrupted by mutagenesis (15) and which were resistant to
metronidazole (Fig. 1).
|
Immunoblotting of metronidazole-sensitive and -resistant strains of H. pylori with anti-RdxA antibody. To assess whether detection of the RdxA protein could provide the basis for determining the susceptibility of H. pylori to metronidazole, we used the specific anti-RdxA antibody to perform immunoblotting on whole bacterial cell lysates of 17 metronidazole-sensitive and 27 metronidazole-resistant clinical isolates of H. pylori. While a 24-kDa immunoreactive band corresponding to the RdxA protein was observed in all metronidazole-sensitive strains, this band was absent in 25 of 27 resistant isolates (Fig. 1). In some metronidazole-resistant strains a faint parasite band was observed at approximately 22 kDa. We were able to remove this in the majority of strains by preadsorption of the antisera with E. coli TG1 cells prior to immunoblotting.
| |
DISCUSSION |
|---|
|
|
|---|
The development of rapid, genotype-based tests to detect resistance to metronidazole in H. pylori has been hindered by the fact that resistance is associated with many different mutations within rdxA and possibly other reductase-encoding genes. Our results demonstrate a high correlation between production of the RdxA protein and susceptibility of H. pylori to metronidazole, confirming that the rdxA gene is inactivated in the vast majority of resistant isolates and that mutations in other genes are either rare or involved in transition to high-level resistance. We, and other groups, have demonstrated that resistant strains frequently contain frameshift mutations within their rdxA gene that result in the creation of a translational stop codon in the region immediately downstream of the mutation, and such strains would be predicted to produce a truncated RdxA protein. (10, 14, 20, 29, 31). A particularly important observation of this study was that production of the RdxA protein was completely abrogated in all but one of the resistant strains; none of the examined strains produced a truncated protein. We therefore conclude that in the majority of resistant strains, mutational inactivation of the rdxA gene prevents production of the protein or results in production of an abnormal polypeptide which is subsequently degraded. This suggests that testing for the absence of the RdxA protein would identify the majority of clinical isolates that will respond poorly to metronidazole-containing eradication regimens and has important implications for the development of assays capable of detecting metronidazole resistance in H. pylori. The advantage of using this approach is that it will identify all resistant strains that carry mutations affecting expression of the rdxA gene, including those that have not yet been identified by sequence analysis.
Although a small number of metronidazole-resistant strains of H. pylori have been reported in which the nucleotide sequence of the rdxA gene has been unchanged there has been no further analysis of these mutants to confirm whether they have decreased RdxA activity or synthesis (1, 14, 31, 35). We are now examining whether the RdxA enzymes produced by the two resistant strains are functionally inactive or whether other mechanisms are responsible for their resistant phenotype. We are also using a larger collection of strains to assess how common such isolates are in clinical practice. In addition, we plan to refine our approach to develop a rapid and simple test that will allow the detection of metronidazole resistance in H. pylori. Such an assay would represent an important advance in the clinical management of H. pylori infection, allowing a more rational approach to the use of this antibiotic.
| |
ACKNOWLEDGMENT |
|---|
P. J. Jenks is supported by an Advanced Fellowship for Medical, Dental, and Veterinary Graduates from the Wellcome Trust, United Kingdom (reference 061599).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Institute of Infections and Immunity, Floor C, West Block, University Hospital, Queen's Medical Centre, Nottingham NG7 2UH, United Kingdom. Phone: 44-115-9249924, ext. 42457. Fax: 44-115-9709923. E-mail: Peter.Jenks{at}nottingham.ac.uk.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Bilardi, C., A. Marais, F. Cantet, C. Birac, and F. Mégraud. 2000. Characterization of the rdxA and frxA genes in metronidazole resistant Helicobacter pylori strains. Gut 47(Suppl. 1):A2. |
| 2. | Blaser, M. J. 1993. Helicobacter pylori: microbiology of a `slow' bacterial infection. Trends Microbiol. 1:255-260[CrossRef][Medline]. |
| 3. | Buckley, M. J., H. X. Xia, D. M. Hyde, C. T. Keane, and C. A. O'Morain. 1997. Metronidazole resistance reduces efficacy of triple therapy and leads to secondary clarithromycin resistance. Dig. Dis. Sci. 42:2111-2115[CrossRef][Medline]. |
| 4. |
Covacci, A.,
S. Censini,
M. Bugnoli,
R. Petracca,
D. Burroni,
G. Macchia,
A. Massone,
E. Papini,
Z. Xiang,
N. Figura, and R. Rappuoli.
1993.
Molecular characterization of the 128-kDa immunodominant antigen of Helicobacter pylori associated with cytotoxicity and duodenal ulcer.
Proc. Natl. Acad. Sci. USA
90:5791-5795 |
| 5. |
Debets-Ossenkopp, Y. J.,
R. G. Pot,
D. J. van Westerloo,
A. Goodwin,
C. M. Vandenbroucke-Grauls,
D. E. Berg,
P. S. Hoffman, and J. G. Kusters.
1999.
Insertion of mini-IS605 and deletion of adjacent sequences in the nitroreductase (rdxA) gene cause metronidazole resistance in Helicobacter pylori NCTC11637.
Antimicrob. Agents Chemother.
43:2657-2662 |
| 6. | Dore, M. P., G. Leandro, G. Realdi, A. R. Sepuiveda, and D. Y. Graham. 2000. Effect of pretreatment antibiotic resistance to metronidazole and clarithromycin on outcome of Helicobacter pylori therapy: a meta-analytical approach. Dig. Dis. Sci. 45:68-76[CrossRef][Medline]. |
| 7. | Dunn, B. E., H. Cohen, and M. J. Blaser. 1997. Helicobacter pylori. Clin. Microbiol. Rev. 10:720-741[Abstract]. |
| 8. |
Ferrero, R. L.,
J. M. Thiberge,
M. Huerre, and A. Labigne.
1994.
Recombinant antigens prepared from urease subunits of Helicobacter spp.: evidence of protection in a mouse model of gastric infection.
Infect. Immun.
62:4981-4989 |
| 9. | Gibson, T. J. 1984. Studies on the Epstein-Barr virus genome. Ph.D. thesis. Cambridge University, Cambridge, England. |
| 10. | Goodwin, A., D. Kersulyte, G. Sisson, S. J. Veldhuyzen van Zanten, D. E. Berg, and P. S. Hoffman. 1998. Metronidazole resistance in Helicobacter pylori is due to null mutations in a gene (rdxA) that encodes an oxygen-insensitive NADPH nitroreductase. Mol. Microbiol. 28:383-393[CrossRef][Medline]. |
| 11. | Graham, D. Y. 1998. Antibiotic resistance in Helicobacter pylori: implications for therapy. Gastroenterology 115:1272-1277[CrossRef][Medline]. |
| 12. |
Houben, M. H.,
D. Van De Beek,
E. F. Hensen,
A. J. Craen,
E. A. J. Rauws, and G. N. Tytgat.
1999.
A systematic review of Helicobacter pylori eradication therapy the impact of antimicrobial resistance on eradication rates.
Aliment. Pharmacol. Ther.
13:1047-1055[CrossRef][Medline].
|
| 13. | Janvier, B., B. Grignon, C. Audibert, L. Pezennec, and J. L. Fauchère. 1999. Phenotypic changes of Helicobacter pylori components during an experimental infection in mice. FEMS Immunol. Med. Microbiol. 24:27-33[CrossRef][Medline]. |
| 14. |
Jenks, P. J.,
R. L. Ferrero, and A. Labigne.
1999.
The role of the rdxA gene in the evolution of metronidazole resistance in Helicobacter pylori.
J. Antimicrob. Chemother.
43:753-758 |
| 15. |
Jenks, P. J.,
R. L. Ferrero,
J. Tankovic,
J. M. Thiberge, and A. Labigne.
2000.
Evaluation of nitrofurantoin combination therapy of metronidazole-sensitive and-resistant Helicobacter pylori infections in mice.
Antimicrob. Agents Chemother.
44:2623-2629 |
| 16. |
Jenks, P. J.,
A. Labigne, and R. L. Ferrero.
1999.
Exposure to metronidazole in vivo readily induces resistance in Helicobacter pylori and reduces the efficacy of eradication therapy in mice.
Antimicrob. Agents Chemother.
43:777-781 |
| 17. |
Jeong, J. Y.,
A. K. Mukhopadhyay,
D. Dailidiene,
Y. Wang,
B. Velapatino,
R. H. Gilman,
A. J. Parkinson,
G. B. Nair,
B. C. Wong,
S. K. Lam,
R. Mistry,
I. Segal,
Y. Yuan,
H. Gao,
T. Alarcon,
M. Lopez-Bria,
Y. Ito,
D. Kersulyte,
H. K. Lee,
Y. Gong,
A. Goodwin,
P. S. Hoffman, and D. E. Berg.
2000.
Sequential inactivation of rdxA (HP0954) and frxA (HP0642) nitroreductase genes causes moderate and high-level metronidazole resistance in Helicobacter pylori.
J. Bacteriol.
182:5082-5090 |
| 18. |
Jeong, J. Y., and D. E. Berg.
2000.
Mouse-colonizing Helicobacter pylori SSI is unusually susceptible to metronidazole due to two complementary reductase activities.
Antimicrob. Agents Chemother.
44:3127-3132 |
| 19. |
Kwon, D. H.,
F. A. El-Zaatari,
M. Kato,
M. S. Osato,
R. Reddy,
Y. Yamaoka, and D. Y. Graham.
2000.
Analysis of rdxA and involvement of additional genes encoding NAD(P)H flavin oxidoreductase (FrxA) and ferredoxin-like protein (FdxB) in metronidazole resistance of Helicobacter pylori.
Antimicrob. Agents Chemother.
44:2133-2142 |
| 20. |
Kwon, D. H.,
J. A. Pena,
M. S. Osato,
J. G. Fox,
D. Y. Graham, and J. Verslovic.
2000.
Frameshift mutations in rdxA and metronidazole resistance in North American Helicobacter pylori isolates.
J. Antimicrob. Chemother.
46:793-796 |
| 21. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[CrossRef][Medline]. |
| 22. | Lee, A., J. O'Rourke, M. C. De Ungria, B. Robertson, G. Daskalopoulos, and M. F. Dixon. 1997. A standardized mouse model of Helicobacter pylori infection: introducing the Sydney strain. Gastroenterology 112:1386-1397[CrossRef][Medline]. |
| 23. |
Lopez-Brea, M.,
D. Domingo,
I. Sanchez, and T. Alarcon.
1997.
Evolution of resistance to metronidazole and clarithromycin in Helicobacter pylori clinical isolates from Spain.
J. Antimicrob. Chemother.
40:279-281 |
| 24. | Olafsson, S., and A. Berstad. 1999. Therapy and diagnostic tests used for Helicobacter pylori infection in the Scandinavian countries in 1998. Scand. J. Gastroenterol. 34:849-855[CrossRef][Medline]. |
| 25. | Parsonnet, J., G. D. Friedman, D. P. Vandersteed, Y. Chang, J. H. Vogelman, N. Orentreich, and R. K. Sibley. 1991. Helicobacter pylori infection and the risk of gastric carcinoma. N. Engl. J. Med. 325:1127-1129[Abstract]. |
| 26. |
Parsonnet, J.,
S. Hansen,
L. Rodriguez,
A. B. Gelb,
R. A. Warnke,
E. Jellum,
N. Orentreich,
J. H. Vogelman, and G. D. Friedman.
1994.
Helicobacter pylori infection and gastric lymphoma.
N. Engl. J. Med.
330:1267-1271 |
| 27. |
Pina, M.,
A. Occhialini,
L. Monteiro,
H. P. Doermann, and F. Mégraud.
1998.
Detection of point mutations associated with resistance of Helicobacter pylori to clarithromycin by hybridization in liquid phase.
J. Clin. Microbiol.
36:3285-3290 |
| 28. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 29. |
Solcà, N. M.,
M. V. Bernasconi, and J. C. Piffaretti.
2000.
Mechanism of metronidazole resistance in Helicobacter pylori: comparison of the rdxA gene sequences in 30 strains.
Antimicrob. Agents Chemother.
44:2207-2210 |
| 30. | Stone, G. G., D. Shortridge, J. Versalovic, J. Beyer, R. K. Flamm, D. Y. Graham, A. T. Ghoneim, and S. K. Tanaka. 1997. A PCR-oligonucleotide ligation assay to determine the prevalence of 23S rRNA gene mutations in clarithromycin-resistant Helicobacter pylori. Antimicrob. Agents Chemother. 41:712-714[Abstract]. |
| 31. |
Tankovic, J.,
D. Lamarque,
J. C. Delchier,
C. J. Soussy,
A. Labigne, and P. J. Jenks.
2000.
Frequent association between alteration of the rdxA gene and metronidazole resistance in French and North African isolates of Helicobacter pylori.
Antimicrob. Agents Chemother.
44:608-613 |
| 32. | Tomb, J. F., O. White, A. R. Kervalage, R. A. Clayton, G. G. Sutton, R. D. Fleischmann, K. A. Ketchum, H. P. Klenk, S. Gill, B. A. Dougherty, K. Nelson, J. Quackenbush, L. Zhou, E. F. Kirkness, S. Peterson, B. Loftus, D. Richardson, R. Dodson, H. G. Khalak, A. Glodek, K. McKenney, L. M. Fitzegerald, N. Lee, M. D. Adams, E. K. Hickey, D. E. Berg, J. D. Gocayne, T. R. Utterback, J. D. Peterson, J. M. Kelley, M. D. Cotton, J. M. Weidman, C. Fujii, C. Bowman, L. Watthey, E. Wallin, W. S. Hayes, M. Borodovsky, P. D. Karp, H. O. Smith, C. M. Fraser, and J. C. Ventor. 1997. The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388:539-547[CrossRef][Medline]. |
| 33. |
Trebesius, K.,
K. Panthel,
S. Strobel,
K. Vogt,
G. Faller,
T. Kirchner,
M. Kist,
J. Heesemann, and R. Haas.
2000.
Rapid and specific detection of Helicobacter pylori macrolide resistance in gastric tissue by fluorescent in situ hybridisation.
Gut
46:608-614 |
| 34. | van der Wouden, E. J., A. A. van Zwet, G. D. Vosmaer, J. A. Oom, A. de Jong, and J. H. Kleibeuker. 1997. Rapid increase in the prevalence of metronidazole-resistant Helicobacter pylori in the Netherlands. Emerg. Infect. Dis. 3:385-389[Medline]. |
| 35. |
Wang, G.,
T. J. Wilson,
Q. Jiang, and D. E. Taylor.
2001.
Spontaneous mutations that confer antibiotic resistance in Helicobacter pylori.
Antimicrob. Agents Chemother.
45:727-733 |
| 36. | Working Party of the European Helicobacter pylori Study Group. 1997. Guidelines for clinical trials in Helicobacter pylori infection. Gut 41(Suppl. 2):S1-S23. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»