INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

In humans, Shiga toxin (or verocytotoxin)-producing Escherichia coli (STEC) are associated with sporadic cases and outbreaks of watery diarrhea, hemorrhagic colitis (HC), and hemolytic-uremic syndrome (HUS) (9, 17). Shiga toxins (Stx) are the major pathogenicity factors of STEC and are responsible for the principal manifestations of HC and HUS (9, 17). Genes located in the genome of temperate bacteriophages encode two distinct Stx. The Stx1 and Stx2 toxins possess similar biological activities, including cytotoxicity to Vero and HeLa cells, but are immunologically distinct. Both toxins are composed of an enzymatically active A subunit and a pentameric B subunit (9, 17). The B subunits form a hollow ring and mediate binding to functional receptors. The toxin molecules are then internalized, and the A subunit is able to inhibit the peptide chain elongation during protein synthesis, leading to eukaryotic cell death (9, 17).

Several Stx2 subtypes have been identified on the basis of sequence homology and immunological cross-reactivity. Variations in the Stx2 amino acid sequence have a direct impact on the capacity of a given STEC to cause disease in mice, suggesting that variations may result in Shiga-like toxins with different properties (13). To date, at least 11 different Stx2 subtypes produced by STEC strains from patients with HUS, abdominal cramps, sudden infant death syndrome, or diarrhea and from animals with diarrhea or edema disease have been described (6, 7, 13-16, 18, 22, 26).

Several other virulence factors involved in the pathogenicity of STEC have been described. The intimin encoded by the eae gene located in the chromosomal locus of enterocyte effacement is involved in the intimate attachment of bacteria to enterocytes (23). However, some STEC involved in severe disease do not contain the genetic information encoding intimin. Plasmid-encoded virulence factors are also probably involved in the pathogenicity of STEC (9). Among them, enterohemolysin (Ehx) acts as a pore-forming cytolysin on eukaryotic cells (21), the EspP extracellular serine protease can cleave human coagulation factor V (3), and the EAST1 enterotoxin may contribute to the pathogenesis of watery diarrhea often observed during the early stages of STEC infections (20).

Stx-producing E. coli strains involved in food-borne infections have been studied extensively (9, 17). Human infections are usually a consequence of the consumption of contaminated bovine meat (17). However, although Stx-producing strains are frequently found in the fecal flora of healthy cattle, little is known about the virulence factors of bovine STEC. Recently, a 1-year survey has been undertaken by Pradel et al. to determine the frequency of STEC isolated from the intestinal tract of healthy cows at the city slaughterhouse (19). In this report, the bovine STEC included in Pradel's collection were screened to analyze the frequency of Stx2 subtypes and the putative combination with other virulence genes associated with STEC involved in human infections. The cytotoxity of Stx-producing strains was analyzed according to the Stx2 subtype, and a new Stx2 variant untypeable by the different protocols tested was characterized.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Bacterial strains. The 185 STEC strains used in this study are part of a well-characterized bacterial collection obtained during a 1-year prospective study in the same geographic area (19). Bacterial strains isolated from fecal samples from healthy cattle were found to be positive for the presence of stx₂ (n = 104), stx₁ (n = 18), or stx₁ and stx₂ (n = 63) by PCR and Southern hybridization (19).

Stx2 subtyping by PCR and RFLP-PCR. A restriction fragment length polymorphism (RFLP)-PCR system using the VT2c-VT2d primer pair was used to discriminate the genes coding for the Stx2, Stx2vh-a, and Stx2vh-b subtypes (25). Restriction patterns were obtained after digestion of the amplified products by HaeIII, RsaI, and NciI restriction endonucleases (25). The PCR method described by Piérard et al. used the VT2cm-VT2f primer pair to amplify a 256-bp DNA fragment specific to the Stx2d group (Stx2d-Ount, Stx2d-OX3a, and Stx2d-O111) (18). Genotypic detection of the Stx2e variant was performed by amplification of a 230-bp DNA fragment using the VTe-a-VTe-b primer pair described previously (8). Genetic detection of the EAST1 toxin was performed by PCR using primers east1-1a and east1-1b, able to amplify a specific 111-bp DNA fragment (27).

Detection of espP by colony blot hybridization. A DNA probe amplified using primers espP-A (CACACGGAGCTTATAATATTCTGTCA) and espP-B (AATGTTATCCCATTGACATCATTTGACT) (3) from reference strain EDL933 was used in colony blot hybridization for detection of the espP gene. The probe (1,830 bp) was purified and radiolabeled with [-³²P]dCTP using the random-primed DNA labeling kit (Boehringer-Mannheim, France) according to the manufacturer's instructions. Colony blot hybridization was performed as previously described (19).

Nucleotide sequencing. The operon coding for the untypeable Stx2 toxin of E. coli NV206 was amplified using two oligonucleotide primers located downstream and upstream of the genes encoding the A and B subunits, respectively (15). The amplified product (approximately 1,500 bp) was purified by using the Prep-A-Gene purification system (Bio-Rad). The nucleotide sequence was determined with double-stranded DNA by the dideoxy chain termination method using a model 373A automatic DNA sequencer (Applied Biosystem Inc.).

Nucleotide sequence accession number. The nucleotide sequence of the Stx2 toxin of E. coli NV206 (Stx2-NV206) has been submitted to the GenBank database under accession number AF329817.

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Subtyping of Stx2 toxins. To data, at least 11 Stx2 subtypes have been described (Table 1). For better comprehension, the Stx2 subtype produced by reference strain EDL933 is named Stx2-EDL933 in this report, and some of the Stx2 subtypes are named according to the O serogroup of the reference E. coli strains (O113, O48, OX3, and O111) (Table 1). Genotypic methods were used for the Stx2 subtyping of 167 bovine STEC strains positive for stx₂ (n = 104) or stx₂ and stx₁ (n = 63) (Fig. 1). Results are summarized in Table 2.

View larger version (20K): [in this window] [in a new window]   FIG. 1.   Subtyping of Stx2 subtypes by RFLP-PCR. (A) Schematic representation of the restriction patterns obtained with the RFLP-PCR method developed by Tyler et al. (25). (B) Predicted sizes of the amplified products obtained with the VT2c and VT2d oligonucleotide primers and restricted with HaeIII, RsaI, and NciI endonuclease. The method developed to screen the Stx2vh-a subtype should also detect Stx2c and Stx2-OX3b because the nucleotide sequences of primers and sites of the restriction endonucleases used in the RFLP-PCR method were conserved among Stx2vh-a, Stx2c, and Stx2-OX3b genes. Similarly, the protocol used to discriminate Stx2-EDL933 should also detect Stx2-O48. The nucleotide sequence of Stx2-O113 is not available in the databases.

Sequence of stx₂ operon of strain NV206. Strain NV206 (serotype O6:H10) is one of the 23 bovine E. coli strains which was found to be negative for stx₂d and stx₂e and untypeable by RFLP-PCR (Table 2). The stx₂ operon of E. coli NV206 (stx₂-NV206) was amplified, and the nucleotide sequence was determined. The operon contained two open reading frames (ORFs) of 957 and 267 bp, encoding two polypeptides of 319 amino acids (A subunit) and 89 amino acids (B subunit), respectively. Nucleotide sequence comparison of the stx₂-NV206 operon with the corresponding ORFs of the eleven Stx2 subtypes described above revealed 94.5 to 99% identity for the A subunit gene and 81.5 to 96% identity for the B subunit gene. At the amino acid level, Stx2-NV206 showed 94 to 99% identity for the A subunit and 87 to 98% identity for the B subunit. Interestingly, the two amino acid residues Ser-291 and Glu-297 of the A subunit of both Stx2vh-a and Stx2vh-b subtypes were conserved at the same position on the Stx2-NV206 A subunit. Melton-Celsa et al. suggest that these two amino acids are involved in the activation of the toxin by mouse or human intestinal mucus (12).

Association of different Stx2 subtypes with Stx1 and other virulence factors. The association of the different stx₂ subtypes with the stx₁ gene was analyzed among the 63 strains of the collection positive for both stx₂ and stx₁. Results are summarized in Table 2. The Stx1-encoding gene was prominent among STEC strains that possessed Stx2-EDL933 alone (61%) or both Stx2-EDL933 and Stx2vh-b (55%). The stx₁ gene was also detected among 48, 30, 16.5, and 13% of the STEC strains that possessed the genes coding for Stx2vh-b, Stx2vh-a, Stx2vh-a/Stx2vh-b, and Stx2-NV206, respectively. Interestingly, except for the bovine isolates with both Stx2-EDL933 and Stx2vh-b, stx₁ was more frequently detected among STEC possessing only one Stx2 subtype.

Verocytotoxicity of bacterial strains with different Stx2 subtypes. The culture supernatants of the STEC strains included here have previously been tested for cytotoxicity on Vero cells (19). On the basis of two independent experiments, the strains were classified into three groups: not cytotoxic for Vero cells (titer 2), moderately cytotoxic (titer from 4 to 32), and highly cytotoxic (titer 64) (19). A significant association between a high cytotoxic activity and the presence of the stx₂ gene has been described (P < 0.001) (19). Therefore, only the high cytotoxic activity of STEC was taken into account in the analysis of a putative correlation between the cytotoxicity of the isolates and the Stx2 subtype produced. Strains positive for stx₂ (n = 104) and positive for both stx₂ and stx₁ (n = 63) were analyzed (Table3). In addition, analysis of the cytotoxic potency of the 18 stx₁-positive strains was also included in this report.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Stx-producing E. coli are mostly transmitted to humans through food contaminated by animal fecal material (9, 17). However, animals do not develop HC or HUS. Furthermore, not all the STEC present in the intestinal tract of cattle are involved in human infections. Because of the lack of suitable animal models that mimic all of the aspects of human diseases caused by STEC, it is difficult to identify the bacterial factors involved. However, it is well documented that STEC strains vary in their capacity to cause serious disease in humans, and this is associated with the type and/or amount of Stx produced (9, 17). Therefore, the type of Stx toxin and/or the Stx2 subtypes produced by STEC isolated from human infections has been extensively studied (6, 22). In contrast, little is known about Stx2 subtype frequency and the combination of virulence factors expressed by STEC from the intestinal tract of healthy cattle.

Considering that bovines are the principal reservoir of STEC potentially pathogenic for humans, a bacterial collection has been constituted from the feces of healthy cows at the city slaughterhouse of Clermont-Ferrand in central France (19). Analysis of the bacterial collection showed that STEC were isolated from 34% of the healthy cows and that 90% of the isolates harbored the Stx2-encoding gene (19). In this report, Stx2 subtyping was undertaken among 167 STEC strains isolated from bovine feces. The Stx2 subtype (renamed Stx2-EDL933 in this study) considered to be the Stx2 prototype for O157:H7 STEC associated with HUS was prominent among the strains isolated from healthy cows. E. coli strains harboring Stx2vh-a- or Stx2vh-b-encoding genes were also frequently detected. Furthermore, the Stx2-EDL933-Stx2vh-b combination was the most frequent among STEC possessing more than one Stx2 subtype. The Stx2d group, including Stx2d-Ount, Stx2d-O111, and Stx2d-OX3a subtypes, was infrequently detected among the bovine isolates included in this report. Recently, a high proportion of strains possessing the Stx2d variant have been isolated from fecal specimens of human asymptomatic carriers (24). In contrast, STEC associated with HUS never showed the Stx2d variants, suggesting that the Stx2d-producing strains might be less pathogenic for humans (14, 15, 18).

Interestingly, a new Stx2 subtype named Stx2-NV206 that is untypeable by Tyler's RFLP-PCR method was detected among 14.5% of the bovine strains studied. In a previous study, the same genotypic method was used to screen STEC isolated from human and meat samples (18). The authors detected 15 isolates (6% of the bacterial collection) possessing an Stx2 toxin referred to as an atypical Stx2vh variant because restriction of amplicons did not correspond to predicted patterns (18). Unfortunately, the restriction pattern of the atypical Stx2 subtype was not described (18), and therefore could not be compared with that of Stx2-NV206.

Among STEC isolated from patients with HUS, both Stx1 and Stx2 toxins are commonly detected, and a few strains produced Stx1 and two distinct Stx2 variants (9, 17). However, Stx2 was 1,000 times more cytotoxic than Stx1 towards human renal endothelial cells, and STEC producing Stx2 are more commonly associated with serious diseases than isolates producing Stx1 or Stx1 and Stx2 (9, 11, 17). In this report, 38% of the STEC were positive for both stx₁ and stx₂ and 9% of the isolates possessed the genetic information encoding Stx1 and two distinct Stx2 subtypes. Furthermore, a combination of three Stx2 subtypes (Stx2-EDL933/Stx2vh-b/Sx2d or Stx2vh-a/Stx2vh-b/Sx2d) were also detected simultaneously among the bovine E. coli tested. To our knowledge, this is the first report of STEC strains of animal origin that possess a combination of three distinct Stx2 variants. The extent to which multiple stx genes in a given STEC isolate can modulate the level of virulence is unknown. However, it is conceivable that strains possessing a combination of three stx genes are more virulent than those harboring only one or two stx genes, assuming that all three genes are expressed.

Mouse and human intestinal mucus is able to activate Stx2vh-a and Stx2vh-b toxins but not Stx2-EDL933 or Stx2c (12). E. coli B2F1, producing both Stx2vh-a and Stx2vh-b, is highly virulent in an orally infected streptomycin-treated mouse model and becomes more cytotoxic for Vero cells after incubation with mouse or human intestinal mucus (10, 12). Two amino acid residues, Ser and Glu at positions 291 and 297, respectively, of the mature A subunit, are probably involved in activation of the toxin (12). Interestingly, these two amino acid residues, potentially important for activation, were conserved at the same position on the A subunit of Stx2-NV206. Ser-291 and Glu-297 were also conserved on the A subunit of Stx2e, Stx2d-Ount, Stx2d-O111, and Stx2d-OX3a but not among Stx2-EDL933, Stx2-O113, Stx2-O48, or Stx2c. Melton-Celsa et al. suggest that synthesis of an activatable toxin results in an Stx2-producing strain that is more virulent and/or compensates for the absence of additional virulence factors (12).

Although intimin is an essential virulence factor for STEC belonging to serogroups O26, O103, O111, and O157, eae-negative STEC strains belonging to serogroup O91, O104, or O113 have been isolated during cases of HUS and HC (9, 17). Therefore, the pathogenicity for humans of eae-negative STEC from healthy cows could not be excluded. The finding of few eae-positive STEC in the bovine bacterial collection (5%) (19) was in agreement with results obtained from similar European studies (1, 2, 28). Among the 167 STEC included in this study, 12 isolates belonging to the O113:H21 serotype were eae negative (19) and espP positive, and possessed the gene encoding Stx2vh-a and/or Stx2vh-b (results not shown). Recently, Paton et al. described eae-lacking STEC strains belonging to the O113:H21 serotype which were associated with a cluster of cases of HUS (16). Taking into account the fact that STEC are mostly transmitted to humans through food contaminated by animal fecal material, the O113:H21 strains isolated from healthy cattle appeared potentially pathogenic for humans. As suggested for the human STEC strain B2F1, also negative for eae, the presence of Stx2vh-a and/or Stx2vh-b subtypes activatable by human intestinal mucus might compensate for the lack of genetic information coding for attaching and effacing lesion (12).

The ehxA enterohemolysin gene is highly conserved among STEC associated with human diseases (particularly in O157:H7 E. coli strains), suggesting that Ehx is under strong selective pressure and is implicated in STEC survival (1, 17). Furthermore, Gyles et al. demonstrate that ehxA is highly present among STEC belonging to serotypes commonly associated with disease in humans (1, 5). In this report, ehxA was prominent among STEC harboring stx2-EDL933 alone or stx2-EDL933 in association with stx2vh-b (78 and 85% of the strains, respectively), demonstrating that the presence of hlxA was also correlated with the Stx2 subtype. In addition, a close association of genes encoding Stx1, Ehx, and EspP was emphasized among stx₂-positive strains harboring the gene encoding Stx2-EDL933 alone, Stx2vh-b alone, or a combination of the two subtypes. In contrast, the EAST1 enterotoxin was infrequently detected and seemed to be more associated with the stx₁-positive strains of this collection.

In summary, Stx2 subtyping analysis of STEC isolated from healthy cows emphasized the predominance of Stx2-EDL933 and/or Stx2vh-b toxins and their association with other putative virulence factors such as Stx1, Ehx, and EspP (but not EAST1). For the first time, the combination of three distinct stx₂ subtypes was described, and the new Stx2-NV206 subtype was characterized.