Previous Article | Next Article 
Journal of Clinical Microbiology, September 2001, p. 3115-3121, Vol. 39, No. 9
Department of Microbiology, Kitasato University School of
Medicine, 1-15-1 Kitasato, Sagamihara, Kanagawa
228-8555,1 and Laboratory of Drug
Resistance in Bacteria, Gunma University School of Medicine,
3-39-22 Showamachi, Maebashi, Gunma 371-8511,2
Japan
Received 29 January 2001/Returned for modification 31 March
2001/Accepted 15 June 2001
A multiple-primer PCR was used to identify genes encoding
aminoglycoside-modifying enzymes in 381 clinical isolates of
methicillin-resistant Staphylococcus aureus (MRSA). The
technique used three sets of primers delineating specific DNA fragments
of the aph(3')-III, ant(4')-I, and
aac(6')-aph(2") genes, which influence the MICs of
gentamicin, tobramycin, and lividomycin. Isolates with none of the
three genes detected were susceptible to all three agents. Isolates
with the aph(3')-III gene showed resistance to lividomycin (MIC > 1,024 µg/ml), and those with the ant(4')-I
gene were resistant to tobramycin (MIC Enzymatic modification of
aminoglycosides is a common mechanism of resistance to these
antibiotics shown by clinical bacterial isolates. Among
gram-positive cocci such as staphylococci, streptococci, and
enterococci, five kinds of aminoglycoside-modifying enzymes (AME)
occur: aminoglycoside-6-O-nucleotidyltransferase I
[ANT(6)-I] (21),
aminoglycoside-9-O-nucleotidyltransferase I [ANT(9)-I] (16),
aminoglycoside-3'-O-phosphoryltransferase III
[APH(3')-III] (7),
aminoglycoside-4'-O-phosphoryltransferase
I [ANT(4')-I] (14) and
aminoglycoside-6'-N-acetyltransferase/2"-O-phosphoryltransferase [AAC(6')/APH(2")] (6, 24). APH(3')-III,
ANT(4')-I, and AAC(6')/APH(2") are of particular significance
because they modify aminoglycosides of therapeutic importance,
including kanamycin, tobramycin, and gentamicin, respectively. These
modifying enzymes can be plasmid or chromosome encoded and often are
encoded on transposable elements (3).
Methicillin-resistant Staphylococcus aureus (MRSA) is a
major cause of nosocomial infection (10), and these
bacteria have acquired multiple resistance to a wide range of
antibiotics including aminoglycosides (9, 10, 37). AME
produced by MRSA isolates can be determined by identifying the
corresponding genes. Susceptibility profiles to selected
aminoglycosides previously have been used to detect specific
aminoglycoside resistance mechanisms. However, characterizing strains
containing several AME genes solely on the basis of aminoglycoside
resistance profiles can be difficult, since one resistance profile is
often partially duplicated thereby masking the presence of an
additional profile. DNA hybridization and PCR amplification are
sensitive and specific methods for the detection of genes including
those encoding AME (34, 36, 38). However, such special
techniques and the necessary equipment are not practical for the
routine clinical laboratory, unlike conventional susceptibility tests.
In the present study, we compared aminoglycoside resistance profiles to
PCR data to determine whether susceptibility tests could reproducibly
detect specific AME in MRSA. We then used the results to study the
epidemiology of AME in Japanese MRSA isolates.
Bacterial strains and plasmids.
The reference strains used
in this study were three transductants, pMS18, pMS91, and pMS555. Each
of these was transduced by S2 phage in S. aureus MS353. The
pMS18 transductant is known to carry two genes, ant(6)-I and
aph(3')-III; the pMS91 transductant is known to carry three
genes, ant(6)-I, aph(3')-III, and
aac(6')-aph(2"); and the pMS555 transductant carries one
gene, ant(4')-I (27).
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.9.3115-3121.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Identification of Aminoglycoside-Modifying Enzymes by
Susceptibility Testing: Epidemiology of Methicillin-Resistant
Staphylococcus aureus in Japan
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
8 µg/ml). Isolates
with only the aac(6')-aph(2") gene were resistant to
gentamicin (MIC 8 µg/ml) and tobramycin in decreasing order;
those with both the ant(4')-I and
aac(6')-aph(2") genes also were resistant to gentamicin and
tobramycin, but in increasing order. Susceptibility testing, then,
could detect specific genes. In 381 Japanese MRSA isolates, the
ant(4')-I, aac(6')-aph(2"), and aph(3')-III
genes were prevalent in 84.5, 61.7, and 8.9%, respectively. Isolates
with only the ant(4')-I gene had coagulase type II or III,
but isolates with both the ant(4')-I and
aac(6')-aph(2") genes included all coagulase types. Most
isolates with coagulase type IV or VII carried the
aac(6')-aph(2") gene. Of the MRSA isolates with
ant(4')-I and/or aac(6')-aph(2") genes, 97%
were resistant to aminoglycosides in clinical use, but a new
aminoglycoside, arbekacin, had excellent activity against these isolates.
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Antibiotics and chemicals. Reference samples of various aminoglycosides and other antimicrobial agents of known potency were kindly supplied as powders by the manufactures, as follows: kanamycin, streptomycin, and arbekacin were from Meiji Seika Kaisha, Tokyo, Japan; gentamicin was from Schering-Plough Japan, Osaka, Japan; and tobramycin was from Shionogi Pharmaceutical, Osaka, Japan. Lividomycin was obtained commercially (Sigma).
Determination of MICs. MICs were determined by the twofold agar dilution method in Sensitivity Disk Agar N (Nissui, Tokyo, Japan). The bacteria were grown overnight in Sensitivity Test broth (Nissui) at 35°C. The culture was diluted to a final concentration of 106 CFU/ml with buffered saline containing gelatin. The bacterial suspensions were delivered by an inoculator (Sakuma Seisaku, Tokyo, Japan) with an inoculum size of 104 CFU/spot on agar plates. Inoculated plates were incubated for 18 h at 35°C. The MIC was defined as the lowest concentration of the compound that prevented visible growth.
DNA isolation. Each strain was subcultured overnight at 35°C on brain heart infusion agar (Nissui). Bacteria grown on plates were suspended in 100 µl of lysing solution (20 mM Tris-HCl, 140 mM NaCl, 5 mM EDTA [pH 8.0]) containing 250 µg of lysostaphin (Sigma) and incubated at 37°C for 30 min. After the suspensions were cooled on ice, 200 µl of distilled water was added to each, and they were heated at 65°C for 5 min. Subsequently, phenol-chloroform extraction and ethanol precipitation were performed as described by Okamoto et al. (20). The pellet was dried briefly in a vacuum desiccator and dissolved in 100 µl of distilled water. A 10-µl volume of a 1:10 dilution of the total DNA solution was used for PCR.
PCR experiments. Heat-stable Taq polymerase, the four deoxynucleoside triphosphates, and PCR buffer were purchased from Takara Shuzo (Otsu, Japan). As primers for PCR (see below), 20-mer oligonucleotides were used; these were purchased from Takara Shuzo. Cell lysates as processed above (10 µl) were added to a PCR mixture containing each primer at 0.1 µM, 10 µL of a 10-fold concentrate of PCR buffer, deoxynucleoside triphosphates (each at 200 µM), and 2.5 U of Taq polymerase in a final volume of 90 µl of distilled water. To prevent evaporation, 2 drops of mineral oil (Sigma) was added to each mixture.
A thermal cycler (Perkin-Elmer Cetus, Emeryville, Calif.) was used for amplification of DNA. The cycling program included 30 cycles of a denaturing step at 94°C for 1 min, an annealing step at 57°C for 2 min, and an extension step at 72°C for 30 s. Then 5-µl volumes of the samples were taken for analysis by electrophoresis on 2% agarose gels (FMC BioProducts, Rockland, Maine) in Tris-borate-EDTA buffer. The PCR products were detected by ethidium bromide staining under UV illumination.Design of primers for PCR. Three sets of primers were designed to detect the three different genes encoding AME in a single test. All primer sequences were chosen from a site within the nucleotide sequence of the AME gene region known to be specific for an enzyme. The primers for detection of the aph(3')-III gene were based on the nucleotide sequences reported by Gray and Fitch (7). The 5' primer was CGATGTGGATTGCGAAAACT; the 3' primer was CACCGAAATAACTAGAACCC. Primers for detection of the aac(6')-aph(2") gene were based on the nucleotide sequences reported by Ferretti et al. (6) and Rouch et al. (24). The 5' primer was CATTATACAGAGCCTTGGGA; the 3' primer was AGGTTCTCGTTATTCCCGTA. Primers for detection of the ant(4')-I gene were based on the nucleotide sequences reported by Matsumura et al. (14). The 5' primer was ATGGCTCTCTTGGTCGTCAG; the 3' primer was TAAGCACACGTTCCTGGCTG. The primers did not interact with one another or with genes encoding other AME.
Coagulase typing. Coagulase types were discerned by inactivation of coagulase activity type-specific antisera (33). The specific antisera and normal rabbit plasma for coagulase typing were purchased from Denka Seiken (Tokyo, Japan). Clinical isolates were grown overnight in 5 ml of brain heart infusion agar at 35°C. After a 30-min centrifugation at 1,600 × g 0.1 ml of supernatant was aliquotted into each of nine tubes. Type-specific antiserum (0.1 ml) or control serum was added to each tube, and the mixtures were incubated at 37°C for 1 h. Finally, 0.2 ml of normal rabbit plasma was added to all tubes. Coagulase types were determined by inhibition of clotting after incubation at 37°C for 1 to 48 h.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Primer specificity.
An agarose gel separation of DNA fragments
amplified from total DNA isolated from reference strains is shown in
Fig. 1. The primers for the
aph(3')-III gene yielded a fragment of 175 bp. This DNA
fragment was amplified from total DNA isolated from S. aureus MS353(pMS18) and S. aureus MS353(pMS91). The
primers for the aac(6')-aph(2") gene yielded a fragment of
279 bp. This DNA fragment was amplified only from total DNA isolated
from MS353(pMS91). The primers for the ant(4')-I gene
yielded a fragment of 367 bp. This DNA fragment was amplified only from
total DNA isolated from S. aureus MS353(pMS555). Then
different primers for the three genes were mixed and used to test the
specificity of these primers with mixed DNA isolated from
MS353(pMS18), MS353(pMS91), and MS353(pMS555). As expected, three
different sizes of amplified DNA, of 175, 279, and 367 bp, were
detected. These results indicated that the PCR products following
amplification and the aminoglycoside resistance profiles were in
correct agreement. Therefore, the specificity of the primers selected
for this study was confirmed, as well as the specificity and
sensitivity of the method for detection of these three genes encoding
AME.
|
X174 HaeIII
digest); 2, S. aureus MS353(pMS18); 3, S. aureus
MS353(pMS91); 4, S. aureus MS353(pMS555); 5, S. aureus MS353 as a negative control.
PCR identification of genes encoding AME in clinical isolates.
The genes encoding AME were subjected to PCR amplification and to
agarose gel electrophoresis. The frequencies of the genes encoding AME
detected by PCR are shown in Fig. 2 for
the 381 isolates. PCR products were amplified from 375 of the 381 isolates but not from the remaining 6 isolates (1.6%). The
ant(4')-I gene was encountered most frequently (84.5%), and
59.6% of isolates carried this gene in combination with one or both of
the others. The aph(3')-III and aac(6')-aph(2")
genes were present in 8.9 and 61.7% of isolates, respectively. The
most frequent combination of genes was ant(4')-I with
aac(6')-aph(2") (48%). The aph(3')-III gene was
present in combination with either the aac(6')-aph(2") gene
or the ant(4')-I gene in 4.7 and 0.8% of isolates
respectively. The triple combination of aph(3')-III,
ant(4')-I, and aac(6')-aph(2") was present in 1.6% of
isolates.
|
Correlation of aminoglycoside susceptibilities and the presence of
AME genes.
The MICs of three aminoglycosides, gentamicin,
tobramycin, and lividomycin, for the 381 isolates characterized above
by PCR are shown in Table 1. All 235 isolates with the aac(6')-aph(2") gene were resistant to
gentamicin (8 µg/ml), and most of them were also resistant to
tobramycin (8 µg/ml). A total of 322 isolates with the
ant(4')-I gene were highly resistant to tobramycin (128 µg/ml); 34 isolates with the aph(3')-III gene were highly
resistant to lividomycin (1,024 µg/ml); and 6 isolates with none of
the three genes were susceptible to gentamicin (
1 µg/ml),
tobramycin (1 µg/ml), and lividomycin (8 µg/ml).
|
1,024 µg/ml); on the other hand, the isolates with the
ant(4')-I gene but without the aph(3')-III gene
were only mildly resistant to lividomycin (8 to 128 µg/ml). The
tobramycin resistance in MRSA isolates was subjected to the genes
carrying ant(4')-I and aac(6')-aph(2"). However,
from the determination of the MIC of tobramycin, it was difficult to
identify these genes in tobramycin-resistant isolates.
Relationship between the MICs of gentamicin and tobramycin in MRSA
isolates with the aac(6')-aph(2") gene.
As mentioned
above, although all 235 isolates with the aac(6')-aph(2")
gene were resistant to gentamicin, it has not been clarified in
susceptibility tests using a kind of aminoglycoside whether they also
contained the ant(4')-I gene. However, determining whether
the aac(6')-aph(2") gene was combined with the
ant(4')-I gene required a comparison of the MICs of
gentamicin and tobramycin (Fig. 3). For
most isolates (45 of 46) with the aac(6')-aph(2") gene and
without the ant(4')-I gene, the MIC of gentamicin was higher
than that of tobramycin. All 189 isolates with both the ant(4')-I and aac(6')-aph(2") genes were
resistant to tobramycin and gentamicin, but for these bacteria the MIC
of tobramycin was either higher than or equivalent to that of
gentamicin. Using the above results, susceptibility tests for
lividomycin, tobramycin, and gentamicin could reproducibly detect
specific AME in MRSA.
|
Coagulase typing and AME. The coagulase types of 350 of the 381 tested strains were successfully determined using specific antisera against eight different types of coagulase in S. aureus. Type II predominated (83.7% of 381 isolates). In contrast, the isolates with coagulase type III, IV, VII, or I were infrequent (3.7, 2.4, 1.3, and 0.8%, respectively). The coagulase types of 31 isolates were indistinguishable.
The relationship between coagulase type and genes encoding AME in MRSA isolates was examined (Table 2). Isolates with only the ant(4')-I gene were of coagulase type II or III but not type I, IV, or VII. The isolates carrying the both ant(4')-I and aac(6')-aph(2") included all coagulase types. The results showed that isolates with the aac(6')-aph(2") gene were more frequent among isolates with coagulase type I, IV, or VII than among those with type II or III.
|
Drug resistance and AME.
The relationship between genes
encoding AME and aminoglycoside resistance in MRSA isolates was
examined (Table 3). The interpretive categories of gentamicin, tobramycin, and kanamycin resistance were
recommended by National Committee for Clinical Laboratory Standards
(NCCLS), and their cutoff MIC were 8, 8, and 32 µg/ml, respectively
(18). For other aminoglycosides, such as streptomycin, lividomycin, and arbekacin, the interpretive categories were not listed
in the NCCLS publication. Therefore, their interpretive categories were
provisionally established as follows: streptomycin, 32 µg/ml;
lividomycin, 256 µg/ml; and arbekacin, 8 µg/ml. The MRSA isolates
with at least one of three genes were resistant to kanamycin. Of 381 isolates, 54 (14.2%) were resistant to streptomycin. All 34 isolates
with the aph(3')-III gene were resistant to streptomycin, whereas only 5.8% of the isolates without this gene were resistant to
streptomycin. Twenty-four isolates (6.3%) were resistant to arbekacin,
and they were found only in isolates with the
aac(6')-aph(2") gene and showed high resistance (512
µg/ml) to gentamicin (data not shown).
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Beginning in the late 1970s and continuing for the last 20 years, MRSA have been isolated in connection with outbreaks of nosocomial infection in many countries around the world (2, 13). In 1982 and 1983, MRSA began to increase in prevalence throughout Japan (10). MRSA typically are resistant to various antimicrobial agents such as penicillins, cephalosporins, macrolides, aminoglycosides, tetracyclines, and fluoroquinolones (9). Because of this multidrug resistance and tendency to spread in hospital populations, MRSA have a special clinical significance, requiring epidemiologic monitoring as a measure for control of nosocomial infection. Conventional methods commonly used in the clinical laboratory for typing of S. aureus, including phage typing (22), coagulase typing (33), and antibiotyping (19), often prove useless as epidemiologic tools since of most MRSA isolated in Japan have nonsensitivity to phage production of type II coagulase and resistance to many kinds of antibiotics (9, 10). In contrast to conventional methods of MRSA typing, genetic analyses such as pulsed field gel electrophoresis (23), the DNA hybridization techniques (15, 28), and the PCR technique (35) are sensitive and versatile tools. Vanhoof et al. (36) have reported that defining the genetic determinants of AME by PCR was useful for epidemiologic surveillance of MRSA. In the present work, a relationship was found between the PCR detection of genes encoding AME and aminoglycoside resistance patterns in clinically isolated MRSA; the distribution of AME, coagulase types, and antibiotic susceptibility patterns was studied in MRSA isolated from 30 hospitals widely distributed throughout Japan.
The PCR technique used three sets of primers delineating specific DNA
fragments, aph(3')-III, ant(4')-I, and
aac(6')-aph(2"), defined as detecting and identificating AME
genes in reference strains. PCR was performed in 381 clinical isolates
to identify AME genes. The 34 isolates with the aph(3')-III
gene showed high resistance to lividomycin (1,024 µg/ml), which has
been reported to be a specific substrate of the enzyme APH(3')-III
(26). Therefore, APH(3')-III production was determined by
testing the susceptibility of strains to lividomycin. In this study,
ANT(4')-I-producing strains showed low resistance to lividomycin (8 to
128 µg/ml). Although it has not been reported that lividomycin was
inactivated by ANT(4')-I, this result suggested that it was inactivated
only weakly by this enzyme. All isolates carrying the
aac(6')-aph(2") gene were resistant to gentamicin (8
µg/ml); therefore, it was possible to detect AAC(6')/APH(2")
production by susceptibility testing with gentamicin. However, since
most aminoglycosides are substrates of this enzyme, the additional
production of ANT(4')-I is difficult to identify on the basis of
antibiotic resistance patterns. Interestingly, the PCR results were
almost always related to the MICs of gentamicin and tobramycin. In most
isolates (45 of 46) with the aac(6')-aph(2") gene but
without the ant(4')-I gene, the MIC of gentamicin was higher
than that of tobramycin; in the isolates with both the
aac(6')-aph(2") and ant(4')-I genes, the MIC of
tobramycin was higher than or similar to that of gentamicin (Fig. 3).
Ubukata et al. (30) have reported that AAC(6')/APH(2") inactivates gentamicin more effectively than it inactivates tobramycin, and our results are compatible with and explained by this observation. Only 1 of the 235 isolates with the aac(6')-aph(2") gene was
exceptional in that the relationship between the PCR result and
susceptibility testing did not show the same tendency. The reason for
the discrepancy between PCR and MIC in this strain is not clear; it is
possible that a mutation of the aac(6')-aph(2") gene is
incriminated in the change of substrate specificity. We should almost
always be able to determine AME production in clinical isolates of MRSA by testing their susceptibility to lividomycin, gentamicin, and tobramycin, because the agreement between this method and the PCR
method was 99.7% (380 of 381). Therefore, we recommend the use of this
method in clinical laboratories in the epidemiologic study of MRSA.
The frequencies of genes encoding AME was studied in 381 Japanese isolates. The ant(4')-I, aac(6')-aph(2"), and aph(3')-III genes were evident in 84.5, 61.7, and 8.9% of isolates, respectively. One of the reasons why the ant(4')-I gene is the most frequent is that it adjoins the mecA gene (5, 31). In contrast, isolates with coagulase type I, IV, or VII did not carry the ant(4')-I gene as frequently as did those with coagulase type II (Table 2). These results suggested that mec DNA regions differed between coagulase types and were compatible with other observations (M. Kurazono and T. Ida, unpublished data). AAC(6')/APH(2") has been the enzyme most frequently found among MRSA isolated in Europe (25, 36). In contrast, gentamicin-resistant MRSA carrying the aac(6')-aph(2") gene were encountered less frequently among isolates from Japan. The aac(6')-aph(2") gene is encoded by transposon Tn4001 or Tn4001-like elements (11, 12, 24), and those have been detected in large plasmids in S. aureus (1, 29). The gentamicin resistance plasmids in S. aureus vary in conjugational transfer and have been isolated from different geographic areas (17). The reasons for the prevalence of the AAC(6')/APH(2") enzyme in Japan may be more closely related to the spread of isolates with coagulase type II than to gentamicin resistance plasmids being conjugative or nonconjugative. The isolates carrying the aph(3')-III gene were not frequent among isolates from Japan. In 27 of 34 isolates with the aph(3')-III gene, this gene was combined with the aac(6')-aph(2") gene and/or the ant(4')-I gene. Since AAC(6')/APH(2") and ANT(4')-I are capable of inactivation for kanamycin, the aph(3')-III gene does not appear to be necessary for these isolates. However, all isolates with the aph(3')-III gene showed resistance to streptomycin, which is inactivated only by ANT(6)-I. The aph(3')-III and ant(6)-I genes are carried on transposon Tn3854 on the staphylococcal plasmid and chromosome (32). For these isolates, it may be more important to produce ANT(6)-I rather than APH(3')-III.
Most isolates in this study produced ANT(4')-I and/or AAC(6')/APH(2") and were resistant to aminoglycosides used in clinical therapy. However, arbekacin, a derivative of dibekacin, showed excellent antibacterial activity against tobramycin- and gentamicin-resistant MRSA (Table 3) (8, 9), because arbekacin is modified very little by ANT(4')-I and/or AAC(6')/APH(2") (30). In Japan, arbekacin has been approved for clinical use in MRSA infection since 1990, and no increase in the prevalence of arbekacin-resistant MRSA has been reported (4); nonetheless, a nosocomial infection caused by arbekacin-resistant MRSA has been reported at one hospital (9). Therefore, clinical laboratories should monitor the spread of arbekacin-resistant MRSA and the genes encoding AME. The susceptibility-based technique we describe and recommend here should facilitate the detection and characterization of AME.
| |
ACKNOWLEDGMENTS |
|---|
We thank the Working Group for collecting isolates of MRSA. We also thank Toshiko Hashizume and Mizuyo Kurazono for technical assistance.
This study was supported in part by the All Kitasato Project Study, Kitasato University, and the Working Group for MRSA cooperated by Meiji Seika Kaisha, Ltd., Tokyo, Japan.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, Kitasato University School of Medicine, 1-15-1 Kitasato, Sagamihara, Kanagawa 228-8555, Japan. Phone: 81-42-778-9355. Fax: 81-42-778-9350. E-mail: matsu{at}kitasato-u.ac.jp.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. | Archer, G. L., D. R. Dietrick, and J. L. Johnston. 1985. Molecular epidemiology of transmissible gentamicin resistance among coagulase-negative staphylococci in a cardiac surgery unit. J. Infect. Dis. 151:243-251[Medline]. |
| 2. | Ayliffe, G. A. 1997. The progressive intercontinental spread of methicillin-resistant Sthapylococcus aureus. Clin. Infect. Dis. 24:74-79. |
| 3. | Brown, N. M., and D. S. Reeves. 1992. Mechanisms and epidemiology of aminoglycoside resistance. J. Med. Microbiol. 36:11-14. |
| 4. | Deguchi, K., Y. Suzuki, R. Ishihara, Y. Ishii, and A. Nakazawa. 1997. Antimicrobial activities of arbekacin against methiillin-resistant Staphylococcus aureus. Jpn. J. Antibiot. 50:1-11[Medline]. |
| 5. |
Dubin, D. T.,
P. R. Matthews,
S. G. Chikramane, and P. R. Stewart.
1991.
Physical mapping of the mec region of an American methicillin-resistant Staphylococcus aureus strain.
Antimicrob. Agents Chemother.
35:1661-1665 |
| 6. |
Ferretti, J. J.,
K. S. Gilmore, and P. Courvalin.
1986.
Nucleotide sequence analysis of the gene specifying the bifunctional 6'-aminoglycoside acetyltransferase 2"-aminoglycoside phosphotransferase enzyme in Streptococcus faecalis and identification and cloning of gene regions specifying the two activities.
J. Bacteriol.
167:631-638 |
| 7. | Gray, G. S., and W. M. Fitch. 1984. Evolution of antibiotic resistance genes: the DNA sequence of a kanamycin resistance gene from Staphylococcus aureus. Mol. Biol. Evol. 1:57-66[Abstract]. |
| 8. |
Hamilton-Miller, J. M. T., and S. Shah.
1995.
Activity of semi-synthetic kanamycin B derivative, arbekacin against methicillin-resistant Staphylococcus aureus.
J. Antimicrob. Chemother.
35:865-868 |
| 9. | Inoue, M., M. Nonoyama, R. Okamoto, and T. Ida. 1994. Antimicrobial activity of arbekacin, a new aminoglycoside antibiotic, against methicillin-resistance Staphylococcus aureus. Drugs Exp. Clin. Res. 20:233-240[Medline]. |
| 10. | Konno, M. 1995. Nosocomial infections caused by methicillin-resistant Staphylococcus aureus in Japan. J. Infect. Chemother. 1:30-39[CrossRef]. |
| 11. | Lyon, B. R., J. W. May, and R. A. Skurray. 1984. Tn4001: a gentamicin and kanamycin resistance transposon in Staphylococcus aureus. Mol. Gen. Genet. 193:554-556[CrossRef][Medline]. |
| 12. |
Lyon, B. R.,
M. T. Gillespie,
M. E. Byrne,
J. W. May, and R. A. Skurray.
1987.
Plasmid-mediated resistance to gentamicin in S. aureus: the involvement of a transposon.
J. Med. Microbiol.
23:101-110 |
| 13. | Maple, P. A., J. M. Hamilton-Miller, and W. Brumfitt. 1989. World-wide antibiotic resistance in methicillin-resistant Sthapylococcus aureus. Lancet i:537-540. |
| 14. |
Matsumura, M.,
Y. Katakura,
T. Imanaka, and S. Aiba.
1984.
Enzymatic and nucleotide sequence studies of a kanamycin-inactivating enzyme encoded by a plasmid from thermophilic bacilli in comparison with that encoded by plasmid pUB110.
J. Bacteriol.
160:413-420 |
| 15. | Meugnier, H., M. P. Fernandez, M. Bes, Y. Brun, N. Bornstein, J. Freney, and J. Fleurette. 1993. rRNA gene restriction patterns as an epidemiological marker in nosocomial outbreaks of Stahpylococcus aureus infections. Res. Microbiol. 144:25-33[Medline]. |
| 16. | Murphy, E. 1985. Nucleotide sequence of a spectinomycin adenyltransfrase AAD(9) determinant from Staphylococcus aureus and its relationship to AAD(3")(9). Mol. Gen. Genet. 200:33-39[CrossRef][Medline]. |
| 17. | Murphy, E. 1989. Transposable elements in gram-positive bacteria, p. 269-288. In D. E. Berg, and M. M. Howe (ed.), Mobile DNA. ASM Press, Washington, D.C. |
| 18. | National Committee for Clinical Laboratory Standards. 2000. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 5th ed. Approved standard M7-A5. National Committee for Clinical Laboratory Standards, Wayne, Pa. |
| 19. | Noble, W. C., and S. A. Howell. 1995. Labile antibiotic resistance in Staphylococcus aureus. J. Hosp. Infect. 31:135-141[CrossRef][Medline]. |
| 20. |
Okamoto, R.,
T. Okubo, and M. Inoue.
1996.
Detection of genes regulating  -lactamase production in Enterococcus faecalis and Staphylococcus aureus.
Antimicrob. Agents Chemother.
40:2550-2554[Abstract].
|
| 21. | Ounissi, H., and P. Courvalin. 1987. Appendix B. Nucleotide sequences of streptococcal genes, p. 275. In J. J. Ferretti, and R. Curtiss III (ed.), Streptococcal genetics. American Society for Microbiology, Washington, D.C. |
| 22. | Parker, M. T. 1983. The significance of phage-typing patterns in Staphylococcus aureus, p. 33-62. In C. S. F. Easmon, and C. Adlam (ed.), Staphylococci and staphylococcal infections, vol. 1. Academic Press, Ltd., London, United Kingdom. |
| 23. | Prevost, G., B. Pottecher, M. Dahlet, M. Bientz, J. M. Mantz, and Y. Piemont. 1991. Pulsed-field gel electrophoresis as a new epidemiological tool for monitoring methicillin-resistant Staphylococcus aureus in an intensive care unit. J. Hosp. Infect. 17:255-269[CrossRef][Medline]. |
| 24. |
Rouch, D. A.,
M. E. Byrne,
Y. C. Kong, and R. A. Skurray.
1987.
The aacA-aphD gentamicin and kanamycin resistance determinant of Tn4001 from Staphylococcus aureus: expression and nucleotide sequence analysis.
J. Gen. Microbiol.
133:3039-3052 |
| 25. |
Schmitz, F. J.,
A. C. Fluit,
M. G. Gondolf,
R. Beyrau,
E. Lindenlauf,
J. Verhoef,
H. P. Heinz, and M. E. Jones.
1999.
The prevalence of aminoglycoside resistance and corresponding resistance genes in clinical isolates of staphylococci from 19 European hospitals.
J. Antimicrob. Chemother.
43:253-259 |
| 26. |
Shaw, K. J.,
P. N. Rather,
R. S. Hare, and G. H. Miller.
1993.
Molecular genetics of aminoglycoside resistance genes and familial relationships of the aminoglycoside-modifying enzymes.
Microbiol. Rev.
57:138-163 |
| 27. | Suzuki, T., K. Fujita, Y. Nagamachi, and T. Okubo. 1994. Emergence of arbekacin resistant strains among methicillin-resistant Sthapylococcus aureus. Jpn. J. Antibiot. 47:634-639[Medline]. |
| 28. |
Tenover, F. C.,
R. Arbeit,
G. Archer,
J. Biddle,
S. Byrne,
R. Goering,
G. Hancock,
G. A. Hebert,
B. Hill,
R. Hoollis,
W. R. Jarvis,
B. Kreiswirth,
W. Eisner,
J. Maslow,
L. K. McDougal,
J. M. Miller,
M. Mulligan, and M. A. Pfaller.
1994.
Comparison of traditional and molecular methods of typing isolates of Staphylococcus aureus.
J. Clin. Microbiol.
32:407-415 |
| 29. |
Townsend, D. E.,
N. Ashdown,
L. C. Greed, and W. B. Grubb.
1984.
Analysis of plasmids mediating gentamicin resistance in methicillin-resistant Staphylococcus aureus.
J. Antimicrob. Chemother.
13:347-352 |
| 30. |
Ubukata, K.,
N. Yamashita,
A. Gotoh, and M. Konno.
1984.
Purification and characterization of aminoglycoside-modifying enzymes from Staphylococcus aureus and Staphylococcus epidermidis.
Antimicrob. Agents Chemother.
25:754-759 |
| 31. |
Ubukata, K.,
R. Nonoguchi,
M. Matsuhashi,
M. D. Song, and M. Konno.
1989.
Restriction maps of the regions coding for methicillin and tobramycin resistances in chromosomal DNA in methicillin-resistant staphylococci.
Antimicrob. Agents Chemother.
33:1624-1626 |
| 32. |
Udo, E. E., and W. B. Grubb.
1991.
Transposition of genes encoding kanamycin, neomycin and streptomycin resistance in Staphylococcus aureus.
J. Antimicrob. Chemother.
27:713-720 |
| 33. | Ushioda, H., T. Terayama, S. Sakai, H. Zen-Yoji, M. Nishiwaki, and A. Hidano. 1981. Coagulase typing of Staphylococcus aureus and its application in routine work, p. 77-83. In J. Jeljaszewicz (ed.), Staphylococci and staphylococcal infections. Gustav Fischer Verlag, Stuttgart, Germany. |
| 34. |
van Asselt, G. J.,
J. S. Vliegenthart,
P. L. C. Petit,
J. A. M. van de Klundert, and R. P. Mouton.
1992.
High-level aminoglycoside resistance among enterococci and group A streptococci.
J. Antimicrob. Chemother.
30:651-659 |
| 35. |
van Belkum, A.,
R. Bax,
P. Peerbooms,
W. H. F. Goessens,
N. van Leeuwen, and W. G. V. Quint.
1993.
Comparison of phage typing and DNA fingerprinting by polymerase chain reaction for discrimination of methicillin-resistant Staphylococcus aureus strains.
J. Clin. Microbiol.
31:798-803 |
| 36. |
Vanhoof, R.,
C. Godard,
J. Content,
H. J. Nyssen,
E. Hannecart-Pokorni, and the Belgian Study Group of Hospital Infections (GDEPIH/GOSPIZ).
1994.
Detection by polymerase chain reaction of genes encoding aminoglycoside-modifying enzymes in methicillin-resistant Staphylococcus aureus isolates of epidemic phage types.
J. Med. Microbiol.
41:282-290 |
| 37. | Warsa, C. W., T. Okubo, and R. Okamoto. 1996. Antimicrobial susceptibilities and phage typing of Staphylococcus aureus clinical isolates in Indonesia. J. Infect. Chemother. 2:29-33. |
| 38. |
Weems, J. J.,
J. H. Lowrance,
L. M. Baddour, and W. A. Simpson.
1989.
Molecular epidemiology of nosocomial, multiply aminoglycoside resistant Enterococcus faecalis.
J. Antimicrob. Chemother.
24:121-130 |
Journal of Clinical Microbiology, September 2001, p. 3115-3121, Vol. 39, No. 9
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.9.3115-3121.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Ishino, K., Tsuchizaki, N., Ishikawa, J., Hotta, K.
(2007). Usefulness of PCR-Restriction Fragment Length Polymorphism Typing of the Coagulase Gene To Discriminate Arbekacin-Resistant Methicillin-Resistant Staphylococcus aureus Strains. J. Clin. Microbiol.
45: 607-609
[Abstract] [Full Text] -
Sola, C., Cortes, P., Saka, H. A., Cordoba MRSA Collaborative Study Group, , Vindel, A., Bocco, J. L.
(2006). Evolution and Molecular Characterization of Methicillin-Resistant Staphylococcus aureus Epidemic and Sporadic Clones in Cordoba, Argentina. J. Clin. Microbiol.
44: 192-200
[Abstract] [Full Text] -
Nagaoka, T., Horii, T., Satoh, T., Ito, T., Monji, A., Takeshita, A., Maekawa, M.
(2005). Use of a Three-Dimensional Microarray System for Detection of Levofloxacin Resistance and the mecA Gene in Staphylococcus aureus. J. Clin. Microbiol.
43: 5187-5194
[Abstract] [Full Text] -
Huang, V., Rybak, M. J.
(2005). Pharmacodynamics of Cefepime Alone and in Combination with Various Antimicrobials against Methicillin-Resistant Staphylococcus aureus in an In Vitro Pharmacodynamic Infection Model. Antimicrob. Agents Chemother.
49: 302-308
[Abstract] [Full Text] -
Klingenberg, C., Sundsfjord, A., Ronnestad, A., Mikalsen, J., Gaustad, P., Flaegstad, T.
(2004). Phenotypic and genotypic aminoglycoside resistance in blood culture isolates of coagulase-negative staphylococci from a single neonatal intensive care unit, 1989-2000. J Antimicrob Chemother
54: 889-896
[Abstract] [Full Text] -
Denis, O., Deplano, A., Nonhoff, C., De Ryck, R., de Mendonca, R., Rottiers, S., Vanhoof, R., Struelens, M. J.
(2004). National Surveillance of Methicillin-Resistant Staphylococcus aureus in Belgian Hospitals Indicates Rapid Diversification of Epidemic Clones. Antimicrob. Agents Chemother.
48: 3625-3629
[Abstract] [Full Text] -
Yamane, K., Doi, Y., Yokoyama, K., Yagi, T., Kurokawa, H., Shibata, N., Shibayama, K., Kato, H., Arakawa, Y.
(2004). Genetic Environments of the rmtA Gene in Pseudomonas aeruginosa Clinical Isolates. Antimicrob. Agents Chemother.
48: 2069-2074
[Abstract] [Full Text] -
Kim, H. B., Jang, H.-C., Nam, H. J., Lee, Y. S., Kim, B. S., Park, W. B., Lee, K. D., Choi, Y. J., Park, S. W., Oh, M.-d., Kim, E.-C., Choe, K. W.
(2004). In Vitro Activities of 28 Antimicrobial Agents against Staphylococcus aureus Isolates from Tertiary-Care Hospitals in Korea: a Nationwide Survey. Antimicrob. Agents Chemother.
48: 1124-1127
[Abstract] [Full Text] -
Lee, D.-G., Chun, H.-S., Yim, D.-S., Choi, S.-M., Choi, J.-H., Yoo, J.-H., Shin, W.-S., Kang, M.-W.
(2003). Efficacies of Vancomycin, Arbekacin, and Gentamicin Alone or in Combination against Methicillin-Resistant Staphylococcus aureus in an In Vitro Infective Endocarditis Model. Antimicrob. Agents Chemother.
47: 3768-3773
[Abstract] [Full Text] -
Melter, O., Aires de Sousa, M., Urbaskova, P., Jakubu, V., Zemlickova, H., de Lencastre, H.
(2003). Update on the Major Clonal Types of Methicillin-Resistant Staphylococcus aureus in the Czech Republic. J. Clin. Microbiol.
41: 4998-5005
[Abstract] [Full Text] -
Vakulenko, S. B., Mobashery, S.
(2003). Versatility of Aminoglycosides and Prospects for Their Future. Clin. Microbiol. Rev.
16: 430-450
[Abstract] [Full Text] -
Kikuchi, K., Takahashi, N., Piao, C., Totsuka, K., Nishida, H., Uchiyama, T.
(2003). Molecular Epidemiology of Methicillin-Resistant Staphylococcus aureus Strains Causing Neonatal Toxic Shock Syndrome-Like Exanthematous Disease in Neonatal and Perinatal Wards. J. Clin. Microbiol.
41: 3001-3006
[Abstract] [Full Text] -
Dominguez, E., Zarazaga, M., Torres, C.
(2002). Antibiotic Resistance in Staphylococcus Isolates Obtained from Fecal Samples of Healthy Children. J. Clin. Microbiol.
40: 2638-2641
[Abstract] [Full Text] -
Ida, T., Okamoto, R., Nonoyama, M., Irinoda, K., Kurazono, M., Inoue, M.
(2002). Antagonism between Aminoglycosides and {beta}-Lactams in a Methicillin-Resistant Staphylococcus aureus Isolate Involves Induction of an Aminoglycoside-Modifying Enzyme. Antimicrob. Agents Chemother.
46: 1516-1521
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»