This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Drago, L.
Right arrow Articles by Gismondo, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Drago, L.
Right arrow Articles by Gismondo, M. R.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, November 2002, p. 4399, Vol. 40, No. 11
0095-1137/02/$04.00+0     DOI: 10.1128/JCM.40.11.4399.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

LETTER TO THE EDITOR

Real-Time PCR Assay for Rapid Detection of Bacillus anthracis Spores in Clinical Samples


arrow
LETTER
 
During the period of "emergence anthrax," the high number of clinical samples sent to our laboratory evidenced the need for a rapid and sensitive detection method able to provide results in a very short time. Therefore, we adapted real-time-PCR methods (1, 2) to the rapid detection of Bacillus anthracis spores in swabs mimicking clinical nasopharyngeal and wound specimens.

Three different strains of B. anthracis as lyophilized spores were used. The strains were clinically isolated between 1960 and 1970, probably from patients with human cutaneous anthrax. Their identification was confirmed by biochemical testing (API 50 CH; Biomerieux, Marcy l'Etoile, France).

Swabs for clinical use were artificially contaminated by dipping them in a suspension containing 3 x 105 to 5 x 105 spores/ml. Swabs were dissolved in 1 ml of sterile saline to release the adhered spores and obtain an initial inoculum of 104 spores/ml, which was then diluted to the required concentrations.

The suspensions containing anthrax spores were heated at 100°C for 30 min and centrifuged at 11,000 x g at 4°C for 5 min, and then 1 µl of the supernatant was used for real-time PCR, performed with the Light Cycler PCR system (Roche Diagnostic Co., Monza, Italy).

The primers were rpoBF1a (CCACCAACAGTAGAAAATGCC) and rpoBR1a (AAATTTCACCAGTTTCTGGATCT) (2). The PCR mixture (19 µl) consisted of 2.2 mM MgCl2 (1.8 µl), 1x real-time-PCR buffer (2 µl), the two primers (0.5 µM, 1 µl each), and the two probes (0.15 µM, 0.3 µl each). The sample volume was 1 µl.

The amplification program comprised an initial denaturation at 95°C for 120 s followed by 55 cycles each of 95°C for 3 s, 63°C for 10 s, and 72°C for 10 s. Detection was accomplished by hybridization of a pair of probes (BaP1, TCCAAAGCGCTATGATTTAGCAAATGT-fluorescein; BaP2, Red 640-GGTCGCTACAAGATCAACAAGTTACAC-P, where P indicates phosphorylation at the 3' end) to the amplicons as they were formed (2).

The most important feature of the assay was its capability to detect as few as 25 spores/ml in a very short time (about 90 min, including the time required for DNA extraction) for determination of nasopharyngeal or wound contamination. The specificity of the test was ensured by the choice of PCR primers with B. anthracis-specific nucleotides at their 3' ends, so that no reactions were observed for B. subtilis or B. cereus spores or for B. anthracis-negative clinical swabs. A linear correlation was observed between the concentration of target DNA sequence (the plasmid rpoB1 [TIB MOLBIOL LLC, Freehold, N.J.]) and corresponding crossing points (where crossing point refers to cycle numbers at the beginning of the linear phase). A decrement of 1 log in DNA concentration caused an increase of 2 crossing points, until the concentration of 10 genomes/ml was reached.

The assay showed good intra-assay reproducibility in 10 replicates, with a coefficient of variation of 1.34%.

Extracting DNA by boiling samples proved to be a reproducible, easy-to-perform procedure, allowing a good recovery of anthrax spores in comparison with recoveries by other methods (data not shown). The method allowed for rapid screening of several samples from subjects exposed to suspected contamination, thus allowing the subjects to avoid any prophylaxis in the period between contamination and the availability of results from conventional culture methods.


arrow
REFERENCES
 
    1
  1. Makino, S. I., H. I. Cheun, M. Watarai, I. Uchida, and K. Takeshi. 2001. Detection of anthrax spores from the air by real-time PCR. Lett. Appl. Microbiol. 33:237-240.[CrossRef][Medline]
  2. 2
  3. Qi, Y., G. Patra, X. Liang, L. E. Williams, S. Rose, R. J. Redkar, and V. G. Del Vecchio. 2001. Utilization of the rpoB gene as a specific chromosomal marker for real-time PCR detection of Bacillus anthracis. Appl. Environ. Microbiol. 67:3720-3727.[Abstract/Free Full Text]
Lorenzo Drago*
Alessandra Lombardi
Elena De Vecchi
Maria Rita Gismondo

Laboratory of Clinical Microbiology
L. Sacco Teaching Hospital
University of Milan
Via GB Grassi 74
20157 Milan, Italy

* Phone: 390239042459
Fax: 390250319651
E-mail: microbio{at}mailserver.unimi.it.


Journal of Clinical Microbiology, November 2002, p. 4399, Vol. 40, No. 11
0095-1137/02/$04.00+0     DOI: 10.1128/JCM.40.11.4399.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Dauphin, L. A., Newton, B. R., Rasmussen, M. V., Meyer, R. F., Bowen, M. D. (2008). Gamma Irradiation Can Be Used To Inactivate Bacillus anthracis Spores without Compromising the Sensitivity of Diagnostic Assays. Appl. Environ. Microbiol. 74: 4427-4433 [Abstract] [Full Text]  
  • Espy, M. J., Uhl, J. R., Sloan, L. M., Buckwalter, S. P., Jones, M. F., Vetter, E. A., Yao, J. D. C., Wengenack, N. L., Rosenblatt, J. E., Cockerill, F. R. III, Smith, T. F. (2006). Real-Time PCR in Clinical Microbiology: Applications for Routine Laboratory Testing. Clin. Microbiol. Rev. 19: 165-256 [Abstract] [Full Text]  
  • Bode, E., Hurtle, W., Norwood, D. (2004). Real-Time PCR Assay for a Unique Chromosomal Sequence of Bacillus anthracis. J. Clin. Microbiol. 42: 5825-5831 [Abstract] [Full Text]  
  • Varma-Basil, M., El-Hajj, H., Marras, S. A.E., Hazbon, M. H., Mann, J. M., Connell, N. D., Kramer, F. R., Alland, D. (2004). Molecular Beacons for Multiplex Detection of Four Bacterial Bioterrorism Agents. Clin. Chem. 50: 1060-1062 [Full Text]  

This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Drago, L.
Right arrow Articles by Gismondo, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Drago, L.
Right arrow Articles by Gismondo, M. R.