Previous Article | Next Article 
Journal of Clinical Microbiology, December 2002, p. 4457-4465, Vol. 40, No. 12
0095-1137/02/$04.00+0 DOI: 10.1128/JCM.40.12.4457-4465.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Microevolution of the Direct Repeat Region of Mycobacterium tuberculosis: Implications for Interpretation of Spoligotyping Data
R. M. Warren,1 E. M. Streicher,1 S. L. Sampson,1 G. D. van der Spuy,1 M. Richardson,1 D. Nguyen,2 M. A. Behr,2 T. C. Victor,1 and P. D. van Helden1*
MRC Centre for Molecular and Cellular Biology, Department of Medical Biochemistry, Faculty of Health Sciences, Stellenbosch University, Tygerberg 7505, South Africa,1
Department of Medicine, McGill University Health Centre, Montreal H3G 1A4, Canada2
Received 21 June 2002/
Returned for modification 6 August 2002/
Accepted 14 September 2002

ABSTRACT
The direct repeat (DR) region has been determined to be an important
chromosomal domain for studying the evolution of
Mycobacterium tuberculosis. Despite this, very little is known about microevolutionary
events associated with clonal expansion and how such events
influence the interpretation of both restriction fragment length
polymorphism (RFLP) and spoligotype data. This study examined
the structure of the DR region in three independently evolving
lineages of
M. tuberculosis with a combination of DR-RFLP, spoligotyping,
and partial DNA sequencing. The results show that the duplication
of direct variable repeat (DVR) sequences and single-nucleotide
polymorphisms is rare; conversely, the deletion of DVR sequences
and IS
6110-mediated mutation is observed frequently. Deletion
of either single or contiguous DVR sequences was observed. The
deletion of adjacent DVR sequences occurred in a dependent manner
rather than as an accumulation of independent events. Insertion
of IS
6110 into either the direct repeat or spacer sequences
influenced the spoligotype pattern, resulting in apparent deletion
of DVR sequences. Homologous recombination between adjacent
IS
6110 elements led to extensive deletion in the DR region,
again demonstrating a dependent evolutionary mechanism. Different
isolates from the same strain family and isolates from different
strain families were observed to converge to the same spoligotype
pattern. In conclusion, the binary data of the spoligotype are
unable to provide sufficient information to accurately establish
genotypic relationships between certain clinical isolates of
M. tuberculosis. This has important implications for molecular
epidemiologic strain tracking and for the application of spoligotype
data to phylogenetic analysis of
M. tuberculosis isolates.

INTRODUCTION
Sequencing of the
Mycobacterium tuberculosis genome has identified
a number of different repeat sequences (
5). Perhaps the most
intensively investigated repeat is the direct repeat (DR) (
15).
This region has a unique structure, comprising directly repeated
sequences interspersed with unique variable sequences (
15),
which in combination have been termed the direct variable repeat
(DVR) sequences (
13). While the function of this region of the
M. tuberculosis genome remains to be determined, its preservation
throughout the evolutionary history of the
M. tuberculosis complex
argues for a functionally important domain.
Repeated sequences such as the IS6110 element and DR are the most commonly used targets for the molecular typing of M. tuberculosis isolates. IS6110 is a transposable element that may be repeated up to 25 times per M. tuberculosis genome (31). Transposition is thought to be random, generating a diverse array of insertions throughout the chromosomes of different clinical isolates. The polymorphic nature of the IS6110 insertions and the DR region has been exploited to create relatively reproducible bacterial "DNA fingerprints," which are used for epidemiologic tracking (1, 21, 29, 31, 37). To simplify the DR typing technique, a PCR-based method termed spoligotyping was developed, which determines the presence or absence of 43 DVR sequences in the DR region (13, 16). This method is widely used for epidemiological investigations (6, 22, 23, 26) and lends itself readily to interlaboratory and international strain comparisons (17, 24).
A recent study extended the application of spoligotyping beyond epidemiologic tracking to investigate its potential utility for phylogenetic reconstruction of clinical isolates from different geographical regions (25). This study predicts the existence of at least seven distinct evolutionary groups, providing a scenario regarding the global spread of M. tuberculosis. Although this study provided new insights into the macroevolution of the DR region, the microevolution of the DR region in well-defined evolutionary lineages remains largely unknown. Only one study has investigated the evolution of the DR region within a limited number of closely related low-IS6110-copy-number strains (10). In that study, it was suggested that the DR region evolved primarily through homologous recombination. However, these low-copy-number strains were collected from vastly different geographical regions, and therefore the observed polymorphisms probably represent ancient evolutionary events.
More recently, it has been shown that the low-copy-number strains are evolutionarily distinct from the high-copy-number strains (12, 36). Hence, it is not possible to assume that the evolutionary mechanisms seen in the low-copy-number strains are the same as those occurring in high-copy-number strains. Therefore, the mechanism and rate of DR region evolution in a large number of isolates representing defined evolutionary lineages of high-copy-number strains remain to be fully determined. This knowledge will be important for the accurate inference of phylogenetic relationships.
To further explore the evolution of the DR region, we have examined clinical isolates belonging to three strain families, grouped according to the similarity of the IS6110 banding pattern (36), as well as uniquely inherited polymorphisms (30, 33, 34). Isolates from each strain family were subjected to DR-restriction fragment length polymorphism (RFLP) analysis, spoligotyping, and partial DNA sequencing to identify the evolutionary mechanisms leading to the polymorphic variants observed in the DR and flanking regions. We demonstrate that the DR region evolves by deletion of DVR sequences and by IS6110-mediated mutation. IS6110 insertion strongly influences the interpretation of spoligotype data, while mapping of the insertion points suggests the presence of preferential integration sites. Recombination between adjacent IS6110 elements or adjacent repeat sequences may lead to evolutionary convergence of DR-based genotypes. This has important implications for the interpretation of phylogenetic predictions.

MATERIALS AND METHODS
Study population.
M. tuberculosis isolates were collected from patients visiting
primary health care facilities in Cape Town, South Africa (
2).
DNA fingerprinting.
Each isolate was classified by DNA fingerprinting with the internationally standardized protocol (31). The PvuII Southern blots were sequentially hybridized with the enhanced chemiluminescence (ECL)-labeled probes IS-3' (31), IS-5' (35), and DRr (15), each probe being stripped from the membrane by denaturation before the next probe was applied. The IS-3', IS-5', and DRr autoradiographs were scanned and normalized with GelCompar 4.0 to support accurate positioning of the respective hybridizing bands.
Strain family groupings were defined by isolates having an IS6110 Dice similarity index of >65% (36), where the index is calculated as the sum of the total number of matching bands divided by the total number of bands in each isolate. The delineation of the strain family groups used in this study was supported by previously identified polymorphisms uniquely associated with each IS6110-defined group (30, 33, 34). Each polymorphism is assumed to reflect a discrete evolutionary event, which is then inherited in subsequent generations. Therefore, a collection of isolates with an identical polymorphism is thought to represent clonal expansion from a common progenitor.
All isolates were classified according to polymorphisms in katG and gyrA (27) with the dot blot hybridization method (36).
DR-RFLP analysis.
In order to identify mutations leading to polymorphisms within the direct repeat locus and surrounding genome, the DRr DNA fingerprints of isolates grouped into strain families were analyzed as previously described (35). Briefly, the PvuII DRr DNA fingerprints were superimposed on the IS-3' and IS-5' DNA fingerprints to identify cohybridizing bands. Such cohybridization was indicative of an IS6110 insertion(s) within the direct repeat region. If cohybridization could not be demonstrated, this was indicative of the absence of an IS6110 element in the DR region. A single IS6110 insertion in the DR region was characterized by two DRr-hybridizing bands, while two IS6110 insertions were identified by the presence of three DRr-hybridizing bands, since each IS6110 insertion generates an additional PvuII restriction site. Direct repeats of the IS6110 elements were characterized by cohybridization of both the IS-5' and IS-3' probes with one of the DRr-containing fragments, while inverted repeats of the IS6110 elements were characterized by cohybridization of the IS-3' probe with only one DRr-containing fragment, together with cohybridization of the IS-5' probe with the remaining two DRr fragments, or vice versa.
Spoligotyping.
M. tuberculosis isolates were spoligotyped with the internationally standardized PCR protocol in combination with primers DRa (GGT TTT GGG TCT GAC GAC, 5' biotinylated) and DRb (CCG AGA GGG GAC GGA AAC) (13, 16). PCR amplifications were conducted in physically separated workstations to prevent contamination. Negative water controls were PCR amplified and included on each blot to identify any possible amplicon contamination. In addition, H37Rv DNA was amplified and included on each blot to determine the reproducibility of the spoligotyping method. To determine whether the spoligotypes identified in this study were found in other geographical regions, they were visually compared with the spoligotypes deposited in the worldwide database (25).
Sequencing.
In order to determine the point of IS6110 integration in the DR region or flanking regions, the chromosomal domain between the ancestral IS6110 element (7) and the second IS6110 element was PCR amplified with outward-reading primers complementary to the 3' (TTCAACCATCGCCGCCTCTACC) and 5' (GGTACCTCCTCGATGAACCAC) regions of the IS6110 element. Alternatively, the region between the inserted IS6110 element and a flanking genomic sequence was PCR amplified with the above IS6110 primers in combination with primers complementary to the 3'-flanking region (GCCGAAGTCACGGCAGACTG) or 5'-flanking region (CCTTGCTGTCCCGCCAATAC or CAGCGCAGAGGAGTTTGTG) .
The PCR products were then cloned into the vector pGEMTeasy (Promega) according to the manufacturer's instructions, and the inserts were sequenced with the T7 and SP6 primers. These sequences were deposited in GenBank with the following accession numbers: isolate 108 (AY099013); isolate 118 (AY052534, AY052535); isolate 125 (AY052536, AY052537); isolate 176 (AF390058, AF390059, AF390060, AF390061, AF390062, AF390063); isolate 211 (AY099015, AY099018, AY099019, AY099021, AY099023); isolate 235 (AY053426, AY053427, AY053428); isolate 278 (AF504308, AF504309); isolate 286 (AY053429, AY053430, AY053431); isolate 305 (AF504310, AF504311); isolate 348 (AF390057, AF390056, AF390055); isolate 392 (AF390069, AF390070, AF390071); isolate 397 (AF390064, AF390065, AF390066, AF390067,AF390068); isolate 453 (AY053432, AY053433, AY053434, AY099016); isolate 480 (AY053435, AY053436, AY053437, AY053438, AY053439); isolate 602 (AF421346); isolate 677 (AY099014, AY099020); isolate 704 (AF390047, AF390048, AF390049, AF390050); isolate 780 (AF390039S1, AF390039S2); isolate 907 (AY099008, AY099011, AY099012); isolate 973 (AF390051, AF390052, AF390053, AF390054); isolate 1124 (AF421344, AF421345); isolate 1227 (AF390041, AF390042, AF390043, AF390044, AF390045, AF390046); isolate 1633 (AY099009 AY099010); isolate 1662 (AY099022); isolate 1764 (AY099017, AY099024); and isolate 1985 (AF411183, AF411182).
The BlastN (http://www.ncbi. nlm.nih.gov) algorithm was used to identify the positions of IS6110 insertions and to localize DVR deletions and mutations in relation to the genome sequence of H37Rv (cosmid MTCY16B7, accession number Z81331) (5).

RESULTS
A total of 379 high-IS
6110-copy-number strains (>5 IS
6110 insertions) were identified in the study setting during the
period from mid-1992 to the end of 1998. Each high-copy-number
strain has a distinct IS
6110 banding pattern. One hundred and
seventy-six of these strains were grouped into three strain
families (F11, F28, and Beijing) (Fig.
1), according to a Dice
similarity index of >65% (
36). These groupings were supported
by chromosomal polymorphisms unique to each IS
6110-defined group.
Isolates grouped as strain family F11 showed a C-to-T transition
at position 491 of the
rrs gene (
34), while isolates grouped
as strain family F28 showed a G-to-A transition at position
619 in the Rv3566c gene (
30). The Beijing family isolates were
characterized by the absence of the ISL540 sequence (
33).
Strain family F11 was represented by 97 different IS
6110 banding
patterns, family F28 was represented by 41 patterns; and the
Beijing family was represented by 38 patterns (Table
1). These
strain families represent the three largest groupings found
in the study community (
36).
katG and
gyrA polymorphism data
(
27) showed that strain families F11 and F28 were part of genetic
group 2 (Table
1), although phylogenetic analysis has inferred
that these strain families evolved independently and that they
do not share a recent progenitor (
36). The Beijing family was
part of genetic group 1 (
27) (Table
1).
Spoligotyping (
13,
16) of the DR regions was used to determine
the presence or absence of the 43 DVR sequences (Fig.
2). Strain
families F11 and F28 each showed a total of 14 different spoligotypes,
while the Beijing family showed only a single spoligotype (Table
1 and Fig.
2).
The spoligotype pattern evolved primarily by the deletion of
single DVRs, although, in 11 instances, contiguous DVRs were
deleted (Fig.
2). The absence of intermediate DR structures
suggests that the deletion of adjacent DVR sequences occurred
as single deletion events rather than as a series of sequential
deletion events. The deletion of the DVR sequences appeared
to be random, although there was a slight preference for the
deletion of DVR sequences in the region 5' to the ancestral
IS
6110 element (between DVRs 1 and 24) (Fig.
2).
Many of the isolates in each IS6110 strain family were characterized by specific DVR deletions (Fig. 2), suggesting that these isolates have a common ancestor. Identical spoligotypes were identified in isolates in the worldwide spoligotype database (22, 25) (Table 1), suggesting that the strain families in our study could be globally distributed or that the spoligotypes observed in these databases arose convergently in different strains.
DR-RFLP analysis enabled an overview of the structure of the DR region and adjacent flanking regions. Strain family F11 strains showed 18 DR-RFLP variants, while family F28 showed 12 DR-RFLP variants. In contrast, the Beijing family showed only two DR-RFLP variants (Table 1). Comparison between the DR-RFLP data and the spoligotype data demonstrated that certain evolutionary mechanisms were not detected by the spoligotyping method and that the regions flanking the DR region were also subject to evolution (Fig. 3). In combination, the DR-RFLP and spoligotype data demonstrate that this chromosomal region has undergone substantial evolutionary change, although at a rate lower than that for IS6110 (see ratio of DR variants to IS6110 variants, Table 1).
To identify the mechanisms leading to the different polymorphic
variants, chromosomal domains adjacent to the ancestral IS
6110 insertion element as well as domains adjacent to additional
IS
6110 elements were cloned and sequenced. Comparison of the
DNA sequences with the DNA sequence of the DR region of H37Rv
(cosmid MTCY16B7) suggests that the duplication of DVR sequences
was rare, as only one event was identified (isolate 453 contains
a duplication of DVRs 17 and 18). Single-nucleotide polymorphisms
were identified in six isolates, occurring in both the direct
repeat and variable sequences. Sequence analysis showed that
in seven cases, the DR region had been disrupted by a second
IS
6110 insertion (Fig.
3). In strain family F11, the additional
DR IS
6110 insertions occurred between DVR 8 and DVR 21 (Fig.
3A, isolates 286, 453, and 602), while in family F28, the additional
DR IS
6110 insertions occurred between DVR 25 and DVR 37 (Fig.
3B, isolates 235, 480, and 973).
These IS6110 insertions play an important role in the formulation of the spoligotype pattern. In two instances, the IS6110 element was inserted in the variable spacer sequence, preventing hybridization of the amplified region to the immobilized complementary sequence (Fig. 2, IS6110 insertion in DVR 21 [F11 isolates] and isolate 235). In four instances, the IS6110 element was asymmetrically inserted in the direct repeat sequence, inhibiting PCR amplification of the adjacent variable sequence (Fig. 2, isolates 286, 480, 602, and 973) (11). The asymmetrical insertion of the IS6110 element in the DR region of isolate 286 (Fig. 3A) led to the apparent evolution of a spoligotype pattern that was identical to the spoligotype seen in isolate 453 (Fig. 2).
The close proximity of the IS6110 insertions to each other suggests the presence of two different preferential IS6110 integration loci in the DR region as well as preferential integration loci in both the 3'- and 5'-flanking regions (Fig. 3). The IS6110 insertion in the 5'-flanking regions appears to mediate recombination with an IS6110 insertion in the DR region, leading to partial deletion of the DR region (Fig. 3, isolates 392, 397, 704, 907, and 973) (Sampson et al., submitted for publication). This is supported by the absence of the 3-bp duplication at the terminus of the IS6110 element (4, 8). In these strains, the terminal 3 bp correspond to the 3-bp direct repeat of the ancestral IS6110 element and of the 5'-flanking IS6110 insertion. These large deletion events affect the spoligotype pattern, resulting in the convergent evolution of the spoligotype in isolates from different evolutionary lineages (Fig. 2, 3A, and 3B, compare isolates 704 with 392, 397, and 907).
Convergence of the spoligotype was also observed in isolates within a single evolutionary lineage (Fig. 2, compare isolates 392 and 397). In these isolates, recombination occurred between the ancestral IS6110 element and a 5'-flanking IS6110 element located in different chromosomal positions in the different strains (Fig. 3A). In addition, convergence via recombination is predicted to have occurred as parallel events between the ancestral and the same 5'-flanking IS6110 insertion in two different isolates (392 and 907) (Fig. 2 and 3A). These isolates are positioned on different branches within the same evolutionary lineage (Fig. 1).

DISCUSSION
The DR region has become an important genomic locus which can
be used to study the evolutionary history of clinical isolates
of
M. tuberculosis. Phylogenetic analysis has provided new insights
into the macroevolution of distinct clades and their global
dissemination (
25). However, the factors influencing microevolution
are not fully understood, and therefore their influence on phylogenetic
predictions remains to be determined. In this study we have
analyzed the structure of the DR region in three independently
evolving strain families (
36). The large number of observed
DR variants suggests that the DR region is evolving more rapidly
than was previously predicted (
10), although this rate is significantly
slower than that of IS
6110, as demonstrated by the ratio of
DR variants to IS
6110 variants. Within the study population,
the frequency of change appears to be strain family specific,
which may suggest that the mechanisms leading to change are
dependent either on the structure of the DR region or on the
overall mutation rate of the strain family. This is particularly
evident in the Beijing strain family, where the DR region appears
to be in a (evolutionarily) fixed state (
32). Only three spoligotype
variants have been previously documented in the Beijing family
(
3,
19).
Analysis of the data presented in this study supports suggestions that the DR region evolves by at least four different mechanisms (10, 32); IS6110-mediated mutation, homologous recombination between repeat sequences leading to DVR deletion, strand slippage during replication leading to duplication of DVR sequences, and point mutation. In agreement with a previous report (32), the duplication of DVR sequences and point mutations was found to be rare. Conversely, the frequency of DVR deletions was high. From this study, it is evident that the deletion of specific DVR sequences generated spoligotype "signatures" which appear to be unique to a strain family (Fig. 2). Comparison between the spoligotype patterns identified in this study and those deposited in the worldwide database (22, 25) identified spoligotype patterns that were either identical or highly similar. This suggests that the strain families are widely disseminated, but the correlation between spoligotype signature and strain family needs further investigation, as it is possible that the spoligotypes deposited in the different databases have arisen convergently in different strains. Furthermore, it is not known how the accumulation of mutations in the DR region will disturb such signatures.
The evolution of the spoligotype pattern appears to occur via the deletion of single DVRs or contiguous DVR sequences. In this study, isolates representing intermediate numbers of DVR deletions were not observed, suggesting that the deletion of contiguous DVR sequences does not occur via a process of sequential deletion but rather via a single deletion event spanning a number of DVRs. This mechanism has been previously proposed to explain the deletion of contiguous DVR sequences (32) or DVR sequences in association with an (internal) IS6110 element (10). This implies that certain deletions of contiguous DVR sequences will occur in a dependent manner, which may restrict the use of spoligotype data to accurately predict evolutionary relationships. Most of the algorithms used to calculate phylogenetic trees are based on the assumption that the markers evolve independently (28). Furthermore, the sampling methods used to gain statistical support for inferred phylogenies are dependent on the markers' evolving independently.
In contrast to previous studies, we show that IS6110-mediated mutation plays a significant role in the evolution of the spoligotype pattern. Mapping of the IS6110 insertion points demonstrates the existence of preferential IS6110 integration loci (9, 11, 15, 20). Two of these loci were located within the DR region, while a further two preferential integration loci were located in the 3'- and 5'-flanking regions. The preferential integration loci in the DR region appear to be strain family specific, suggesting that the structure of the DR region may influence subsequent evolutionary events. The insertion of IS6110 into repeat sequences in the DR region resulted in the apparent deletion of DVR sequences according to the spoligotype data (11, 19). However, DNA sequencing of these regions showed that the DVR sequences were present and that PCR amplification was inhibited by the insertion of the IS6110 element in the priming region (18).
An alternative mechanism was also identified by which the IS6110 element was inserted into the variable spacer sequence, preventing hybridization. The identification of these additional evolutionary mechanisms implies that the spoligotype pattern reflects an overrepresentation of the frequency of homologous recombination events occurring within the DR region. The inability of the spoligotype pattern to differentiate between the evolutionary mechanisms leading to the apparent loss of DVR sequences has important consequences for tracking of strains in epidemiological studies. Clustering algorithms will group such isolates as identical even though they have evolved independently by different mechanisms. This will influence the accuracy of both epidemiologic and phylogenetic studies based only on spoligotype data.
Homologous recombination between adjacent IS6110 elements (4, 8) could explain the deletion of large portions of the DR region and 5'-flanking region (Sampson et al., submitted), thereby strongly influencing the spoligotype pattern. This evolutionary mechanism generated identical spoligotype patterns in different strain families, demonstrating convergent evolution of the spoligotype pattern. This also has important implications for phylogenetic predictions, as isolates will be seen as genotypically identical even though they have evolved independently and belong to different evolutionary lineages. The true extent of convergence of spoligotype patterns or subsets of the spoligotype pattern is unknown and will depend on the frequency at which specific DVRs or contiguous DVRs are deleted by homologous recombination. The significance of such events on phylogenetic reconstructions will vary depending on the number of DVRs deleted as well as the complexity of the underlying spoligotype. The lower the complexity, the greater the influence of convergent events on the phylogenetic reconstruction, while the greater the number of contiguous DVRs deleted, the greater the chance of convergence.
From this and other studies (10, 32), it is clear that the evolutionary process generates a substantial number of variant DR structures. However, this study implies that the binary data of the spoligotype are unable to provide sufficient information to accurately establish the evolutionary relationship between certain clinical isolates of M. tuberculosis. To gain further insights into the evolutionary history of M. tuberculosis isolates, we recommend the use of other genotyping methods, in association with spoligotyping, to enhance the accuracy of genotypic classification.

ACKNOWLEDGMENTS
This work was made possible by grants from the GlaxoSmithKline
Action TB Initiative, the Sequella Global Tuberculosis Foundation,
IAEA (projects SAF6/003 and CRP 9925), the Harry Crossely Foundation,
and the National Research Foundation (THRP).
E. Engelke, S. Carlini, and M. De Kock are thanked for technical assistance.

FOOTNOTES
* Corresponding author. Mailing address: MRC Centre for Molecular and Cellular Biology, Department of Medical Biochemistry, Stellenbosch University, P.O. Box 19063, Tygerberg 7505, South Africa. Phone: 27 21 9389401. Fax: 27 21 9389467. E-mail:
pvh{at}sun.ac.za.


REFERENCES
1 - Alland, D., G. E. Kalkut, A. R. Moss, R. A. McAdam, J. A. Hahn, W. Bosworth, E. Drucker, and B. R. Bloom. 1994. Transmission of tuberculosis in New York City. An analysis by DNA fingerprinting and conventional epidemiologic methods. N. Engl. J. Med. 330:1710-1716.[Abstract/Free Full Text]
2 - Beyers, N., R. P. Gie, H. L. Zietsman, M. Kunneke, J. Hauman, M. Tatley, and P. R. Donald. 1996. The use of a geographical information system (GIS) to evaluate the distribution of tuberculosis in a high-incidence community. S. Afr. Med. J. 86:40-41, 44.[Medline]
3 - Bifani, P., B. Mathema, M. Campo, S. Moghazeh, B. Nivin, E. Shashkina, J. Driscoll, S. S. Munsiff, R. Frothingham, and B. N. Kreiswirth. 2001. Molecular identification of streptomycin monoresistant Mycobacterium tuberculosis related to multidrug-resistant W strain. Emerg. Infect. Dis. 7:842-848.[Medline]
4 - Brosch, R., W. J. Philipp, E. Stavropoulos, M. J. Colston, S. T. Cole, and S. V. Gordon. 1999. Genomic analysis reveals variation between Mycobacterium tuberculosis H37Rv and the attenuated M. tuberculosis H37Ra strain. Infect. Immun. 67:5768-5774.[Abstract/Free Full Text]
5 - Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. Barry III, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, B. G. Barrell, et al. 1998. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393:537-544.[CrossRef][Medline]
6 - Cronin, W. A., J. E. Golub, L. S. Magder, N. G. Baruch, M. J. Lathan, L. N. Mukasa, N. Hooper, J. H. Razeq, D. Mulcahy, W. H. Benjamin, and W. R. Bishai. 2001. Epidemiologic usefulness of spoligotyping for secondary typing of Mycobacterium tuberculosis isolates with low-copy-numbers of IS6110. J. Clin. Microbiol. 39:3709-3711.[Abstract/Free Full Text]
7 - Dale, J. W. 1995. Mobile genetic elements in mycobacteria. Eur. Respir. J. Suppl. 20:633s-648s.[Medline]
8 - Fang, Z., C. Doig, D. T. Kenna, N. Smittipat, P. Palittapongarnpim, B. Watt, and K. J. Forbes. 1999. IS6110-mediated deletions of wild-type chromosomes of Mycobacterium tuberculosis. J. Bacteriol. 181:1014-1020.[Abstract/Free Full Text]
9 - Fang, Z., and K. J. Forbes. 1997. A Mycobacterium tuberculosis IS6110 preferential locus (ipl) for insertion into the genome. J. Clin. Microbiol. 35:479-481.[Abstract]
10 - Fang, Z., N. Morrison, B. Watt, C. Doig, and K. J. Forbes. 1998. IS6110 transposition and evolutionary scenario of the direct repeat locus in a group of closely related Mycobacterium tuberculosis strains. J. Bacteriol. 180:2102-2109.[Abstract/Free Full Text]
11 - Filliol, I., C. Sola, and N. Rastogi. 2000. Detection of a previously unamplified spacer within the DR locus of Mycobacterium tuberculosis: epidemiological implications. J. Clin. Microbiol. 38:1231-1234.[Abstract/Free Full Text]
12 - Fomukong, N., M. Beggs, H. el Hajj, G. Templeton, K. Eisenach, and M. D. Cave. 1997. Differences in the prevalence of IS6110 insertion sites in Mycobacterium tuberculosis strains: low and high-copy-number of IS6110. Tuber. Lung Dis. 78:109-116.[CrossRef][Medline]
13 - Groenen, P. M., A. E. Bunschoten, D. van Soolingen, and J. D. van Embden. 1993. Nature of DNA polymorphism in the direct repeat cluster of Mycobacterium tuberculosis; application for strain differentiation by a novel typing method. Mol. Microbiol. 10:1057-1065.[Medline]
14 - Hermans, P. W., F. Messadi, H. Guebrexabher, D. van Soolingen, P. E. de Haas, H. Heersma, H. de Neeling, A. Ayoub, F. Portaels, and D. Frommel. 1995. Analysis of the population structure of Mycobacterium tuberculosis in Ethiopia, Tunisia, and the Netherlands: usefulness of DNA typing for global tuberculosis epidemiology. J. Infect. Dis. 171:1504-1513.[Medline]
15 - Hermans, P. W., D. van Soolingen, E. M. Bik, P. E. de Haas, J. W. Dale, and J. D. van Embden. 1991. Insertion element IS987 from Mycobacterium bovis BCG is located in a hot-spot integration region for insertion elements in Mycobacterium tuberculosis complex strains. Infect. Immun. 59:2695-2705.[Abstract/Free Full Text]
16 - Kamerbeek, J., L. Schouls, A. Kolk, M. van Agterveld, D. van Soolingen, S. Kuijper, A. Bunschoten, H. Molhuizen, R. Shaw, M. Goyal, and J. Van Embden. 1997. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J. Clin. Microbiol. 35:907-914.[Abstract]
17 - Kremer, K., D. van Soolingen, R. Frothingham, W. H. Haas, P. W. Hermans, C. Martin, P. Palittapongarnpim, B. B. Plikaytis, L. W. Riley, M. A. Yakrus, J. M. Musser, and J. D. van Embden. 1999. Comparison of methods based on different molecular epidemiological markers for typing of Mycobacterium tuberculosis complex strains: interlaboratory study of discriminatory power and reproducibility. J. Clin. Microbiol. 37:2607-2618.[Abstract/Free Full Text]
18 - Legrand, E., I. Filliol, C. Sola, and N. Rastogi. 2001. Use of spoligotyping to study the evolution of the direct repeat locus by IS6110 transposition in Mycobacterium tuberculosis. J. Clin. Microbiol. 39:1595-1599.[Abstract/Free Full Text]
19 - Mokrousov, I., O. Narvskaya, E. Limeschenko, T. Otten, and B. Vyshnevskiy. 2002. Novel IS6110 insertion sites in the direct repeat locus of Mycobacterium tuberculosis clinical strains from the St. Petersburg area of Russia and evolutionary and epidemiological considerations. J. Clin. Microbiol. 40:1504-1507.[Abstract/Free Full Text]
20 - Sampson, S. L., R. M. Warren, M. Richardson, G. D. van der Spuy, and P. D. van Helden. 1999. Disruption of coding regions by IS6110 insertion in Mycobacterium tuberculosis. Tuber. Lung Dis. 79:349-359.[CrossRef][Medline]
21 - Small, P. M., P. C. Hopewell, S. P. Singh, A. Paz, J. Parsonnet, D. C. Ruston, G. F. Schecter, C. L. Daley, and G. K. Schoolnik. 1994. The epidemiology of tuberculosis in San Francisco. A population-based study with conventional and molecular methods. N. Engl. J. Med. 330:1703-1709.[Abstract/Free Full Text]
22 - Soini, H., X. Pan, A. Amin, E. A. Graviss, A. Siddiqui, and J. M. Musser. 2000. Characterization of Mycobacterium tuberculosis isolates from patients in Houston, Texas, by spoligotyping. J. Clin. Microbiol. 38:669-676.[Abstract/Free Full Text]
23 - Soini, H., X. Pan, L. Teeter, J. M. Musser, and E. A. Graviss. 2001. Transmission dynamics and molecular characterization of Mycobacterium tuberculosis isolates with low-copy-numbers of IS6110. J. Clin. Microbiol. 39:217-221.[Abstract/Free Full Text]
24 - Sola, C., A. Devallois, L. Horgen, J. Maisetti, I. Filliol, E. Legrand, and N. Rastogi. 1999. Tuberculosis in the Caribbean: with spacer oligonucleotide typing to understand strain origin and transmission. Emerg. Infect. Dis. 5:404-414.[Medline]
25 - Sola, C., I. Filliol, M. C. Gutierrez, I. Mokrousov, V. Vincent, and N. Rastogi. 2001. Spoligotype database of Mycobacterium tuberculosis: biogeographic distribution of shared types and epidemiologic and phylogenetic perspectives. Emerg. Infect. Dis. 7:390-396.[Medline]
26 - Sola, C., L. Horgen, J. Maisetti, A. Devallois, K. S. Goh, and N. Rastogi. 1998. Spoligotyping followed by double-repetitive-element PCR as rapid alternative to IS6110 fingerprinting for epidemiological studies of tuberculosis. J. Clin. Microbiol. 36:1122-1124.[Abstract/Free Full Text]
27 - Sreevatsan, S., X. Pan, K. E. Stockbauer, N. D. Connell, B. N. Kreiswirth, T. S. Whittam, and J. M. Musser. 1997. Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination. Proc. Natl. Acad. Sci. USA 94:9869-9874.[Abstract/Free Full Text]
28 - Swofford, D. L., G. J. Olsen, P. J. Waddell, and D. M. Hillis. 1996. Phylogenetic inference, p. 407-514. In D. M. Hillis, C. Moritz, and B. K. Mable (ed.), Molecular systematics. Sinauer Associates, Boston, Mass.
29 - Torrea, G., G. Levee, P. Grimont, C. Martin, S. Chanteau, and B. Gicquel. 1995. Chromosomal DNA fingerprinting analysis with the insertion sequence IS6110 and the repetitive element DR as strain-specific markers for epidemiological study of tuberculosis in French Polynesia. J. Clin. Microbiol. 33:1899-1904.[Abstract]
30 - Upton, A. M., A. Mushtaq, T. C. Victor, S. L. Sampson, J. Sandy, D. M. Smith, P. V. van Helden, and E. Sim. 2001. Arylamine N-acetyltransferase of Mycobacterium tuberculosis is a polymorphic enzyme and a site of isoniazid metabolism. Mol. Microbiol. 42:309-317.[CrossRef][Medline]
31 - van Embden, J. D., M. D. Cave, J. T. Crawford, J. W. Dale, K. D. Eisenach, B. Gicquel, P. Hermans, C. Martin, R. McAdam, and T. M. Shinnick. 1993. Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology. J. Clin. Microbiol. 31:406-409.[Abstract/Free Full Text]
32 - van Embden, J. D., T. van Gorkom, K. Kremer, R. Jansen, B. A. Der Zeijst, and L. M. Schouls. 2000. Genetic variation and evolutionary origin of the direct repeat locus of Mycobacterium tuberculosis complex bacteria. J. Bacteriol. 182:2393-2401.[Abstract/Free Full Text]
33 - van Rie, A., R. M. Warren, N. Beyers, R. P. Gie, C. N. Classen, M. Richardson, S. L. Sampson, T. C. Victor, and P. D. van Helden. 1999. Transmission of a multidrug-resistant Mycobacterium tuberculosis strain resembling "strain W" among noninstitutionalized, human immunodeficiency virus-seronegative patients. J. Infect. Dis. 180:1608-1615.[CrossRef][Medline]
34 - Victor, T. C., A. van Rie, A. M. Jordaan, M. Richardson, G. D. Der Spuy, N. Beyers, P. D. van Helden, and R. Warren. 2001. Sequence polymorphism in the rrs gene of Mycobacterium tuberculosis is deeply rooted within an evolutionary clade and is not associated with streptomycin resistance. J. Clin. Microbiol. 39:4184-4186.[Abstract/Free Full Text]
35 - Warren, R. M., M. Richardson, S. L. Sampson, G. D. van der Spuy, W. Bourn, J. H. Hauman, H. Heersma, W. Hide, N. Beyers, and P. D. van Helden.. 2001. Molecular evolution of Mycobacterium tuberculosis: phylogenetic reconstruction of clonal expansion. Tuberculosis (Edinburgh) 81:291-302.
36 - Warren, R. M., S. L. Sampson, M. Richardson, G. D. van der Spuy, C. J. Lombard, T. C. Victor, and P. D. van Helden. 2000. Mapping of IS6110-flanking regions in clinical isolates of M. tuberculosis demonstrates genome plasticity. Mol. Microbiol. 37:1405-1416.[CrossRef][Medline]
37 - Yang, Z. H., P. E. de Haas, D. van Soolingen, J. D. van Embden, and A. B. Andersen. 1994. Restriction fragment length polymorphism Mycobacterium tuberculosis strains isolated from Greenland during 1992: evidence of tuberculosis transmission between Greenland and Denmark. J. Clin. Microbiol. 32:3018-3025.[Abstract/Free Full Text]
Journal of Clinical Microbiology, December 2002, p. 4457-4465, Vol. 40, No. 12
0095-1137/02/$04.00+0 DOI: 10.1128/JCM.40.12.4457-4465.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Stavrum, R., Mphahlele, M., Ovreas, K., Muthivhi, T., Fourie, P. B., Weyer, K., Grewal, H. M. S.
(2009). High Diversity of Mycobacterium tuberculosis Genotypes in South Africa and Preponderance of Mixed Infections among ST53 Isolates. J. Clin. Microbiol.
47: 1848-1856
[Abstract]
[Full Text]
-
Muller, B., Hilty, M., Berg, S., Garcia-Pelayo, M. C., Dale, J., Boschiroli, M. L., Cadmus, S., Ngandolo, B. N. R., Godreuil, S., Diguimbaye-Djaibe, C., Kazwala, R., Bonfoh, B., Njanpop-Lafourcade, B. M., Sahraoui, N., Guetarni, D., Aseffa, A., Mekonnen, M. H., Razanamparany, V. R., Ramarokoto, H., Djonne, B., Oloya, J., Machado, A., Mucavele, C., Skjerve, E., Portaels, F., Rigouts, L., Michel, A., Muller, A., Kallenius, G., van Helden, P. D., Hewinson, R. G., Zinsstag, J., Gordon, S. V., Smith, N. H.
(2009). African 1, an Epidemiologically Important Clonal Complex of Mycobacterium bovis Dominant in Mali, Nigeria, Cameroon, and Chad. J. Bacteriol.
191: 1951-1960
[Abstract]
[Full Text]
-
Augustynowicz-Kopec, E., Jagielski, T., Zwolska, Z.
(2008). Genetic Diversity of Isoniazid-Resistant Mycobacterium tuberculosis Isolates Collected in Poland and Assessed by Spoligotyping. J. Clin. Microbiol.
46: 4041-4044
[Abstract]
[Full Text]
-
Allix-Beguec, C., Harmsen, D., Weniger, T., Supply, P., Niemann, S.
(2008). Evaluation and Strategy for Use of MIRU-VNTRplus, a Multifunctional Database for Online Analysis of Genotyping Data and Phylogenetic Identification of Mycobacterium tuberculosis Complex Isolates. J. Clin. Microbiol.
46: 2692-2699
[Abstract]
[Full Text]
-
Gibson, A. L., Huard, R. C., Gey van Pittius, N. C., Lazzarini, L. C. O., Driscoll, J., Kurepina, N., Zozio, T., Sola, C., Spindola, S. M., Kritski, A. L., Fitzgerald, D., Kremer, K., Mardassi, H., Chitale, P., Brinkworth, J., Garcia de Viedma, D., Gicquel, B., Pape, J. W., van Soolingen, D., Kreiswirth, B. N., Warren, R. M., van Helden, P. D., Rastogi, N., Suffys, P. N., Lapa e Silva, J., Ho, J. L.
(2008). Application of Sensitive and Specific Molecular Methods To Uncover Global Dissemination of the Major RDRio Sublineage of the Latin American-Mediterranean Mycobacterium tuberculosis Spoligotype Family. J. Clin. Microbiol.
46: 1259-1267
[Abstract]
[Full Text]
-
Lazzarini, L. C. O., Huard, R. C., Boechat, N. L., Gomes, H. M., Oelemann, M. C., Kurepina, N., Shashkina, E., Mello, F. C. Q., Gibson, A. L., Virginio, M. J., Marsico, A. G., Butler, W. R., Kreiswirth, B. N., Suffys, P. N., Lapa e Silva, J. R., Ho, J. L.
(2007). Discovery of a Novel Mycobacterium tuberculosis Lineage That Is a Major Cause of Tuberculosis in Rio de Janeiro, Brazil. J. Clin. Microbiol.
45: 3891-3902
[Abstract]
[Full Text]
-
Flores, L., Van, T., Narayanan, S., DeRiemer, K., Kato-Maeda, M., Gagneux, S.
(2007). Large Sequence Polymorphisms Classify Mycobacterium tuberculosis Strains with Ancestral Spoligotyping Patterns. J. Clin. Microbiol.
45: 3393-3395
[Abstract]
[Full Text]
-
Streicher, E. M., Victor, T. C., van der Spuy, G., Sola, C., Rastogi, N., van Helden, P. D., Warren, R. M.
(2007). Spoligotype Signatures in the Mycobacterium tuberculosis Complex. J. Clin. Microbiol.
45: 237-240
[Abstract]
[Full Text]
-
Mathema, B., Kurepina, N. E., Bifani, P. J., Kreiswirth, B. N.
(2006). Molecular Epidemiology of Tuberculosis: Current Insights. Clin. Microbiol. Rev.
19: 658-685
[Abstract]
[Full Text]
-
Marais, B. J., Victor, T. C., Hesseling, A. C., Barnard, M., Jordaan, A., Brittle, W., Reuter, H., Beyers, N., van Helden, P. D., Warren, R. M., Schaaf, H. S.
(2006). Beijing and Haarlem Genotypes Are Overrepresented among Children with Drug-Resistant Tuberculosis in the Western Cape Province of South Africa. J. Clin. Microbiol.
44: 3539-3543
[Abstract]
[Full Text]
-
Huard, R. C., Fabre, M., de Haas, P., Claudio Oliveira Lazzarini, L., van Soolingen, D., Cousins, D., Ho, J. L.
(2006). Novel Genetic Polymorphisms That Further Delineate the Phylogeny of the Mycobacterium tuberculosis Complex.. J. Bacteriol.
188: 4271-4287
[Abstract]
[Full Text]
-
Aga, R. S., Fair, E., Abernethy, N. F., DeRiemer, K., Paz, E. A., Kawamura, L. M., Small, P. M., Kato-Maeda, M.
(2006). Microevolution of the Direct Repeat Locus of Mycobacterium tuberculosis in a Strain Prevalent in San Francisco. J. Clin. Microbiol.
44: 1558-1560
[Abstract]
[Full Text]
-
Viana-Niero, C., Rodriguez, C. A. R., Bigi, F., Zanini, M. S., Ferreira-Neto, J. S., Cataldi, A., Leao, S. C.
(2006). Identification of an IS6110 insertion site in plcD, the unique phospholipase C gene of Mycobacterium bovis.. J Med Microbiol
55: 451-457
[Abstract]
[Full Text]
-
Filliol, I., Motiwala, A. S., Cavatore, M., Qi, W., Hazbon, M. H., Bobadilla del Valle, M., Fyfe, J., Garcia-Garcia, L., Rastogi, N., Sola, C., Zozio, T., Guerrero, M. I., Leon, C. I., Crabtree, J., Angiuoli, S., Eisenach, K. D., Durmaz, R., Joloba, M. L., Rendon, A., Sifuentes-Osornio, J., Ponce de Leon, A., Cave, M. D., Fleischmann, R., Whittam, T. S., Alland, D.
(2006). Global Phylogeny of Mycobacterium tuberculosis Based on Single Nucleotide Polymorphism (SNP) Analysis: Insights into Tuberculosis Evolution, Phylogenetic Accuracy of Other DNA Fingerprinting Systems, and Recommendations for a Minimal Standard SNP Set. J. Bacteriol.
188: 759-772
[Abstract]
[Full Text]
-
Brudey, K., Filliol, I., Ferdinand, S., Guernier, V., Duval, P., Maubert, B., Sola, C., Rastogi, N.
(2006). Long-Term Population-Based Genotyping Study of Mycobacterium tuberculosis Complex Isolates in the French Departments of the Americas. J. Clin. Microbiol.
44: 183-191
[Abstract]
[Full Text]
-
Lari, N., Rindi, L., Sola, C., Bonanni, D., Rastogi, N., Tortoli, E., Garzelli, C.
(2005). Genetic Diversity, Determined on the Basis of katG463 and gyrA95 Polymorphisms, Spoligotyping, and IS6110 Typing, of Mycobacterium tuberculosis Complex Isolates from Italy. J. Clin. Microbiol.
43: 1617-1624
[Abstract]
[Full Text]
-
Garcia de Viedma, D., Bouza, E., Rastogi, N., Sola, C.
(2005). Analysis of Mycobacterium tuberculosis Genotypes in Madrid and Identification of Two New Families Specific to Spain-Related Settings. J. Clin. Microbiol.
43: 1797-1806
[Abstract]
[Full Text]
-
Scott, A. N., Menzies, D., Tannenbaum, T.-N., Thibert, L., Kozak, R., Joseph, L., Schwartzman, K., Behr, M. A.
(2005). Sensitivities and Specificities of Spoligotyping and Mycobacterial Interspersed Repetitive Unit-Variable-Number Tandem Repeat Typing Methods for Studying Molecular Epidemiology of Tuberculosis. J. Clin. Microbiol.
43: 89-94
[Abstract]
[Full Text]
-
Shamputa, I. C., Rigouts, L., Eyongeta, L. A., El Aila, N. A., van Deun, A., Salim, A. H., Willery, E., Locht, C., Supply, P., Portaels, F.
(2004). Genotypic and Phenotypic Heterogeneity among Mycobacterium tuberculosis Isolates from Pulmonary Tuberculosis Patients. J. Clin. Microbiol.
42: 5528-5536
[Abstract]
[Full Text]
-
Warren, R. M., Victor, T. C., Streicher, E. M., Richardson, M., van der Spuy, G. D., Johnson, R., Chihota, V. N., Locht, C., Supply, P., van Helden, P. D.
(2004). Clonal Expansion of a Globally Disseminated Lineage of Mycobacterium tuberculosis with Low IS6110 Copy Numbers. J. Clin. Microbiol.
42: 5774-5782
[Abstract]
[Full Text]
-
Niobe-Eyangoh, S. N., Kuaban, C., Sorlin, P., Thonnon, J., Vincent, V., Gutierrez, M. C.
(2004). Molecular Characteristics of Strains of the Cameroon Family, the Major Group of Mycobacterium tuberculosis in a Country with a High Prevalence of Tuberculosis. J. Clin. Microbiol.
42: 5029-5035
[Abstract]
[Full Text]
-
Brudey, K., Gutierrez, M. C., Vincent, V., Parsons, L. M., Salfinger, M., Rastogi, N., Sola, C.
(2004). Mycobacterium africanum Genotyping Using Novel Spacer Oligonucleotides in the Direct Repeat Locus. J. Clin. Microbiol.
42: 5053-5057
[Abstract]
[Full Text]
-
Aranaz, A., Romero, B., Montero, N., Alvarez, J., Bezos, J., de Juan, L., Mateos, A., Dominguez, L.
(2004). Spoligotyping Profile Change Caused by Deletion of a Direct Variable Repeat in a Mycobacterium tuberculosis Isogenic Laboratory Strain. J. Clin. Microbiol.
42: 5388-5391
[Abstract]
[Full Text]
-
Goguet de la Salmoniere, Y.-O. L., Kim, C. C., Tsolaki, A. G., Pym, A. S., Siegrist, M. S., Small, P. M.
(2004). High-Throughput Method for Detecting Genomic-Deletion Polymorphisms. J. Clin. Microbiol.
42: 2913-2918
[Abstract]
[Full Text]
-
Warren, R. M., Victor, T. C., Streicher, E. M., Richardson, M., Beyers, N., van Pittius, N. C. G., van Helden, P. D.
(2004). Patients with Active Tuberculosis often Have Different Strains in the Same Sputum Specimen. Am. J. Respir. Crit. Care Med.
169: 610-614
[Abstract]
[Full Text]
-
Victor, T. C., de Haas, P. E. W., Jordaan, A. M., van der Spuy, G. D., Richardson, M., van Soolingen, D., van Helden, P. D., Warren, R.
(2004). Molecular Characteristics and Global Spread of Mycobacterium tuberculosis with a Western Cape F11 Genotype. J. Clin. Microbiol.
42: 769-772
[Abstract]
[Full Text]
-
Sampson, S. L., Richardson, M., van Helden, P. D., Warren, R. M.
(2004). IS6110-Mediated Deletion Polymorphism in Isogenic Strains of Mycobacterium tuberculosis. J. Clin. Microbiol.
42: 895-898
[Abstract]
[Full Text]
-
Smith, N. H., Dale, J., Inwald, J., Palmer, S., Gordon, S. V., Hewinson, R. G., Smith, J. M.
(2003). The population structure of Mycobacterium bovis in Great Britain: Clonal expansion. Proc. Natl. Acad. Sci. USA
100: 15271-15275
[Abstract]
[Full Text]
-
Nguyen, D., Brassard, P., Westley, J., Thibert, L., Proulx, M., Henry, K., Schwartzman, K., Menzies, D., Behr, M. A.
(2003). Widespread Pyrazinamide-Resistant Mycobacterium tuberculosis Family in a Low-Incidence Setting. J. Clin. Microbiol.
41: 2878-2883
[Abstract]
[Full Text]
-
Sampson, S. L., Warren, R. M., Richardson, M., Victor, T. C., Jordaan, A. M., van der Spuy, G. D., van Helden, P. D.
(2003). IS6110-Mediated Deletion Polymorphism in the Direct Repeat Region of Clinical Isolates of Mycobacterium tuberculosis. J. Bacteriol.
185: 2856-2866
[Abstract]
[Full Text]
-
Filliol, I., Driscoll, J. R., van Soolingen, D., Kreiswirth, B. N., Kremer, K., Valetudie, G., Anh, D. D., Barlow, R., Banerjee, D., Bifani, P. J., Brudey, K., Cataldi, A., Cooksey, R. C., Cousins, D. V., Dale, J. W., Dellagostin, O. A., Drobniewski, F., Engelmann, G., Ferdinand, S., Gascoyne-Binzi, D., Gordon, M., Gutierrez, M. C., Haas, W. H., Heersma, H., Kassa-Kelembho, E., Ly, H. M., Makristathis, A., Mammina, C., Martin, G., Mostrom, P., Mokrousov, I., Narbonne, V., Narvskaya, O., Nastasi, A., Niobe-Eyangoh, S. N., Pape, J. W., Rasolofo-Razanamparany, V., Ridell, M., Rossetti, M. L., Stauffer, F., Suffys, P. N., Takiff, H., Texier-Maugein, J., Vincent, V., de Waard, J. H., Sola, C., Rastogi, N.
(2003). Snapshot of Moving and Expanding Clones of Mycobacterium tuberculosis and Their Global Distribution Assessed by Spoligotyping in an International Study. J. Clin. Microbiol.
41: 1963-1970
[Abstract]
[Full Text]