This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Konomi, N.
Right arrow Articles by Zhang, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Konomi, N.
Right arrow Articles by Zhang, D.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, December 2002, p. 4738-4740, Vol. 40, No. 12
0095-1137/02/$04.00+0     DOI: 10.1128/JCM.40.12.4738-4740.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Detection of Mycobacterial DNA in Andean Mummies

Nami Konomi,1 Eve Lebwohl,1 Ken Mowbray,2 Ian Tattersall,2 and David Zhang1*

Department of Pathology, Mount Sinai School of Medicine, New York University,1 American Museum of Natural History, New York, New York2

Received 20 June 2002/ Returned for modification 18 July 2002/ Accepted 3 September 2002


arrow
ABSTRACT
 
The identification of genetic material from pathogenic organisms in ancient tissues provides a powerful tool for the study of certain infectious diseases in historic populations. We have obtained tissue samples from the genital areas of 12 mummies in the American Museum of Natural History collection in New York, N.Y. The mummies were excavated in the Andes Mountain region of South America, and radiocarbon dating estimates that the mummies date from A.D. 140 to 1200. DNAs were successfully extracted from all tissues and were suitable for PCR analysis. PCRs were carried out to detect Mycobacterium tuberculosis complex and mycobacteria other than M. tuberculosis (MOTB). M. tuberculosis complex was detected in 2 out of 12 samples, and MOTB were detected in 7 samples. This study confirmed the adequate preservation of genetic material in mummified tissues and the existence of mycobacteria, including M. tuberculosis, in historic populations in South America.


arrow
TEXT
 
The identification of genetic material from pathogenic organisms in ancient tissues provides a powerful tool for the study of certain infectious diseases in historic populations. Specifically, the analysis of ancient bacterial DNA may help clarify the uncertainty of macromorphologic analyses. Moreover, the identification of bacterial DNA provides direct evidence of the occurrence and frequency of infectious diseases in historic populations and may provide information about the evolution of microorganisms and their associated diseases (5). Environmental conditions have ensured the preservation of a wealth of evidence from antiquity that provides information about diseases of the time.

Molecular studies performed to date on bacteria and other microorganisms in ancient human remains have mainly addressed typing and characterization of pathogen DNA. Several recent reports describe the isolation of Mycobacterium tuberculosis in ancient human skeletal remains and soft tissue remains (1, 2, 6, 8, 10-12). We used PCR analysis of genital tissue samples from 12 ancient mummies from South America in order to detect the presence of mycobacteria in this population.

Twelve dried tissue samples were obtained from mummies in the collection of the American Museum of Natural History in New York, N.Y. Archaeological findings and radiocarbon dating estimate that the mummies date to before A.D. 1220. The tissue samples, taken from histologically confirmed skin samples in the pelvic region, were in dried form. Specifically, skin samples were taken from preserved genitalia when identifiable or from adjacent skin. Positive controls of M. tuberculosis specimens were obtained from a clinical laboratory.

Mummy tissue samples were cut into small fragments (5 mm3), placed in 1.5-ml microcentrifuge tubes, homogenized in 50 to 100 µl of phosphate-buffered saline (PBS) (Sigma, St. Louis, Mo.) with a homogenizer, and further diluted with 1,000 µl of PBS. After centrifugation, the supernatants were aspirated and the pellets were washed with PBS three times. The pellets were lysed in a 5 M guanidinium thiocyanate (GTC) buffer containing 5 M GTC (Sigma), 0.5% bovine serum albumin (Sigma), 80 mM EDTA, 400 mM Tris HCl (pH 7.5), and 0.5% sodium-N-lauroylsarcosine (Sigma) at 60°C for 1 h and then at 37°C overnight (7). DNA was extracted twice with phenol-chloroform (Sigma) at a 1:1 ratio, followed by chloroform once, and then precipitated by the addition of a 1/10 volume of 3 M sodium acetate (pH 5.2) and 2.5 volumes of absolute ethanol. The pellets were washed with 70% ethanol and air dried. They were dissolved in Tris-EDTA (10 mM Tris-HCl [pH 8.0], 1 mM EDTA) buffer (Sigma) and stored at -20°C for later use.

PCR was carried out in 50 µl of a reaction mixture composed of 1.5 mM MgCl2, 200 µM (each) deoxynucleoside triphosphate, various concentrations of each primer, 2 U of AmpliTaq Gold DNA polymerase (Roche, Indianapolis, Ind.), 50 mM KCl, and 10 mM Tris-HCl (pH 8.3). The PCR was initiated by preheating the mixture at 95°C for 10 min, followed by temperature cycles (for GAPDH [glyceraldehyde-3-phosphate dehydrogenase], 94°C for 1 min, 55°C for 30 s, and 72°C for 1 min for 40 cycles; for M. tuberculosis, 94°C for 1 min, 64°C for 30 s, and 72°C for 1 min for 40 cycles; for MOTB, 94°C for 1 min, 60°C for 30 s, and 72°C for 1 min for 45 cycles), in a thermal cycler (Perkin-Elmer model 9600). These temperature cycles were followed by a final extension step at 72°C for 5 min. PCR primers were used to detect the GAPDH gene (TCACTGCCACCCAGAAGACT and TTCTAGACGGCAGGTCAGGT) (15), M. tuberculosis (Tb-A, CTCGTCCAGCGCCGCTTCGG; Tb-B, CCTGCGAGCGTAGGCGTCGG) (4, 10), and MOTB (Tb11, ACCAACGATGGTGTGTCCAT; Tb12, CTTGTCGAACCGCATACCCT) (9, 13). To increase the detection sensitivity, a second PCR was carried out for M. tuberculosis. Two microliters of the first PCR product was transferred to a tube containing the second set of PCR primers (Tb-C, GCTTCGGACCACCAGCACCT; Tb-D, GCGTCGGTGACAAAGGCCAC) and amplified with the appropriate temperature cycles (94°C for 1 min, 50°C for 30 s, and 72°C for 1 min for 40 cycles). The PCR products were examined by electrophoresis and visualized under UV light after being stained with ethidium bromide.

Restriction fragment length polymorphism analyses were used to ensure that the PCR products were specific for the M. tuberculosis complex (4, 10) and to specify MOTB. For M. tuberculosis, the second group of PCR products was digested with 10 U of SalI (GIBCO BRL, Grand Island, N.Y.) in a 20-µl reaction mixture in the presence of the appropriate buffer at 37°C for 3 h. For MOTB (9, 13), the PCR products were analyzed by digestion with 7 U of BstEII (GIBCO BRL) for 1 h at 60°C or with 10 U of HaeIII (GIBCO BRL) for 1 h at 37°C in a 20-µl reaction mixture with the appropriate buffer.

To confirm that the DNA in mummy tissues was still intact after hundreds of years and that the DNA could be detected in and extracted from the dried samples, the GAPDH gene was used as a marker DNA for PCR. Our results showed that DNAs were efficiently isolated from mummy tissues by the 5 M GTC method and that they were adequate for PCR amplification. Human genomic DNA was detected in all samples by PCR with the GAPDH gene (Fig. 1).



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 1. Detection of GAPDH and mycobacterial DNA in mummified tissues. DNAs were extracted from the genital tissues of 12 mummies. The PCR products were examined on a 10% polyacrylamide gel. GAPDH DNA was detected in all mummified tissues, indicating that the DNA was adequate for PCR analysis. DNAs of M. tuberculosis complex were detected in 2 of the 12 samples, and MOTB DNAs were detected in 7 of the 12 samples. Lane M, DNA size markers (PBR322 DNA digested with MspI); lanes 1 to 12, mummy samples; lane P, positive control; lane N, negative control.

In two samples (no. 9 and 11), a 97-bp DNA fragment was detected by PCR (Fig. 1) with primers specific for insertion sequence IS6110, which is unique to the M. tuberculosis complex (14). This fragment was further digested with SalI and gave rise to two expected fragments of 42 and 55 bp (Fig. 2), confirming the presence of M. tuberculosis complex in these two samples. The IS6110 element, which was initially identified from a clinical isolate of M. tuberculosis, is specific for the M. tuberculosis complex (M. tuberculosis, Mycobacterium bovis, and Mycobacterium simiae). Generally, the IS6110 element is present in high copy numbers in most strains of M. tuberculosis and low copy numbers in M. bovis strains (3). The specificity of detecting M. tuberculosis complex by PCR with the primers for IS6110 was confirmed by Eisenach et al. (4). The primers detected strains of M. tuberculosis, M. bovis, and M. simiae. The IS6110 sequence was also detected in mummified tissues (10), and it was found to be identical to that of contemporary M. tuberculosis as reported by Eisenach et al. (4). In this study, we applied nested PCR to detect the IS6110 sequence in ancient DNA in order to increase sensitivity and specificity. Our results confirmed the presence of M. tuberculosis complex in 2 of 12 mummy samples, although we could not determine the species in the M. tuberculosis complex.



View larger version (97K):
[in this window]
[in a new window]
  		FIG. 2. Confirmation of M. tuberculosis complex by SalI digestion. PCR products from two positive samples and one positive control were further digested with SalI and separated on a 10% polyacrylamide gel. We observed two bands (55 and 42 bp), which are identical to those of the positive control (M. tuberculosis). These results confirmed the presence of M. tuberculosis complex in these two samples. Lane M, DNA size markers (PBR322 DNA digested with MspI); lanes 9 and 11, mummy samples 9 and 11, respectively; lane P, positive control (M. tuberculosis).

A 441-bp DNA fragment was amplified in seven samples (no. 1, 2, 3, 5, 6, 9, and 11) (Fig. 1) by using primers specific for the 65-kDa heat shock protein present in all MOTB (9, 13). The DNA fragments were further digested with BstEII and HaeIII to determine the species of MOTB according to the algorithm reported by Telenti et al. (13) and Rastogi et al. (9). Six samples could not be digested by BstEII but were able to be digested with HaeIII and gave rise to a 140-bp band (Fig. 3). Based on band size and patterns, they were considered to be Mycobacterium flavescens I. In one sample (no. 1), two DNA fragments were observed after digestion with BstEII and three fragments were observed after digestion with HaeIII (Fig. 3). With these patterns, the fragments could not be assigned to a specific species. However, we believe that there may be two species present in this sample, i.e., M. flavescens I and another MOTB not included in the algorithm. Since these mycobacteria are present in soil and water, we do not believe that their identification indicates the presence of clinical disease; this is in contrast to M. tuberculosis, which must be considered pathogenic.



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 3. Identification of MOTB by BstEII and HaeIII. PCR products from seven positive samples were further digested with BstEII and HaeIII and separated on a 2.5% agarose gel. A 441-bp band was seen in all seven samples after digestion with BstEII. However, sample 1 gave rise to two bands of 245 and 220 bp. After digestion with HaeIII, a 140-bp band was seen in all samples; however, two bands of 175 and l15 bp were observed in sample 1. The results suggest that M. flavescens I was present in all samples and that there was an additional species present in sample 1. Lane P, positive control (M. leprae); lanes M, DNA size markers; lanes 1, 2, 3, 5, 6, 9, and 11, mummy samples 1, 2, 3, 5, 6, 9, and 11, respectively.

We also tested samples for other infectious agents, including Mycobacterium leprae, Treponema pallidum, Leishmania spp., herpes simplex virus, human papillomavirus, and human T-cell lymphotropic virus type 1. No PCR products were observed.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Molecular Pathology Laboratory, Mount Sinai School of Medicine, Box 1122, One Gustave Levy Pl., New York, NY 10021. Phone: (212) 659-8173. Fax: (212) 427-2082. E-mail: David.Zhang{at}Msnyuhealth.org. Back


arrow
REFERENCES
 
    1
  1. Arriaza, B. T., W. Salo, A. C. Aufderheide, and T. A. Holcomb. 1995. Pre-Columbian tuberculosis in northern Chile: molecular and skeletal evidence. Am. J. Phys. Anthropol. 98:37-45.[CrossRef][Medline]
    2. 2
  2. Baron, H., S. Hummel, and B. Herrmann. 1996. Mycobacterium tuberculosis complex DNA in ancient human bones. J. Archaeol. Sci. 23:667-671.[CrossRef]
    3. 3
  3. Cave, M. D., K. D. Eisenach, P. F. McDermott, J. H. Bates, and J. T. Crawford. 1991. IS6110: conservation of sequence in the Mycobacterium tuberculosis complex and its utilization in DNA fingerprinting. Mol. Cell. Probes 5:73-80.[CrossRef][Medline]
    4. 4
  4. Eisenach, K. D., M. D. Cave, J. H. Bates, and J. T. Crawford. 1990. Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis. J. Infect. Dis. 161:977-981.[Medline]
    5. 5
  5. Haas, C. J., A. Zink, G. Palfi, U. Szeimies, and A. G. Nerlich. 2000. Detection of leprosy in ancient human skeletal remains by molecular identification of Mycobacterium leprae. Am. J. Clin. Pathol. 114:428-436.[Abstract/Free Full Text]
    6. 6
  6. Nerlich, A. G., C. J. Haas, A. Zink, U. Szeimies, and H. G. Hagedorn. 1997. Molecular evidence for tuberculosis in an ancient Egyptian mummy. Lancet 350:1404.[Medline]
    7. 7
  7. Park, Y. N., K. Abe, H. Li, T. Hsuih, S. N. Thung, and D. Y. Zhang. 1996. Detection of hepatitis C virus RNA using ligation-dependent polymerase chain reaction in formalin-fixed, paraffin-embedded liver tissues. Am. J. Pathol. 149:1485-1491.[Abstract]
    8. 8
  8. Rafi, A., M. Spigelman, J. Stanford, E. Lemma, H. Donoghue, and J. Zias. 1994. Mycobacterium leprae DNA from ancient bone detected by PCR. Lancet 343:1360-1361.[CrossRef]
    9. 9
  9. Rastogi, N., K. S. Goh, and M. Berchel. 1999. Species-specific identification of Mycobacterium leprae by PCR-restriction fragment length polymorphism analysis of the hsp65 gene. J. Clin. Microbiol. 37:2016-2019.[Abstract/Free Full Text]
    10. 10
  10. Salo, W. L., A. C. Aufderheide, J. Buikstra, and T. A. Holcomb. 1994. Identification of Mycobacterium tuberculosis DNA in a pre-Columbian Peruvian mummy. Proc. Natl. Acad. Sci. USA 91:2091-2094.[Abstract/Free Full Text]
    11. 11
  11. Spigelman, M., and E. Lemma. 1993. The use of the polymerase chain reaction (PCR) to detect Mycobacterium tuberculosis in ancient skeletons. Int. J. Osteoarchaeol. 3:137-143.
    12. 12
  12. Taylor, G. M., M. Grossey, J. Saldanha, and T. Waldron. 1996. DNA from Mycobacterium tuberculosis identified in mediaeval human skeletal remains using polymerase chain reaction. J. Archaeol. Sci. 23:789-798.[CrossRef]
    13. 13
  13. Telenti, A., F. Marchesi, M. Balz, F. Bally, E. C. Bottger, and T. Bodmer. 1993. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis. J. Clin. Microbiol. 31:175-178.[Abstract/Free Full Text]
    14. 14
  14. Thierry, D., M. D. Cave, K. D. Eisenach, J. T. Crawford, J. H. Bates, B. Gicquel, and J. L. Guesdon. 1990. IS6110, an IS-like element of Mycobacterium tuberculosis complex. Nucleic Acids Res. 18:188.[Free Full Text]
    15. 15
  15. Tokunaga, K., Y. Nakamura, K. Sakata, K. Fujimori, M. Ohkubo, K. Sawada, and S. Sakiyama. 1987. Enhanced expression of a glyceraldehyde-3-phosphate dehydrogenase gene in human lung cancers. Cancer Res. 47:5616-5619.[Abstract/Free Full Text]

Journal of Clinical Microbiology, December 2002, p. 4738-4740, Vol. 40, No. 12
0095-1137/02/$04.00+0     DOI: 10.1128/JCM.40.12.4738-4740.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Sakamoto, J. M., Feinstein, J., Rasgon, J. L. (2006). Wolbachia infections in the cimicidae: museum specimens as an untapped resource for endosymbiont surveys.. Appl. Environ. Microbiol. 72: 3161-3167 [Abstract] [Full Text]  
  • Nair, P.N.R. (2004). PATHOGENESIS OF APICAL PERIODONTITIS AND THE CAUSES OF ENDODONTIC FAILURES. CROBM 15: 348-381 [Abstract] [Full Text]  
  • Drevets, D. A., Leenen, P. J. M., Greenfield, R. A. (2004). Invasion of the Central Nervous System by Intracellular Bacteria. Clin. Microbiol. Rev. 17: 323-347 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Konomi, N.
Right arrow Articles by Zhang, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Konomi, N.
Right arrow Articles by Zhang, D.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»