This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sugita, T.
Right arrow Articles by Nishikawa, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sugita, T.
Right arrow Articles by Nishikawa, A.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, April 2002, p. 1363-1367, Vol. 40, No. 4
0095-1137/02/$04.00+0     DOI: 10.1128/JCM.40.4.1363-1367.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

New Yeast Species, Malassezia dermatis, Isolated from Patients with Atopic Dermatitis

Takashi Sugita,1* Masako Takashima,2 Takako Shinoda,1 Hajime Suto,3 Tetsushi Unno,3 Ryoji Tsuboi,3 Hideoki Ogawa,3 and Akemi Nishikawa4

Department of Microbiology,1 Department of Immunobiology, Meiji Pharmaceutical University, Kiyose,4 Department of Dermatology, School of Medicine, Juntendo University, Bunkyo-ku, Tokyo,3 Japan Collection of Microorganisms, RIKEN (The Institute of Physical and Chemical Research), Wako, Saitama, Japan2

Received 4 September 2001/ Returned for modification 31 December 2001/ Accepted 2 February 2002


arrow
ABSTRACT
 
Malassezia species are considered to be one of the exacerbating factors in atopic dermatitis (AD). During examination of the cutaneous colonization of Malassezia species in AD patients, we found a new species on the surface of the patients' skin. Analysis of ribosomal DNA sequences suggested that the isolates belonged to the genus Malassezia. They did not grow in Sabouraud dextrose agar but utilized specific concentrations of Tween 20, 40, 60, and 80 as a lipid source. Thus, we concluded that our isolates were new members of the genus Malassezia and propose the name Malassezia dermatis sp. nov. for these isolates.


arrow
INTRODUCTION
 
Malassezia species are known causative factors in pityriasis versicolor, seborrheic dermatitis (SD), and atopic dermatitis (AD) (3). In the last decade, research has focused primarily on isolating Malassezia strains and detecting specific immunoglobulin E (IgE) antibodies from patients (9, 13, 14, 26). A comparison of the isolation rates of Malassezia species from the skin of AD patients and healthy control subjects detected a significantly higher rate for patients than for healthy subjects (8). AD patients had specific IgE antibodies against Malassezia, while healthy subjects did not. In recent years, studies have increasingly been directed towards analyzing how the cutaneous microflora at the species level are related to each disease type (pityriasis versicolor, SD, and AD) (1, 6, 7, 12, 16). We previously compared the distribution of Malassezia species in skin lesions of AD patients and in healthy subjects using a nonculture method (nested PCR) that is not affected by the isolating medium (21). Of the seven members of the genus Malassezia, Malassezia globosa and M. restricta were the species most commonly associated with AD, while M. obtusa and M. pachydermatis were not detected in AD. In our survey of cutaneous Malassezia microflora, we isolated new Malassezia species from several patients with AD. In this paper, we propose a new species, M. dermatis, for these isolates.


arrow
MATERIALS AND METHODS
 
Malassezia isolates. Nineteen AD outpatients at Juntendo University Hospital were included in the study. To obtain samples, OpSite transparent dressings (3 by 7 cm; Smith and Nephew Medical Ltd., Hull, United Kingdom) were applied to skin lesions (erosive, erythematous, and lichenoid) on the scalp, back, and nape of the neck of AD patients. Samples were then transferred onto Leeming and Notman agar (LNA) (10.0 g of polypeptone, 5.0 g of glucose, 0.1 g of yeast extract, 8.0 g of ox gall, 1.0 mg of glycerol, 0.5 g of glycerol stearate, 0.5 mg of Tween 60, 10 ml of cow's milk [whole fat], and 12.0 g of agar per liter) plates containing 50 µl of chloramphenicol (Sankyo, Tokyo, Japan) and incubated at 32°C for 2 weeks.

Direct DNA sequencing of rRNA genes of the isolates. Yeast isolates recovered from LNA medium were identified by analysis of rRNA gene sequences. Nuclear DNA of the isolates was extracted by the method of Makimura et al. (15). The D1 and D2 regions of 26S ribosomal DNA (rDNA) and internal transcribed spacer (ITS) regions in the rRNA gene were sequenced directly from PCR products using the primer pairs NL-1 (forward; GCATATCAATAAGCGGAGGAAAAG) and NL-4 (reverse; GGTCCGTGTTTCAAGACGG) (11) and pITS-F (forward; GTCGTAACAAGGTTAACCTGCGG) and pITS-R (reverse; TCCTCCGCTTATTGATATGC) (22), respectively. The PCR products were sequenced using an ABI 310 DNA sequencer and an ABI PRISM BigDye Terminator Cycle Sequencing kit (Perkin-Elmer Applied Biosystems, Foster, Calif.) according to the manufacturer's instructions. Strains with 99% or more similarity of the D1 and D2 regions of 26S rDNA and the overall ITS sequences were defined as conspecific (18, 22). The sequence data were searched using the BLAST system (http://www.ncbi.nlm.nih.gov/BLAST/) at the National Center for Biotechnology Information, Bethesda, Md.

Molecular phylogenetic analysis. The sequences were aligned using ClustalW software (25). For neighbor-joining analysis (20), the distances between sequences were calculated using Kimura's two-parameter model (10). A bootstrap analysis was conducted with 100 replications (2).

Morphological, physiological, and chemotaxonomic characteristics. Morphology was examined on LNA after incubation at 32°C for 7 days. Tween 20, 40, 60, and 80 utilization, catalase reactions, and diazonium blue B reactions were performed as described by Guého et al. (4). Identification of ubiquinone was carried out using methods described by Nakase and Suzuki (17). The nuclear DNA base composition (moles percent G+C) was determined by high-pressure liquid chromatography after enzymatic digestion of DNA into deoxyribonucleosides (23, 24). The DNA-GC kit (Yamasa Shouyu, Chiba, Japan) was used according to the manufacturer's instructions.

Nucleotide sequence accession numbers. The nucleotide sequences determined in this study have been deposited with DDBJ (DNA Data Bank of Japan) under the accession numbers shown in Fig. 1.




View larger version (61K):
[in this window]
[in a new window]
  		FIG. 1. Molecular phylogenetic trees constructed using the sequences of D1 and D2 26S rDNA of M. dermatis sp. nov. and related Ustilaginomycetes species (A) and the ITS1 region of M. dermatis sp. nov. and other member of the genus Malassezia (B). DDBJ/GenBank accession numbers are indicated in parentheses. The numerals represent the confidence levels from 100 replicate bootstrap samplings (frequencies of less than 50% are not indicated). T, type strain. Knuc, Kimura's parameter (10).


arrow
RESULTS
 
Molecular phylogenetic analysis. All of the yeast isolates obtained from the 19 AD patients were identified by analysis of rRNA gene sequences (D1 and D2 regions of 26S rDNA and ITS). Of these, the DNA sequences of five isolates did not match sequences in the DNA sequence database. These isolates were designated M 9927, M 9928, M 9929, M 9930, and M 9931. The first three strains were isolated from a single patient, while the last two strains were isolated from one patient each. Sequence analysis of their 26S rDNA indicated that these isolates belonged to the genus Malassezia (Fig. 1A). The sequences of five isolates were completely identical in both the 26S rDNA and ITS regions and clustered with M. sympodialis with high bootstrap values (100%) (Fig. 1). Dissimilarities between these isolates and the M. sympodialis strain in their D1 and D2 regions of 26S, ITS1, and ITS2 were 1.2% (7 of 578), 10.5% (17 of 162), and 10.3% (24 of 233), respectively. The overall dissimilarity of ITS regions was 10.4% (41 of 395).

Taxonomic characteristics. The characteristics that differentiate the new species, M. dermatis, from the other seven known Malassezia species are summarized in Table 1. The physiological characteristics of M. dermatis are identical to those of M. furfur. However, the moles percent G+C of M. dermatis nuclear DNA is 60.4% while that of M. furfur is 66.0 to 66.7%. A difference of more than 1 mol% G+C between two strains is considered taxonomically significant (19, 24).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Taxonomic characteristics of M. dermatis and other Malassezia species

Latin description of Malassezia dermatis Sugita, Takashima, Nishikawa et Shinoda sp. nov. In LNA, post dies 7 ad 32°C, cellulae vegetativae sphaericae, ovoideae vel ellipsoideae (2-8) x (2-10) µm. Cultura xanthoalba, semi-nitida aut hebetata, butyracea et margo glabra aut lobulata. In agaro glucoso-peptonico Tween 20, 40, 60, 80 (0.1-1%) addito crecit. H2O2 hydrolysatur. Commutatio colori per diazonium caeruleum B positiva. Proportio molaris guanini+cytosini in acido deoxyribonucleico: 60.4 mol%. Ubiquinonum majus: Q-9. Telemorphis ignota. Typus: JCM 11348T, ex cute morbosa, Tokyo, Japonia, 30.9.1999, T. Sugita (originaliter ut M 9927), conservatur in collectionibus culturarum quas ‘Japan Collection of Microorganisms,’ Saitama, Japan sustentat.

Description of M. dermatis Sugita, Takashima, Nishikawa et Shinoda sp. nov. After 7 days on LNA at 32°C, the vegetative cells were spherical, oval, or ellipsoidal (2 to 8 by 2 to 10 µm), and they reproduced by budding (Fig. 2). The colony was yellowish white, semishiny to dull, convex, and butyrous and had an entire or lobed margin. Filaments sometimes formed at the area of the origin of the bud. Growth was seen on glucose-peptone agar with either 0.1, 0.5, 1.0, 5.0, or 10% Tween 20, 40, 60, or 80 as sole source of lipid. Catalase reaction was positive. The diazonium blue B reaction was positive. The G+C content of nuclear DNA was 60.4 mol%, and the major ubiquinone was Q-9. Teleomorph is unknown. JCM 11348T (originally M 9927) isolated from skin lesions of an AD patient in Tokyo, Japan, by T. Sugita on 30 September 1999 is maintained in the Japan Collection of Microorganisms (JCM), Saitama, Japan. The other strains, M 9929 and M 9931 have also been deposited in the JCM, as JCM 11469 and JCM 11470, respectively. Etymology is from the Latin name for skin, from which this strain of the species was obtained.



View larger version (97K):
[in this window]
[in a new window]
  		FIG. 2. Vegetative cells of M. dermatis M 9927 (JCM 11348) grown in LNA for 7 days at 32°C. Bar, 10 µm.


arrow
DISCUSSION
 
The genus Malassezia is phylogenetically monophyletic with a high bootstrap value (100%) and is positioned in the class Ustilaginomycetes (Fig. 1A). Our isolates clustered with M. sympodialis on the tree. We did not perform a nuclear DNA-DNA hybridization study between M. sympodialis and our isolates, but sequence analysis of rDNA (26S and ITS) strongly suggests that our five isolates represent a new species in the genus Malassezia. At present, D1 and D2 26S rDNA sequences are used from almost all yeasts for species identification or phylogenetic analysis. Peterson and Kurtzman (18) correlated the biological species concept with the phylogenetic species concept by the extent of nucleotide substitutions in 26S rDNA sequences. Their study demonstrated that strains of a single biological species show less than 1% substitution in this region. Subsequently, Sugita et al. (22) also found that conspecific strains have less than 1% dissimilarity in the ITS1 and -2 regions after comparing the nuclear DNA-DNA hybridization values and similarity in the sequences of the entire ITS1 and -2 regions. According to the species concept used in the two reports cited above, the divergence between M. sympodialis and our isolates is sufficient to resolve them as individual species. In addition, the approximately 1 mol% difference in the G+C content of nuclear DNA that was found between these two species also has taxonomic significance (19, 24). Guillot et al. (5) described a practical approach (combination of Tween utilization and catalase tests) for easy and simple identification of Malassezia species. Unfortunately, M. dermatis cannot be identified by this system, despite having similar characteristics to M. furfur. At present, sequence analysis of the D1 and D2 regions of the 26S rDNA or the ITS regions is the most reliable and simplest method for M. dermatis identification.

We previously demonstrated cutaneous Malassezia colonization in 32 AD patients by a nonculture method (nested PCR) and compared anti-Malassezia antibody levels with those in healthy subjects. The detection of M. globosa and M. restricta in more than 90% of AD patients suggested that these two species play an important role in AD. Since we were not aware of the existence of M. dermatis at that time, we did not detect the DNA of this species in our previous study. Although the present study examined a limited number of patients, M. dermatis was found in 3 of 19 patients. However, the degree of M. dermatis colonization of the skin surface in the AD patients was not as great as that of M. globosa and M. restricta.

In conclusion, we described a novel species, M. dermatis, isolated from skin lesions of AD patients. Further studies should examine whether this microorganism is responsible for AD or other skin diseases and whether it is specific to Japan.


arrow
ACKNOWLEDGMENTS
 
This study was supported in part by a Grant for the Promotion of the Advancement of Education and Research in Graduate Schools from the Ministry of Education, Culture, Sports, Science, and Technology of Japan.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology, Meiji Pharmaceutical University, 2-522-1 Noshio, Kiyose, Tokyo 204-8588, Japan. Phone: 81-424-95-8762. Fax: 81-424-95-8762. E-mail: sugita{at}my-pharm.ac.jp. Back


arrow
REFERENCES
 
    1
  1. Aspiroz, C., L. A. Moreno, A. Rezusta, and C. Rubio. 1999. Differentiation of three biotypes of Malassezia species on human normal skin. Correspondence with M. globosa, M. sympodialis and M. restricta. Mycopathologia 145:69-74.[CrossRef][Medline]
    2. 2
  2. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783-791.[CrossRef]
    3. 3
  3. Guého, E., T. Boekhout, H. R. Ashbee, J. Guillot, A. van Belkum, and J. Faergemann. 1998. The role of Malassezia species in the ecology of human skin and as pathogens. Med. Mycol. 36(Suppl. 1):220-229.
    4. 4
  4. Guého, E., G. Midgley, and J. Guillot. 1996. The genus Malassezia with description of four new species. Antonie van Leeuwenhoek 69:337-355.[CrossRef][Medline]
    5. 5
  5. Guillot, J., E. Guého, M. Lesourd, G. Midgley, G. Chevrier, and B. Dupont. 1996. Identification of Malassezia species. J. Mycol. Med. 6:103-110.
    6. 6
  6. Gupta, A. K., Y. Kohli, J. Faergemann, and R. C. Summerbell. 2001. Epidemiology of Malassezia yeasts associated with pityriasis versicolor in Ontario, Canada. Med. Mycol. 39:199-206.[Medline]
    7. 7
  7. Gupta, A. K., Y. Kohli, R. C. Summerbell, and J. Faergemann. 2001. Quantitative culture of Malassezia species from different body sites of individuals with or without dermatoses. Med. Mycol. 39:243-251.[Medline]
    8. 8
  8. Hiruma, M., D. J. Maeng, M. Kobayashi, H. Suto, and H. Ogawa. 1999. Fungi and atopic dermatitis. Jpn. J. Med. Mycol. 40:79-83.
    9. 9
  9. Kim, T. Y., I. G. Jang, Y. M. Park, H. O. Kim, and C. W. Kim. 1999. Head and neck dermatitis: the role of Malassezia furfur, topical steroid use and environmental factors in its causation. Clin. Exp. Dermatol. 24:226-231.[CrossRef][Medline]
    10. 10
  10. Kimura, M. 1980. A simple method for estimation evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. E 16:111-120.
    11. 11
  11. Kurtzman, C. P., and C. J. Robnett. 1997. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene. J. Clin. Microbiol. 35:1216-1223.[Abstract]
    12. 12
  12. Leeming, J. P., J. E. Sansom, and J. L. Burton. 1997. Susceptibility of Malassezia furfur subgroups to terbinafine. Br. J. Dermatol. 137:764-767.[CrossRef][Medline]
    13. 13
  13. Leung, D. Y. 1995. Atopic dermatitis: the skin as a window into the pathogenesis of chronic allergic diseases. J. Allergy Clin. Immunol. 96:302-318.[CrossRef][Medline]
    14. 14
  14. Lintu, P., J. Savolainen, and K. Kalimo. 1997. IgE antibodies to protein and mannan antigens of Pityrosporum ovale in atopic dermatitis patients. Clin. Exp. Allergy 27:87-95.[CrossRef][Medline]
    15. 15
  15. Makimura, K., Y. S. Murayama, and H. Yamaguchi. 1994. Detection of a wide range of medically important fungal species by polymerase chain reaction (PCR). J. Med. Microbiol. 40:358-364.[Abstract/Free Full Text]
    16. 16
  16. Nakabayashi, A., Y. Sei, and J. Guillot. 2000. Identification of Malassezia species isolated from patients with seborrhoeic dermatitis, atopic dermatitis, pityriasis versicolor and normal subjects. Med. Mycol. 38:337-341.[Medline]
    17. 17
  17. Nakase, T., and M. Suzuki. 1986. Bullera megalospora, a new species of yeast forming large ballistospores isolated from dead leaves of Oryza sativa, Miscanthus sinensis, and Sasa sp. in Japan. J. Gen. Appl. Microbiol. 32:225-240.
    18. 18
  18. Peterson, S. W., and C. P. Kurtzman. 1991. Ribosomal RNA sequence divergence among sibling species of yeasts. Syst. Appl. Microbiol. 14:124-129.
    19. 19
  19. Price, C. W., G. B. Fuson, and H. J. Phaff. 1978. Genome comparison in yeast systematics: delimitation of species within the genera Schwanniomyces, Saccharomyces, Debaryomyces, and Pichia. Microbiol. Rev. 42:161-193.[Free Full Text]
    20. 20
  20. Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. E 4:406-425.
    21. 21
  21. Sugita, T., H. Suto, T. Unno, R. Tsuboi, H. Ogawa, T. Shinoda, and A. Nishikawa. 2001. Molecular analysis of Malassezia microflora on the skin of atopic dermatitis patients and healthy subjects. J. Clin. Microbiol. 39:3486-3490.[Abstract/Free Full Text]
    22. 22
  22. Sugita, T., A. Nishikawa, R. Ikeda, and T. Shinoda. 1999. Identification of medically relevant Trichosporon species based on sequences of internal transcribed spacer regions and construction of a database for Trichosporon identification. J. Clin. Microbiol. 37:1985-1993.[Abstract/Free Full Text]
    23. 23
  23. Takashima, M., and T. Nakase. 2000. Four new species of the genus Sporobolomyces isolated from leaves in Thailand. Mycoscience 41:65-77.
    24. 24
  24. Tamaoka, J., and K. Komagata. 1984. Determination of DNA base composition by reversed-phase high-performance liquid chromatography. FEMS Microbiol. Lett. 25:125-128.
    25. 25
  25. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]
    26. 26
  26. Wessels, M. W., G. Doekes, A. G. Van Ieperen-Van Kijk, W. J. Koers, and E. Young. 1991. IgE antibodies to Pityrosporum ovale in atopic dermatitis. Br. J. Dermatol. 125:227-232.[CrossRef][Medline]

Journal of Clinical Microbiology, April 2002, p. 1363-1367, Vol. 40, No. 4
0095-1137/02/$04.00+0     DOI: 10.1128/JCM.40.4.1363-1367.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Gonzalez, A., Sierra, R., Cardenas, M. E., Grajales, A., Restrepo, S., Cepero de Garcia, M. C., Celis, A. (2009). Physiological and Molecular Characterization of Atypical Isolates of Malassezia furfur. J. Clin. Microbiol. 47: 48-53 [Abstract] [Full Text]  
  • Kaneko, T., Makimura, K., Abe, M., Shiota, R., Nakamura, Y., Kano, R., Hasegawa, A., Sugita, T., Shibuya, S., Watanabe, S., Yamaguchi, H., Abe, S., Okamura, N. (2007). Revised Culture-Based System for Identification of Malassezia Species. J. Clin. Microbiol. 45: 3737-3742 [Abstract] [Full Text]  
  • Diaz, M. R., Boekhout, T., Theelen, B., Bovers, M., Cabanes, F. J., Fell, J. W. (2006). Microcoding and flow cytometry as a high-throughput fungal identification system for Malassezia species.. J Med Microbiol 55: 1197-1209 [Abstract] [Full Text]  
  • Paulino, L. C., Tseng, C.-H., Strober, B. E., Blaser, M. J. (2006). Molecular analysis of fungal microbiota in samples from healthy human skin and psoriatic lesions.. J. Clin. Microbiol. 44: 2933-2941 [Abstract] [Full Text]  
  • Gaitanis, G., Chasapi, V., Velegraki, A. (2005). Novel Application of the Masson-Fontana Stain for Demonstrating Malassezia Species Melanin-Like Pigment Production In Vitro and in Clinical Specimens. J. Clin. Microbiol. 43: 4147-4151 [Abstract] [Full Text]  
  • Sugita, T., Tajima, M., Ito, T., Saito, M., Tsuboi, R., Nishikawa, A. (2005). Antifungal Activities of Tacrolimus and Azole Agents against the Eleven Currently Accepted Malassezia Species. J. Clin. Microbiol. 43: 2824-2829 [Abstract] [Full Text]  
  • Cabanes, F. J., Hernandez, J. J., Castella, G. (2005). Molecular Analysis of Malassezia sympodialis-Related Strains from Domestic Animals. J. Clin. Microbiol. 43: 277-283 [Abstract] [Full Text]  
  • Gupta, A. K., Boekhout, T., Theelen, B., Summerbell, R., Batra, R. (2004). Identification and Typing of Malassezia Species by Amplified Fragment Length Polymorphism and Sequence Analyses of the Internal Transcribed Spacer and Large-Subunit Regions of Ribosomal DNA. J. Clin. Microbiol. 42: 4253-4260 [Abstract] [Full Text]  
  • Velegraki, A., Alexopoulos, E. C., Kritikou, S., Gaitanis, G. (2004). Use of Fatty Acid RPMI 1640 Media for Testing Susceptibilities of Eight Malassezia Species to the New Triazole Posaconazole and to Six Established Antifungal Agents by a Modified NCCLS M27-A2 Microdilution Method and Etest. J. Clin. Microbiol. 42: 3589-3593 [Abstract] [Full Text]  
  • Hirai, A., Kano, R., Makimura, K., Duarte, E. R., Hamdan, J. S., Lachance, M.-A., Yamaguchi, H., Hasegawa, A. (2004). Malassezia nana sp. nov., a novel lipid-dependent yeast species isolated from animals. Int. J. Syst. Evol. Microbiol. 54: 623-627 [Abstract] [Full Text]  
  • Odds, F., Ausma, J., Van Gerven, F., Woestenborghs, F., Meerpoel, L., Heeres, J., Vanden Bossche, H., Borgers, M. (2004). In Vitro and In Vivo Activities of the Novel Azole Antifungal Agent R126638. Antimicrob. Agents Chemother. 48: 388-391 [Abstract] [Full Text]  
  • Sugita, T., Takashima, M., Kodama, M., Tsuboi, R., Nishikawa, A. (2003). Description of a New Yeast Species, Malassezia japonica, and Its Detection in Patients with Atopic Dermatitis and Healthy Subjects. J. Clin. Microbiol. 41: 4695-4699 [Abstract] [Full Text]  
  • Sugita, T., Kodama, M., Saito, M., Ito, T., Kato, Y., Tsuboi, R., Nishikawa, A. (2003). Sequence Diversity of the Intergenic Spacer Region of the rRNA Gene of Malassezia globosa Colonizing the Skin of Patients with Atopic Dermatitis and Healthy Individuals. J. Clin. Microbiol. 41: 3022-3027 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sugita, T.
Right arrow Articles by Nishikawa, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sugita, T.
Right arrow Articles by Nishikawa, A.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»