JCM Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Amezaga, M. R.
Right arrow Articles by McKenzie, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Amezaga, M. R.
Right arrow Articles by McKenzie, H.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, September 2002, p. 3313-3318, Vol. 40, No. 9
0095-1137/02/$04.00+0     DOI: 10.1128/JCM.40.9.3313-3318.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Molecular Epidemiology of Erythromycin Resistance in Streptococcus pneumoniae Isolates from Blood and Noninvasive Sites

Maria Rosario Amezaga, Philip E. Carter,,{dagger} Phillip Cash, and Hamish McKenzie*

Department of Medical Microbiology, University of Aberdeen, Aberdeen AB25 2ZD, Scotland, United Kingdom

Received 3 April 2002/ Returned for modification 28 May 2002/ Accepted 25 June 2002


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Erythromycin-resistant isolates of Streptococcus pneumoniae from blood cultures and noninvasive sites were studied over a 3-year period. The prevalence of erythromycin resistance was 11.9% (19 of 160) in blood culture isolates but 4.2% (60 of 1,435) in noninvasive-site isolates. Sixty-two of the 79 resistant isolates were available for study. The M phenotype was responsible for 76% (47 of 62) of resistance, largely due to a serotype 14 clone, characterized by multilocus sequence typing as ST9, which accounted for 79% (37 of 47) of M phenotype resistance. The ST9 clone was 4.8 times more common in blood than in noninvasive sites. All M phenotype isolates were PCR positive for mef(A), but sequencing revealed that the ST9 clone possessed the mef(A) sequence commonly associated with Streptococcus pyogenes. All M phenotype isolates with this mef(A) sequence also had sequences consistent with the presence of the Tn1207.1 genetic element inserted in the celB gene. In contrast, isolates with the mef(E) sequence normally associated with S. pneumoniae contained sequences consistent with the presence of the mega insertion element. All MLSB isolates carried erm(B), and two isolates carried both erm(B) and mef(E). Fourteen of the 15 MLSB isolates were tetracycline resistant and contained tet(M). However, six M phenotype isolates of serotypes 19 (two isolates) and 23 (four isolates) were also tetracycline resistant and contained tet(M). MICs for isolates with the mef(A) sequence were significantly higher than MICs for isolates with the mef(E) sequence (P < 0.001). Thus, the ST9 clone of S. pneumoniae is a significant cause of invasive pneumococcal disease in northeast Scotland and is the single most important contributor to M phenotype erythromycin resistance.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
There are two commonly described mechanisms of erythromycin resistance: active drug efflux and methylation of the antibiotic target site. In Streptococcus pneumoniae these result in two major phenotypes, M and MLSB (18, 30, 34). M phenotype isolates are resistant to macrolides via an active efflux mechanism that requires the presence of the mef(A) gene (30, 34, 35). This gene was first identified in Streptococcus pyogenes and originally designated mef(A), while a similar gene with 90% identity to mef(A) was later identified in S. pneumoniae and designated mef(E) (4, 35). More recently, it has been proposed that these two genes are members of the same family and should be referred to by the generic label of mef(A) (30). The product of the mef(A) gene has not been directly characterized, but its predicted amino acid sequence shows homology with other transporter proteins (4). Santagati et al. (31) described, in a clinical isolate of S. pneumoniae, a 7.244-kb chromosomal element, Tn1207.1 that contained 8 open reading frames (ORFs), one of which (ORF4) was 100% identical to the original mef(A) sequence of S. pyogenes. Downstream from mef(A), ORF5 coded for a protein that showed homology to MsrA, an ATP-binding protein that mediates resistance to macrolides and streptogramin B in staphylococci. Upstream from mef(A), ORF2 was thought to represent an integrase or site-specific recombinase, although Tn1207.1 was considered a defective transposon because it terminates at the 3' end in a truncated ORF. In the isolate studied, Tn1207.1 was inserted in the pneumococcal genome within the competence gene celB. A further 5.4- or 5.5-kb chromosomal insertion element has recently been described by Gay and Stephens (12) and has been designated the macrolide efflux genetic assembly (mega). mega contains 5 ORFs, of which ORF1 is identical to the original mef(E) sequence of S. pneumoniae. As with Tn1207.1, there is also a homologue of the msr(A) gene downstream from mef(E) designated mel, after the first three amino acids of the predicted protein (12). The sequences of the two msr(A) homologues found in Tn1207.1 and mega are 98% identical. The five ORFs of mega show a high degree of identity with ORFs 4 to 8 of Tn1207.1, but mega does not contain ORFs with integrase or recombinase homology. PCR studies on 89 mef(E)-positive clinical isolates from Atlanta revealed that there are more than four different insertion sites for mega in the pneumococcal genome. None of the four insertion sites identified were in the celB gene (12).

In the MLSB phenotype, resistance to the structurally unrelated macrolide, lincosamide, and streptogramin B antibiotics is brought about by methylation of 23S rRNA, the common target of these agents (18). MLSB resistance is determined by members of the erm gene family, and in S. pneumoniae the erm(B) gene is usually carried on the 25.3-kb conjugative transposon Tn1545 along with a separate gene, tet(M), that codes for tetracycline resistance (5, 30). Transfer of Tn1545 between strains is mediated by the excisionase (xis) and integrase (int) genes (28). Other transposable elements such as Tn917-like elements and the composite transposon-like structure Tn3872 can also carry erm(B) in S. pneumoniae (19).

The prevalence of erythromycin resistance in S. pneumoniae has increased in several countries over the past few years (13, 17, 24). However, there are considerable differences between countries in the relative contributions of the M and MLSB phenotypes to the overall prevalence of resistance. Surveys in the United States show a predominance of the M phenotype (8, 13), while in Italy (24), Belgium (7), and Germany (29) the MLSB phenotype is more common. A survey of S. pneumoniae bacteremia carried out in our laboratory showed that the prevalence of erythromycin-resistant isolates was 12% and that 75% of these isolates had the M phenotype (21). All of the M phenotype isolates belonged to serotype 14 and had very similar profiles on pulsed-field gel electrophoresis (21). The aim of the present study was to compare the prevalence of the two major erythromycin resistance phenotypes in pneumococcal isolates from blood and from noninvasive sites. We serotyped all erythromycin-resistant isolates and identified the resistance genes and associated insertion elements by PCR and sequencing.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Bacterial isolates. All bacterial isolates, unless otherwise stated, were cultured from clinical specimens submitted to the routine diagnostic laboratories of the Department of Medical Microbiology, University of Aberdeen, Aberdeen, United Kingdom. Over a 3-year period, from 1998 to 2000, all blood culture isolates of S. pneumoniae and all erythromycin-resistant isolates from other sites were collected. S. pneumoniae was identified by alpha-hemolysis on blood agar and sensitivity to optochin, and erythromycin resistance was detected in the first instance by disk diffusion (39). Isolates were serotyped by the Scottish Pneumococcal Reference Laboratory, Stobhill Hospital, Glasgow, United Kingdom, by coagglutination (33); selected isolates were also characterized by multilocus sequence typing (MLST) (10, 11) by the same laboratory. Isolates from sites other than blood, designated noninvasive, were obtained from the upper respiratory tract, sputum, eye swabs, and ear swabs. We obtained details on all pneumococci isolated during the study period from the computer database of our diagnostic laboratory and thus obtained baseline figures for the number of isolates from sites other than blood. A small number of isolates from invasive sites other than blood, e.g., cerebrospinal fluid, were excluded, and duplicate isolates from the same episode of infection in any one patient were counted only once.

Three S. pneumoniae M phenotype isolates (serotype 14) from the South of England (M44, M47, and M58), two from Australia (M231 and M238), and one from Belgium (M27) were kindly supplied by M. C. Enright and B. G. Spratt, Wellcome Trust Centre for the Epidemiology of Infectious Disease, Department of Zoology, Oxford University, Oxford, United Kingdom. Three susceptible isolates (serotype 14) from Australia (M222, M229, and M237) were also obtained from the same source. The isolates donated are all listed in the MLST database (http://www.mlst.net) as sequence type 9 (ST9).

Isolates were stored at -70°C in Protect (TSC Ltd., Heywood, United Kingdom) and recovered when required by culture on blood agar plates at 37°C in air with 5% CO2. Resistance to erythromycin and the resistance phenotype were confirmed by disk diffusion assay with the disks adjacent to detect inducible resistance (34). Erythromycin MICs were determined by E-test (AB Biodisk, Solna, Sweden) according to the manufacturer's recommendations. S. pneumoniae strain ATCC 49619 was tested simultaneously as a quality control, and the MIC for this strain was within the manufacturer's recommended range. MICs were also determined by broth microdilution according to the guidelines of the National Committee for Clinical Laboratory Standards (NCCLS) (23), except that additional antibiotic concentrations of 3, 6, 12, and 24 mg/liter were added to the recommended test range.

PCR. S. pneumoniae cells were harvested from one confluent blood agar plate. Chromosomal DNA was extracted from cell suspensions by the method of Pitcher et al. (27) or with a DNA extraction kit for gram-positive bacteria (Puregene; Gentra Systems, Minneapolis, Minn.). The mef(A) gene was amplified by using primers based on the published sequence of S. pyogenes (4) (5' ATGGAAAAATACAACAATTG [forward] and 5' TTATTTTAAATCTAATTTTCTAAC [reverse]). PCR conditions for amplification of the mef(A) gene comprised an initial denaturation step at 94°C for 4 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 50°C for 30 s, and elongation at 72°C for 30 s. After the amplification cycles, a final elongation step at 72°C for 5 min was carried out. The primer set used to amplify the erm(B) gene was based on the erythromycin resistance gene carried in the conjugative transposon Tn1545 from S. pneumoniae (36) and consisted of 5' ATTGGAACAGGTAAAGGGC (forward) and 5' GAACATCTGTGGTATGGCG (reverse). PCR conditions for amplification of the erm(B) gene comprised an initial denaturation step at 94°C for 4 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 57°C for 30 s, and elongation at 72°C for 1 min. After the amplification cycles, a final elongation step was performed at 72°C for 7 min. The homologue of msr(A) was amplified by using primers based on the sequence of this gene contained in the transposable element Tn1207.1 of S. pneumoniae (GenBank accession number AF227520), 5' TGCCTATATTCCCCAGTT (forward) and 5' TTAATTTCCGCACCGACTA (reverse). PCR conditions for amplification of the msr(A) homologue comprised an initial denaturation step at 94°C for 4 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 50°C for 1 min, and elongation at 72°C for 1 min. After the amplification cycles, a final elongation step at 72°C for 10 min was carried out.

To establish whether the transposable element carrying mef(A) in our isolates had the same insertion site as Tn1207.1, specific PCR primers were designed. The forward primer, 5' CTTTCCTTTCTCTATCCA, lies upstream of the known insertion site of Tn1207.1 in the celB gene (31) (GenBank accession number AF052208). The reverse primer, 5' TACATCAACATTACCATCTG, was based on the 5'-end sequence of Tn1207.1 (GenBank accession number AF227520). Amplification conditions were the same as for the msr(A) homologue.

Primers for the tet(M) (5' AGTTTTAGCTCATGTTGATG [forward] and 5' TCCGACTATTTGGACGACGG [reverse]) and int (5' GCGTGATTGTATCTCACT [forward] and 5' GACCTCCTGTTGCTTCT [reverse]) genes were as described by Doherty et al. (9). Primers for the xis gene, 5' AAGCAGACTGACATTCCTA (forward) and 5' GCGTCCAATGTATCTATAA (reverse), were based on the sequence of this gene available in the database (GenBank accession number X61025). PCR conditions for amplification of tet(M) comprised an initial denaturation step at 94°C for 4 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 1 min, and elongation at 72°C for 1 min, 30 s. After the amplification cycles, a final elongation step at 72°C for 10 min was carried out. Conditions for amplification of int and xis were the same as those used for the msr(A) homologue.

All PCR amplification mixtures contained 100 ng of genomic DNA, forward and reverse primers (250 nM), MgCl2 (1.5 mM), deoxynucleoside triphosphates (200 µM; Amersham Pharmacia Biotech UK Ltd., Little Chalfont, United Kingdom), and Taq polymerase (5 U) plus buffer (Bioline, London, United Kingdom). PCR was performed on a Perkin-Elmer (PE) Biosystems (Warrington, United Kingdom) 9700 Thermocycler. PCR products were detected by electrophoresis on agarose gels, followed by staining with ethidium bromide and UV transillumination.

DNA sequence analysis. PCR amplification products were purified by using Centricon C100 columns (Millipore UK Ltd., Watford, United Kingdom). Purified PCR products were sequenced by using the corresponding amplification primers. In addition, a specific region of interest within the tet(M) gene was sequenced in both directions by using internal sequencing primers 5' CGAACTTTACCGAATCTGAA (forward) and 5' CAACGGAAGCGGTGATACAG (reverse); these were based on the published sequence of tet(M) (GenBank accession number X90939). Sequencing reactions were performed by using the BigDye Terminator cycle sequencing kit (PE Biosystems) according to the manufacturer's instructions. Sequencing products were run on an ABI 377 automated DNA sequencer, and sequencing analysis was carried out with the SeqEd 1.0.3 DNA analysis program (PE Biosystems).

Statistical analysis. The significance of differences in the distribution of isolates between blood and noninvasive sites was determined by the chi-square test, and the significance of differences between erythromycin MICs was determined by the Mann-Whitney test. Both tests were performed with the SPSS statistical package.


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Erythromycin resistance in S. pneumoniae isolates from blood and noninvasive sites. Over the 3-year study period, there were 160 isolates of S. pneumoniae from blood and 1,435 from other sites. Nineteen blood isolates (11.9%) were erythromycin resistant, and 18 of these were available for confirmation of phenotype and further study. The prevalence of erythromycin resistance was much lower in isolates from noninvasive sites. Sixty of the 1,435 isolates (4.2%) were erythromycin resistant, and 44 of these were available for confirmation of phenotype and further study. The distribution of resistance phenotypes and serotypes among available isolates from blood and noninvasive sites is shown in Table 1. The M phenotype was responsible for 76% (47 of 62) of erythromycin resistance overall, largely due to the contribution of M phenotype, serotype 14 (M14) isolates, which accounted for 60% (37 of 62) of all resistant isolates and 79% (37 of 47) of M phenotype resistance. In contrast, MLSB isolates were responsible for 24% (15 of 62) of erythromycin resistance and were distributed across serotypes 6, 14, 15, 19, and 23 (Table 1).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Distribution of resistance phenotypes and serotypes in erythromycin-resistant S. pneumoniae isolates collected from blood (n = 160) and noninvasive sites (n = 1,435)

 
The M14 clone was responsible for 83% (15 of 18) of erythromycin resistance in blood isolates but 50% (22 of 44) of resistance in isolates from other sites. All M14 isolates were penicillin susceptible (data not shown). If we assume that the distribution of resistance phenotypes was the same in isolates which were not available for examination as in those that were, then 10% of blood isolates were M14 (16 of 160) compared with 2.1% of isolates from noninvasive sites (30 of 1,435). Thus, the M14 clone was proportionately 4.8 times more common in blood than in noninvasive sites, and this difference is statistically significant (P < 0.001 by the chi-square test).

Resistance genes in erythromycin-resistant isolates. All M phenotype isolates and one erythromycin-susceptible isolate from blood were PCR positive for the mef(A) gene. Sequence analysis revealed that the mef(A) gene carried by all M14 isolates and by one isolate of serotype 9 was 100% identical to the mef(A) sequence originally described for S. pyogenes (GenBank accession number U70055), and all these isolates carried the sequence of the msr(A) homologue found in Tn1207.1 (GenBank accession number AF227520) (Table 2). All isolates with this mef(A) sequence were positive by PCR with primers designed to amplify Tn1207.1 when inserted into the celB gene (31). All remaining M phenotype isolates of serotypes 9, 19, and 23 carried the mef(E) sequence originally described for S. pneumoniae (GenBank accession number U83667). These isolates all carried mel, the msr(A) homologue found in the transposable element mega (GenBank accession number AF274302) (Table 2). Isolates with the mega sequence did not produce a PCR product with primers designed to amplify Tn1207.1 when inserted into the celB gene. All MLSB isolates were erm(B) positive by PCR. Two serotype 19 noninvasive isolates, included in Table 1 as MLSB phenotype isolates, contained both the mef(E) and erm(B) genes (Table 2).


View this table:
[in this window]
[in a new window]
  		TABLE 2. Distribution of resistance-related genes and transposable elements in erythromycin-resistant S. pneumoniae isolates

 
Tetracycline resistance. Tetracycline resistance is commonly associated with the MLSB phenotype, since the tet(M) and erm(B) genes are both found on the Tn1545 transposon. Fourteen of the 15 MLSB isolates were resistant to tetracycline and were PCR positive for tet(M) (Table 2). Nine of these 14 isolates were also PCR positive for int and xis, the integrase and excisionase genes commonly associated with Tn1545; 4 isolates were negative for both int and xis, and 1 isolate was positive only for xis. One MLSB isolate of serotype 23 was susceptible to tetracycline. This isolate was positive for tet(M) by PCR, but sequence analysis of the PCR product demonstrated a 10-bp deletion from base 619 to 628 (this deletion was also found in an isolate with the same phenotype collected in our laboratory in 1997). The tetracycline-susceptible isolate was PCR positive for int and xis. Six M phenotype isolates of serotypes 19 (two isolates) and 23 (four isolates) were also tetracycline resistant and were PCR positive for tet(M), int, and xis (Table 2).

Erythromycin MICs for M phenotype isolates. Erythromycin MICs for all resistant isolates were determined by E-test and by broth microdilution (NCCLS). By broth microdilution, median erythromycin MICs were 12 mg/liter (range, 8 to 24 mg/liter) for 38 M phenotype isolates with the mef(A) sequence and 4 mg/liter (range, 2 to 8 mg/liter) for 9 isolates with the mef(E) sequence. By E-test, median MICs were 20 mg/liter (range, 12 to 32 mg/liter) for 38 M phenotype isolates with the mef(A) sequence and 3 mg/liter (range, 2 to 4 mg/liter) for 9 isolates with the mef(E) sequence. The difference in MICs between mef(A) and mef(E) isolates was statistically significant by both methods (P < 0.001 by the Mann-Whitney test).

Comparison with isolates from other geographical locations. To determine whether the mef(A) sequence found in our Scottish M14 isolates reflected a local phenomenon, we sequenced the gene in M14 isolates from other locations, three from the south of England, two from Australia, and one from Belgium. All six isolates also carried the mef(A) sequence. Erythromycin MICs for these isolates by E-test were in the range of 12 to 32 mg/liter, similar to that of the local M14 clone. It has previously been shown by pulsed-field gel electrophoresis analysis that the profiles of our Scottish M14 isolates are very similar to those of isolates from the south of England (21). The serotype 14 isolates from England, Australia, and Belgium have all been previously characterized by MLST as ST9 and belong to an M phenotype clone associated with meningitis in the United Kingdom (10, 11) (http://www.mlst.net). MLST analysis of nine representative isolates from our local M14 clone confirmed that they were also ST9.


   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
This study demonstrates that the M phenotype is the commonest form of erythromycin resistance in northeast Scotland, largely due to the predominance of a serotype 14 clone that has been characterized by MLST as ST9. Thus, the phenotypic pattern of erythromycin resistance observed in the United Kingdom is closer to that of the United States than to that of other European countries, with M phenotype resistance at least three times more prevalent than MLSB resistance overall. We have demonstrated that the ST9 clone is 4.8 times more common in blood than in other sites and is therefore more invasive than the average S. pneumoniae isolate. The ST9 clone has also been identified as an important cause of meningitis throughout the United Kingdom (10, 15, 37), and this clone is now recognized as a cause of invasive disease in other countries (http://www.mlst.net). There are many virulence factors other than the capsule involved in the pathogenesis of pneumococcal infection (14), and there is evidence that particular strains of pneumococci have a predilection for blood and cerebrospinal fluid (16). Further characterization of invasive clones such as ST9 will help to explain this process and may in the future offer targets for treatment or prevention of invasive pneumococcal disease. An increase in the expression of a variant form of the enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in our M14 clone, now known to be ST9, has been demonstrated previously (3). In other species such as S. pyogenes and Staphylococcus aureus, GAPDH is located in the cell wall and is associated with virulence (22, 25, 26, 38). The role of GAPDH in the pathogenicity of the ST9 clone is therefore worthy of further study.

The mef(A) genes of S. pneumoniae and S. pyogenes were found initially to be different and were designated mef(E) and mef(A), respectively. We have shown that an unusual characteristic of the ST9 clone is that it possesses the mef(A) sequence normally associated with S. pyogenes. The original S. pyogenes sequence [mef(A)] was reported for four isolates of S. pneumoniae from Italy (24), and more recently it has been reported for a further 17 isolates, also from Italy (6). Conversely, there is a report of the original pneumococcal sequence [mef(E)] in a single isolate of S. pyogenes (2), and we have also observed this (data not shown). A survey of erythromycin-resistant viridans streptococci found the mef(E) sequence in S. mitis, S. oralis, and S. anginosus, while the mef(A) sequence was found in only one isolate of S. oralis (1). Thus, the potential for the spread of M phenotype resistance in S. pneumoniae is increased by the widespread presence of the mef(A) gene in other, less pathogenic species. The original characterization of Tn1207.1 showed that it was associated with the mef(A) sequence (31), and our data confirmed that all pneumococcal isolates with the S. pyogenes mef(A) sequence contained Tn1207.1. In contrast, the nine M phenotype isolates with the pneumococcal mef(E) sequence contained the mega insertion element. It seems likely, therefore, that the two mef(A) sequences are associated with different transposable elements. In support of this conclusion, Del Grosso et al. have also demonstrated an association between mef(A) sequence and genetic element in six Italian isolates (6).

Our results indicate that the erythromycin MIC for pneumococci possessing mef(A) together with the associated transposable element Tn1207.1 is higher than that for pneumococci possessing mef(E) in association with mega. Gay and Stephens (12) demonstrated that in the transposable element mega, the mef(E) gene is cotranscribed with mel, the msr(A) homologue. In staphylococci, msr(A) encodes an ATP-binding cassette that provides energy for the efflux of macrolides and streptogramin B. Thus, the erythromycin MIC may be influenced not only by the Mef(A) protein but also by the actions of the MsrA homologue. Different sites of insertion in the genome may also result in different rates of transcription. However, relatively few of our isolates contained the mef(E) gene sequence, and therefore further studies are required to confirm the MIC difference.

Resistance to tetracycline is a common characteristic of the MLSB phenotype because the erm(B) and tet(M) genes can be found on the same transposon, Tn1545. The presence of both resistance genes erm(B) and mef(A) in MLSB isolates has been described previously (20), and these isolates are expected to be resistant to tetracycline. In contrast, mef(A) in M phenotype isolates is not known to be linked to tetracycline resistance. We have shown that M phenotype isolates of serotypes 19 and 23 can carry the tet(M) gene and other elements of Tn1545, such as int and xis, without possessing the erm(B) gene. Similar findings were reported for Spanish isolates (32). In this study we have identified a 10-bp deletion in the sequence of the tet(M) gene of an MLSB isolate that was susceptible to tetracycline, relative to the tet(M) sequence in tetracycline-resistant isolates. Susceptibility to tetracycline in MLSB isolates has been reported for Spanish isolates, but these isolates did not possess the tet(M) gene (32). Our data show that tetracycline resistance is not a reliable guide to MLSB phenotype erythromycin resistance, since we found both M phenotypes that were resistant to tetracycline and MLSB phenotypes that were susceptible to tetracycline.

In conclusion, the present study has demonstrated the clinical importance in our region of an M phenotype, serotype 14 clone of S. pneumoniae that has invasive properties and for which MICs are higher than for other M phenotype isolates. The clone has been identified as ST9 and has been isolated in other parts of the world. Further characterization of this clone may yield further insights into both invasiveness and the detailed mechanisms of M phenotype resistance.


   ACKNOWLEDGMENTS
 
M. R. Amezaga was funded by the Chief Scientist Office, Scottish Executive (project K/MRS/50/C2714).

We are grateful for the technical assistance of Evelyn Argo, Linda Ford, Rosie Allan, and Kenny Reay and for statistical advice from Neil Scott. Preliminary sequence data for the S. pneumoniae genome were obtained from the Institute of Genomic Research through the website at http://www.tigr.org. This publication made use of the MLST website (http://www.mlst.net) developed by Man-Suen Chan and sited at the Wellcome Trust Centre for the Epidemiology of Infectious Diseases. The development of this site is funded by the Wellcome Trust.


   FOOTNOTES
 
* Corresponding author. Mailing address: Department of Medical Microbiology, University of Aberdeen, Medical School Buildings, Foresterhill, Aberdeen AB25 2ZD, Scotland, United Kingdom. Phone: 1224 552446. Fax: 1224 685604. E-mail: mmb041{at}abdn.ac.uk. Back

{dagger} Present address: Institute of Environmental Science and Research Ltd., Kenepuru Science Centre, Porirua, New Zealand. Back


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Arpin, C., M.-H. Canron, J. Maugein, and C. Quentin. 1999. Incidence of mefA and mefE genes in viridans group streptococci. Antimicrob. Agents Chemother. 43:2335-2336.[Free Full Text]
  2. Arpin, C., M.-H. Canron, P. Noury, and C. Quentin. 1999. Emergence of mefA and mefE genes in beta-haemolytic streptococci and pneumococci in France. J. Antimicrob. Chemother. 44:133-138.[Free Full Text]
  3. Cash, P., E. Argo, L. Ford, L. Lawrie, and H. McKenzie. 1999. A proteomic analysis of erythromycin resistance in Streptococcus pneumoniae. Electrophoresis 20:2259-2268.[CrossRef][Medline]
  4. Clancy, J., J. Petitpas, F. Dib-Haji, W. Yuan, M. Cronan, A. V. Kamath, J. Bergeron, and J. A. Retsema. 1996. Molecular cloning and functional analysis of a novel macrolide-resistance determinant, mefA, from Streptococcus pyogenes. Mol. Microbiol. 22:867-879.[CrossRef][Medline]
  5. Clewell, D. B., S. E. Flannagan, and D. D. Jaworski. 1995. Unconstrained bacterial promiscuity: the Tn916-Tn1545 family of conjugative transposons. Trends Microbiol. 3:229-236.[CrossRef][Medline]
  6. Del Grosso, M., F. Iannelli, C. Messina, M. Santagati, N. Petrosillo, S. Stefani, G. Pozzi, and A. Pantosti. 2002. Macrolide efflux genes mef(A) and mef(E) are carried by different genetic elements in Streptococcus pneumoniae. J. Clin. Microbiol. 40:774-778.[Abstract/Free Full Text]
  7. Descheemaeker, P., S. Chapelle, C. Lammens, M. Hauchecorne, M. Wijdooghe, P. Vandamme, M. Ieven, and H. Goosens. 2000. Macrolide resistance and erythromycin resistance determinants among Belgian Streptococcus pyogenes and Streptococcus pneumoniae isolates. J. Antimicrob. Chemother. 45:167-173.[Abstract/Free Full Text]
  8. Doern, G. V., K. P. Heilmann, H. K. Huynh, P. R. Rhomberg, S. L. Coffman, and A. B. Brueggemann. 2001. Antimicrobial resistance among clinical isolates of Streptococcus pneumoniae in the United States during 1999-2000, including a comparison of resistance rates since 1994-1995. Antimicrob. Agents Chemother. 45:1721-1729.[Abstract/Free Full Text]
  9. Doherty, N., K. Trzcinski, P. Pickerill, P. Zawadzki, and C. G. Dowson. 2000. Genetic diversity of the tet(M) gene in tetracycline-resistant clonal lineages of Streptococcus pneumoniae. Antimicrob. Agents Chemother. 44:2979-2984.[Abstract/Free Full Text]
  10. Enright, M. C., and B. G. Spratt. 1998. A multilocus sequence typing scheme for Streptococcus pneumoniae: identification of clones associated with serious invasive disease. Microbiology 144:3049-3060.[Abstract]
  11. Enright, M. C., and B. G. Spratt. 1999. Multilocus sequence typing. Trends Microbiol. 7:482-487.[CrossRef][Medline]
  12. Gay, K., and D. S. Stephens. 2001. Structure and dissemination of a chromosomal insertion element encoding macrolide efflux in Streptococcus pneumoniae. J. Infect. Dis. 284:56-65.
  13. Gay, K., W. Baughman, Y. Miller, D. Jackson, C. G. Whitney, A. Schuchat, M. M. Farley, F. Tenover, and D. S. Stephens. 2000. The emergence of Streptococcus pneumoniae resistant to macrolide antibiotic agents: a 6-year population based assessment. J. Infect. Dis. 182:1417-1424.[CrossRef][Medline]
  14. Gillespie, S. H., and I. Balakrishnan. 2000. Pathogenesis of pneumococcal infection. J. Med. Microbiol. 49:1057-1067.[Abstract/Free Full Text]
  15. Hall, L. M. C., R. A. Whiley, B. Duke, R. C. George, and A. Efstratiou. 1996. Genetic relatedness within and between serotypes of Streptococcus pneumoniae from the United Kingdom: analysis of multilocus enzyme electrophoresis, pulsed-field gel electrophoresis, and antimicrobial resistance patterns. J. Clin. Microbiol. 34:853-859.[Abstract]
  16. Hausdorff, W. P., J. Bryant, C. Kloek, P. R. Paradiso, and G. R. Siber. 2000. The contribution of specific pneumococcal serogroups to different disease manifestations. Clin. Infect. Dis. 30:122-140.[CrossRef][Medline]
  17. Johnson, A. P., D. C. E. Speller, R. C. George, M. Warner, G. Domingue, and A. Efstratiou. 1996. Prevalence of antibiotic resistance and serotypes in pneumococci in England and Wales in 1990 and 1995. Br. Med. J. 312:1454-1456.[Abstract/Free Full Text]
  18. Leclercq, R., and P. Courvalin. 1991. Bacterial resistance to macrolide, lincosamide, and streptogramin antibiotics by target modification. Antimicrob. Agents Chemother. 35:1267-1272.[Free Full Text]
  19. McDougal, L. K., F. C. Tenover, L. N. Lee, J. K. Rasheed, J. E. Patterson, J. H. Jorgensen, and D. J. LeBlanc. 1998. Detection of Tn917-like sequences within a Tn916-like conjugative transposon (Tn3872) in erythromycin-resistant isolates of Streptococcus pneumoniae. Antimicrob. Agents Chemother. 42:2312-2318.[Abstract/Free Full Text]
  20. McGee, L., K. P. Klugman, A. Wasas, T. Capper, A. Brink, and The Antibiotics Surveillance Forum of South Africa. 2001. Serotype 19F multiresistant pneumococcal clone harboring two erythromycin resistance determinants, erm(B) and mef(A), in South Africa. Antimicrob. Agents Chemother. 45:1595-1598.[Abstract/Free Full Text]
  21. McKenzie, H., N. Reid, and R. S. Dijkhuizen. 2000. Clinical and microbiological epidemiology of Streptococcus pneumoniae bacteraemia. J. Med. Microbiol. 49:361-366.[Abstract/Free Full Text]
  22. Modun, B., and P. Williams. 1999. The staphylococcal transferrin binding protein is a cell wall glyceraldehyde-3-phosphate dehydrogenase. Infect. Immun. 67:1086-1092.[Abstract/Free Full Text]
  23. National Committee for Clinical Laboratory Standards. 2000. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard M7-A5, 5th ed. National Committee for Clinical Laboratory Standards, Wayne, Pa.
  24. Oster, P., A. Zanchi, S. Cresti, M. Lattanzi, F. Montagnani, C. Cellesi, and G. M. Rossolini. 1999. Patterns of macrolide resistance determinants among community-acquired Streptococcus pneumoniae isolates over a 5-year period of decreased macrolide susceptibility rates. Antimicrob. Agents Chemother. 43:2510-2512.[Abstract/Free Full Text]
  25. Pancholi, V., and V. A. Fischetti. 1992. A major surface protein on group A streptococci is a glyceraldehyde-3-phosphate dehydrogenase with multiple binding activity. J. Exp. Med. 176:415-426.[Abstract/Free Full Text]
  26. Pancholi, V., and V. A. Fischetti. 1993. Glyceraldehyde-3-phosphate dehydrogenase on the surface of group A streptococci is also an ADP-ribosylating enzyme. Proc. Natl. Acad. Sci. USA 90:8154-8158.[Abstract/Free Full Text]
  27. Pitcher, D. G., N. A. Saunders, and R. J. Owen. 1989. Rapid extraction of bacterial genomic DNA with guanidium thiocyanate. Lett. Appl. Microbiol. 8:151-156.
  28. Poyart-Salmeron, C., P. Trieu-Cuot, C. Carlier, and P. Courvalin. 1990. The integration-excision system of the conjugative transposon Tn1545 is structurally and functionally related to those of lambdoid phages. Mol. Microbiol. 4:1513-1521.[Medline]
  29. Reinert, R. R., S. Simic, A. Al-Lahham, S. Reinert., M. Lemperle, and R. Lutticken. 2001. Antimicrobial resistance of Streptococcus pneumoniae recovered from outpatients with respiratory tract infections in Germany from 1998 to 1999: results of a national surveillance study. J. Clin. Microbiol. 39:1187-1189.[Abstract/Free Full Text]
  30. Roberts, M. C., J. Sutcliffe, P. Courvalin, L. B. Jensen, J. Rood, and H. Seppala. 1999. Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants. Antimicrob. Agents Chemother. 43:2823-2830.[Free Full Text]
  31. Santagati, M., F. Iannelli, M. R. Oggioni, S. Stefani, and G. Pozzi. 2000. Characterization of a genetic element carrying the macrolide efflux gene mef(A) in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 44:2585-2587.[Abstract/Free Full Text]
  32. Seral, C., F. J. Castillo, M. C. Rubio-Calvo, A. Fenoll, C. Garcia, and R. Gomez-Lus. 2001. Distribution of resistance genes tet(M), aph3'-III, catpC194 and the integrase gene of Tn1545 in clinical Streptococcus pneumoniae harbouring erm(B) and mef(A) genes in Spain. J. Antimicrob. Chemother. 47:863-866.[Abstract/Free Full Text]
  33. Smart, L. E. 1986. Serotyping of Streptococcus pneumoniae strains by coagglutination. J. Clin. Pathol. 39:328-331.[Abstract/Free Full Text]
  34. Sutcliffe, J., A. Tait-Kamradt, and L. Wondrack. 1996. Streptococcus pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive to clindamycin: a common resistance pattern mediated by an efflux system. Antimicrob. Agents Chemother. 40:1817-1824.[Abstract]
  35. Tait-Kamradt, A., J. Clancy, M. Cronan, F. Dib-Haji, L. Wondrack, W. Yuan, and J. Sutcliffe. 1997. mefE is necessary for erythromycin-resistant M phenotype in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 41:2251-2255.[Abstract]
  36. Trieu-Cuot, P., C. Poyart-Salmeron, C. Carlier, and P. Courvalin. 1990. Nucleotide sequence of the erythromycin resistance gene of the conjugative transposon Tn1545. Nucleic Acids Res. 18:3660.[Free Full Text]
  37. Urwin, G., M. F. Yuan, L. M. C. Hall, K. Brown, and A. Efstratiou. 1996. Pneumococcal meningitis in the North East Thames Region UK: epidemiology and molecular analysis of isolates. Epidemiol. Infect. 117:95-102.[Medline]
  38. Winram, S. B., and R. Lottenberg. 1996. The plasmin binding protein Plr of group A streptococci is identified as glyceraldehyde-3-phosphate dehydrogenase. Microbiology 142:2311-2320.[Abstract]
  39. Working Party of the British Society for Antimicrobial Chemotherapy. 1991. A guide to sensitivity testing. J. Antimicrob. Chemother. 27(Suppl. D):1-50.[Free Full Text]

Journal of Clinical Microbiology, September 2002, p. 3313-3318, Vol. 40, No. 9
0095-1137/02/$04.00+0     DOI: 10.1128/JCM.40.9.3313-3318.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Amezaga, M. R.
Right arrow Articles by McKenzie, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Amezaga, M. R.
Right arrow Articles by McKenzie, H.

Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Antimicrob. Agents Chemother. Clin. Microbiol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS