This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hardick, J.
Right arrow Articles by Gaydos, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hardick, J.
Right arrow Articles by Gaydos, C.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, December 2003, p. 5619-5622, Vol. 41, No. 12
0095-1137/03/$08.00+0     DOI: 10.1128/JCM.41.12.5619-5622.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Use of the Roche LightCycler Instrument in a Real-Time PCR for Trichomonas vaginalis in Urine Samples from Females and Males

Justin Hardick,1 Samuel Yang,2 Shin Lin,2 Della Duncan,1,3 and Charlotte Gaydos1*

Division of Infectious Disease,1 Department of Emergency Medicine, Johns Hopkins University School of Medicine,2 Baltimore City Health Department, Baltimore, Maryland3

Received 25 June 2003/ Returned for modification 26 August 2003/ Accepted 21 September 2003


arrow
ABSTRACT
 
Trichomonas vaginalis is the agent of a highly prevalent sexually transmitted infection (STI) that can result in vaginitis, urethritis, and preterm birth. Traditional methods of diagnosis, including wet preparation, can be unreliable. In this study, we describe the adaptation of an existing PCR method for specific detection of T. vaginalis DNA into a rapid real-time PCR assay based on fluorescence resonance energy transfer (FRET) probe chemistry. The FRET-based assay described demonstrated high sensitivity with a detection limit of 1.06 organisms, as well as a high specificity. A total of 253 urine samples collected prospectively from both men and women were tested for T. vaginalis DNA with both the FRET-based assay and a previously validated PCR assay. When the validated PCR assay was used as the "gold standard" and after discrepancies had been resolved, our FRET-based assay demonstrated an analytical sensitivity and specificity of 90.1 and 100%, respectively. Overall results suggest that FRET-based assays can provide rapid, accurate, and high-throughput detection of T. vaginalis and may prove useful in clinical settings and for large-scale screening programs.


arrow
INTRODUCTION
 
Trichomonas vaginalis is the most common nonviral sexually transmitted disease organism in the world (14). Infections in women cause vaginitis, cervicitis, and urethritis; those in men cause urethritis and prostatitis. Additionally, T. vaginalis has been considered a risk marker for other sexually transmitted agents, such as Chlamydia trachomatis and Neisseria gonorrhoeae (14, 15), and has been implicated as a cofactor in the transmission of the human immunodeficiency virus (17). Other reported associations include preterm labor and cervical cancer (2, 21). A rapid, highly sensitive detection assay for T. vaginalis is needed from both clinical and public health perspectives.

The conventional methods for diagnosing T. vaginalis involve the direct microscopic examination of wet-mount preparations or culture-based systems. However, despite their high specificity, the former are limited by poor sensitivity. The latter have the disadvantage of prolonged turnaround time (20). In addition, both methods are inherently limited because they rely on the organism to be viable for proper detection.

Moreover, clinicians must obtain a vaginal specimen to perform standard tests for wet preparation and culture. Developing an assay for urine would be desirable. Such a method would confer the advantages of easy procurement, transport, and storage of patient samples. Additionally, a portion of the collected urine could be used for other validated sexually transmitted disease tests, such as those for C. trachomatis and N. gonorrhoeae (1).

Several PCR assays have been described to detect T. vaginalis in both vaginal and urine specimens from infected patients (6, 7, 10, 11, 15, 18). Given the undertreatment of T. vaginalis based on standard detection methods, these new PCR-based techniques hold great potential for significantly improving the number of infected patients treated (11).

Traditional PCR methods require postamplification detection of products, which can be error prone, laborious, and/or time consuming (11). The recent advent of real-time PCR has improved accuracy and eliminated the need for any postamplification processing (3, 5). Real-time PCRs couple amplification with detection and are reported by the threshold cycle number (Ct), or the crossing point at which the PCR product accumulates significantly over baseline levels, as detected by interaction with fluorogenic probes. By saving time and labor, a real-time PCR method has the potential for rapid, large-scale screening of patients at risk for T. vaginalis. In this report, we describe the development and validation of a real-time PCR assay for detection of T. vaginalis in urine based on fluorescence resonance energy transfer (FRET) chemistry on a LightCycler platform.


arrow
MATERIALS AND METHODS
 
T. vaginalis strains for positive controls and standards. The three strains used as positive controls and standards in the real-time PCR assays were collected randomly from women who visited the Druid Hill Health Center in Baltimore, Md., and tested positive for T. vaginalis by the Inpouch T. vaginalis culture system (Biomed Diagnostics, San Jose, Calif.) with all identifiers removed from patient samples. One milliliter of the Inpouch culture was mixed with 9 ml of Fuji Trichomonas medium (Remel, Lenexa, Kans.) and incubated for 24 h at 37°C. The culture was then centrifuged (800 x g) for 10 min, and 9 ml of supernatant was removed from the culture. Of the remaining 1 ml of the concentrated culture, a 25-µl aliquot was diluted with Evans blue, and T. vaginalis organisms were counted in a hemocytometer to determine the organism concentration (number per milliliter). To stabilize the T. vaginalis DNA, an additional 50-µl aliquot was subjected to DNA extraction by the Chelex method (16) and was frozen before serial dilution and use as a PCR standard.

Clinical specimens and DNA extractions. Urine samples (n = 253) were randomly collected prospectively as part of an ongoing clinical study for C. trachomatis, N. gonorrhoeae, and T. vaginalis testing. The Johns Hopkins University Institutional Review Board and the Baltimore City Health Department approved this study. The sample group was of young (<25-year-old), sexually active high school students and was presumably a high-risk group for T. vaginalis infection. No other demographic information was available, as all patient identifiers were unlinked from these clinical samples prior to analysis by the different PCR methods. Both male and female urine samples were collected. These samples were subjected to an automated DNA extraction process with a MagNA Pure LC instrument (Roche Diagnostics, Indianapolis, Ind.). Reagents from the MagNA Pure LC DNA isolation kit I (Roche) were used, and DNA extraction was carried out according to the instructions supplied for the MagNA Pure LC program. Positive control DNA and PCR standards were thawed, serially diluted, and extracted by using the MagNA Pure LC in an identical manner. Negative controls consisting of sterile molecular-grade water or carrier DNA were also extracted in the same manner.

Design of PCR primers and probes. The real-time PCR assay design was based on FRET probe chemistry. A previously published T. vaginalis-specific primer set, BTUB9 (5'CATTGATAACGAAGCTCTTTACGAT3') and BTUB2 (5' GCATGTTGTGCCGGACATAACCAT3'), recognizing a 112-bp target within the ß-tubulin gene of the T. vaginalis organism was utilized as the basis for development of primers for the BTUB FRET PCR assay (11). The BTUB9/2 primer set used in touchdown enzyme time release (TETR) PCR had a sensitivity of 97% and a specificity of 98% for female vaginal samples (11). The TETR PCR and primer set have been utilized in additional studies involving male urine and female vaginal samples (18, 19).

A modified primer set (BTUB9/B) was utilized in the FRET-based real-time PCR assay. Primer BTUB2 was altered to primer BTUB B (5'CGCATGTTGTGCCGGACA3') in order to prevent stem-loop formation between primers BTUB9 and BTUB2. The primer set BTUB9 and BTUB B was used in conjunction with two newly designed FRET probes, BTUB FL (5' CCGTACACTCAAGCTCACAACACCAAC-FL3') and BTUB LC (5'LCRed640-CGGCGATCTTAACCACCTTGTTTCC3'). All primers and FRET probes were designed and manufactured by TIB Molbiol LLC (Adelphia, N.J.).

PCR conditions. TETR PCR was performed as previously described with PCR products analyzed by gel electrophoresis and was initially considered the "gold standard" (11).

The BTUB FRET PCR was performed with the LC FastStart master hybridization probe kit (Roche) in a LightCycler (Roche). Amplifications reactions were carried out in a total volumes of 20 µl at 3 mM MgCl2 (1.6 µl per reaction), 20 pM (each) primers (BTUB9 and BTUB B at 1 µl of each primer per reaction), 20 pM (each) FRET probes (BTUB FL and BTUB LC at 1 µl of each probe per reaction), 2 µl of template DNA, and 1x LC FastStart DNA master hybridization probe buffer (2 µl per reaction). The cycling conditions used were as follows: 95°C for 10 min, followed by 50 cycles of 95°C for 10 s, 55°C for 10 s, and 72°C for 5 s. A final cooling step of 3 min at 40°C was included for handling of the samples, because the LightCycler has no cooling block like many commercially available thermocyclers. Data collection was performed during the annealing phase of each amplification cycle, and the fluorescent signal was monitored through the F2 channel. Data were analyzed with LightCycler software by the Fit Point method to minimize noise and obtain the best correlation coefficient possible between standards. Positives were defined as samples having a Ct of less than 40 cycles and significant fluorescent gain when compared to the standard of lowest T. vaginalis concentration.

Reproducibility studies. In order to determine the reproducibility of the assay, intra-assay and interassay precision were measured. Six concentrations of T. vaginalis DNA were extracted with the Roche Magna Pure LC robot, and two researchers performed five replicates of the BTUB FRET assay per concentration on different days. Variability is shown as the standard deviation (SD). Statistical and regression analyses were carried out with STATA version 7.0 (Stata Corp., College Station, Tex.) and Sigma Plot software (SPSS Inc., Chicago, Ill.).

Specificity testing. DNA from the following organisms were evaluated with the BTUB FRET assay to determine T. vaginalis specificity: Trichomonas tenax (ATCC 30207), Trichomonas foetus (ATCC 30003), C. trachomatis (ATCC VR1477), and N. gonorrhoeae (ATCC FA1090).

Discrepancy analysis. Samples that tested positive by the TETR PCR and were initially considered true positives. For the purposes of resolving discrepancies, samples which tested positive by only one of the two PCRs were adjudicated by PCR testing with a third primer set, TVK3 and TVK4, utilizing gel electrophoresis for end-point analysis (9). Samples that were positive by two of the three PCRs were then considered true positives for recalculation of resolved sensitivity and specificity.


arrow
RESULTS
 
The detection limit of the BTUB FRET PCR assay was determined by amplifying serial dilutions of T. vaginalis genomic DNA corresponding to 40.8 to 0.255 T. vaginalis organisms per PCR. Runs that contained 40.8, 4.08, 1.02, and 0.255 T. vaginalis organisms per reaction replicated 100% (6 of 6), 100% (6 of 6), 62.5% (10 of 16) and 33% (2 of 6) of the time, respectively. Calculated concentrations of 47.1 ± 7.5 (mean ± SD), 3.3 ± 0.97, 1.2 ± 0.34, and 0.3 ± 0.07 T. vaginalis organisms per PCR were obtained for the standards of 40.8, 4.08, 1.02 and 0.255 T. vaginalis organisms per PCR, respectively. Mean Ct values were 28.4 ± 1.3, 33.5 ± 1.9, 35.2 ± 3.2, and 35.4 ± 2.9 for the 40.8, 4.08, 1.02, and 0.255 standards, respectively.

Two researchers tested five replicates of standards with various concentrations of T. vaginalis organisms. Results for both technicians are shown in Table 1.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Reproducibility of the BTUB FRET PCR assay

To gauge reproducibility, a multiple linear regression was performed to create standard curves corresponding to the two runs. Ct was regressed on log concentrations and other covariates that allowed the intercepts and slopes of the standard curves corresponding to the two runs to differ. Analysis showed the fitted lines to be statistically different [F(2,50) = 5; P = 0.01]. However, the differences were quite small; for example, the y intercepts of the regression lines were found to differ by 0.1 cycle, a practically insignificant discrepancy.

The specificity of the primers and probes of the BTUB FRET assay was assessed with genomic DNA extracted from T. tenax, T. foetus, C. trachomatis, and N. gonorrhoeae. No signal was detected for any of these organisms (data not shown).

A total of 253 urine samples were tested with the BTUB FRET PCR over 13 separate runs, all of which had positive (serially diluted standards) and negative controls. The negative control accounted for background fluorescence of the assay, thereby reducing false positives.

Initially, using TETR PCR as the gold standard, there were 15 samples that tested positive by both TETR PCR and BTUB FRET PCR. Five samples were positive by TETR PCR and negative by the BTUB FRET PCR. Four samples were positive by the BTUB FRET PCR and negative by TETR PCR. There were also 229 samples that tested negative by both methods. Thus, the initial sensitivity of the BTUB FRET PCR was found to be 75.0% (15 of 20) (95% confidence interval [CI], 50.9 to 91.3%) and the specificity was 98.3% (229 of 233) (95% CI, 95.7 to 99.5%). The initial positive predictive value (PPV) and negative predictive value (NPV) were calculated to be 78.9% (15 of 19) (95% CI, 54.4 to 94.0%) and 97.8% (229 of 234) (95% CI, 95.1 to 99.3%), respectively (Table 2). After discrepancy resolution of discordant samples with primer set TVK3 and TVK4, all four samples that were positive by BTUB FRET and negative by TETR PCR were confirmed to be true positives. Of the five samples that were positive by TETR PCR and negative by BTUB FRET PCR, three were confirmed to be true negatives, while two confirmed as true positives. Thus, the resolved sensitivity of the BTUB FRET PCR was 90.5% (19 of 21) (95% CI, 69.6 to 98.8%); the resolved specificity was 100% (232 of 232) (95% CI, 98.4 to 100%). The resolved PPV and NPV were 100% (19 of 19) (95% CI, 82.4 to 100%) and 99.1% (232 of 234) (95% CI, 96.9, 99.9%), respectively (Table 2). Under the same new standard, TETR PCR was found to be 81% sensitive (17 of 21) (95% CI, 58.1 to 94.6%) and 98.7% (232 of 235) (95% CI, 96.3 to 99.7%) specific with a PPV of 85% (17 of 20) (95% CI, 62.1 to 96.8%) and an NPV of 98.3% (229 of 233) (95% CI, 95.7 to 99.5%).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Initial and resolved sensitivity and specificity of the BTUB FRET assay


arrow
DISCUSSION
 
The BTUB FRET PCR system represents an improvement over other reported PCR systems tested with urine. With true positives defined as samples having two detectable amplifications from three sets of PCR primers, our study demonstrated the BTUB FRET PCR system to be comparable, in terms of sensitivity and specificity, to TETR PCR, which used a similar set of primers and traditional gel-based methods for amplification detection (11). A recent study utilizing TETR PCR for analysis of male urine specimens found that the sensitivity of TETR PCR was superior to that of culture, but confirmation by another PCR occurred in a limited number of cases, indicating that TETR PCR could be improved upon (19).

Some reports suggest that using discrepancy analysis to resolve sensitivity and specificity incorporates positive bias into these calculations (12, 13). However, another report suggests that the bias incorporated into these calculations is minimal, particularly when the culture specificity approaches 100% (4). Due to the labor and time involved, the BTUB FRET PCR assay was not compared to culture, which is a potential limitation of that study. Both amplified tests utilized as dual gold standards in this study have specificities approaching 100% and have been previously compared to T. vaginalis culture (9, 11).

The BTUB FRET PCR system shows marked improvement in assay time over other methods, including TETR PCR. Given that amplification and detection occur concomitantly, real-time PCR assays require less time, and labor, than methods in which post-PCR processing is necessary. However, even among real-time systems, the BTUB FRET PCR is markedly faster. For example, Jordan et al. reported a real-time PCR assay tested with vaginal samples (6). At 40 cycles, their TaqMan PE Thermocycler-based system took about 2.5 h to complete. By using LightCycler technology, runs of the BTUB FRET PCR assay were completed in under 30 min at 50 cycles. Additionally, assay time is also improved by utilizing the Roche Magna Pure LC robot for DNA extraction. The robot is capable of extracting 32 samples, including standards and negative controls, in 90 min, yielding a total assay time of approximately 2 h, a vast improvement over traditional methods.

Even with the extremely short cycle time, the LightCycler-based system was found to be robust. Reproducibility experiments involving the separate work of two different researchers showed that although derived standard curves were statistically different, the discrepancies were trivially small. Moreover, with standard numbers of replicates, the detection limit of the system was found to be consistently between one and four T. vaginalis organisms per PCR, which is comparable to the limit of another reported real-time method for T. vaginalis detection (6). Although not directly comparable, the sensitivity and specificity of the BTUB FRET PCR in urine approach the sensitivity (97.8%) and specificity (97.4%) of the other real-time assay utilizing vaginal swabs for sample collection (6). Although the sensitivity of the BTUB FRET PCR was lower (90.4%), the specificity was higher (100%).

Ultimately, a quick, accurate assay for urine samples is needed to make high-throughput screening for T. vaginalis possible. Culture may be the gold standard, but it is inherently limited because it relies on the organism to be viable for proper detection. Additionally, culture results can be subject to interpretation by the viewer, whereas PCR offers a more definitive result. Traditional gel-based PCR assays have been found to be less accurate with urine samples than with vaginal swabs (10). Employment of an enzyme-linked immunosorbent assay as the post-PCR amplification detection method has been reported to improve the sensitivity and specificity in urine to 90.8 and 93.4%, respectively, and the sensitivity and specificity of the BTUB FRET PCR are comparable to those obtained by enzyme-linked immunosorbent assay (8). The BTUB FRET PCR offers improved accuracy over traditional PCR assays in urine samples. It has the potential for accuracy comparable to those assays for vaginal swabs, and these features are coupled with decreased assay time due to the elimination of post-PCR processing. Although future studies comparing the accuracy of the BTUB FRET PCR system to the true gold standard, i.e., culture, are required, the BTUB FRET PCR system has the potential to be an accurate, high-throughput means of testing for T. vaginalis infection.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: 1159 Ross Bldg., 720 Rutland Ave., Baltimore, MD 21205. Phone: (410) 614-0932. Fax: (410) 614-9775. E-mail: cgaydos{at}jhmi.edu. Back


arrow
REFERENCES
 
    1
  1. Carroll, K. C., W. E. Aldeen, M. Morrison, R. Anderson, D. Lee, and S. Mottice. 1998. Evaluation of the Abbott LCx ligase chain reaction assay for detection of Chlamydia trachomatis and Neisseria gonorrhoeae in urine and genital swab specimens from a sexually transmitted disease clinic population. J. Clin. Microbiol. 36:1630-1633.[Abstract/Free Full Text]
  2. 2
  3. Cotch, M. F., J. G. Pastorek, R. P. Nugent, S. L. Hillier, R. S. Gibbs, D. H. Martin, D. A. Eschenbach, R. Edelman, J. C. Carey, J. A. Regan, M. A. Krohn, M. A. Klebanoff, A. V. Rao, and G. G. Rhoads. 1997. Trichomonas vaginalis associated with low birth weight and preterm delivery. Sex. Transm. Dis. 24:353-360.[Medline]
  4. 3
  5. Gerard, C. J., K. Olsson, R. Ramanathan, C. Reading, and E. G. Hanania. 1998. Improved quantitation of minimal residual disease in multiple myeloma using real-time polymerase chain reaction and plasmid-DNA complementarity determining region III standards. Cancer Res. 58:3957-3964.[Abstract/Free Full Text]
  6. 4
  7. Green, T. A., C. M. Black, and R. E. Johnson. 1998. Evaluation of bias in diagnostic-test sensitivity and specificity estimates computed by discrepant analysis. J. Clin. Microbiol. 36:375-381.[Abstract/Free Full Text]
  8. 5
  9. Heid, C. A., J. Stevens, K. J. Livak, and P. M. Williams. 1996. Real time quantitative PCR. Genome Res. 6:986-994.[Abstract/Free Full Text]
  10. 6
  11. Jordan, J. A., D. Lowery, and M. Trucco. 2001. TaqMan-based detection of Trichomonas vaginalis DNA from female genital specimens. J. Clin. Microbiol. 39:3819-3822.[Abstract/Free Full Text]
  12. 7
  13. Kaydos, S. C., H. Swygard, S. L. Wise, A. C. Sena, P. A. Leone, W. C. Miller, M. S. Cohen, and M. M. Hobbs. 2002. Development and validation of a PCR-based enzyme-linked immunosorbent assay with urine for use in clinical research settings to detect Trichomonas vaginalis in women. J. Clin. Microbiol. 40:89-95.[Abstract/Free Full Text]
  14. 8
  15. Kaydos-Daniels, S. C., W. C. Miller, I. Hoffman, T. Banda, W. Dzinyemba, F. Martinson, M. S. Cohen, and M. M. Hobbs. 2003. Validation of a urine-based PCR-enzyme-linked immunosorbent assay for use in clinical research settings to detect Trichomonas vaginalis in men. J. Clin. Microbiol. 41:318-323.[Abstract/Free Full Text]
  16. 9
  17. Kengne, P., F. Veas, N. Vidal, J. L. Rey, G. Cuny. 1994. Trichomonas vaginalis: repeated DNA target for highly sensitive and specific polymerase chain reaction diagnosis. Cell Mol. Biol. (Noisy-le-grand) 40:819-831.[Medline]
  18. 10
  19. Lawing, L. F., S. R. Hedges, J. R. Schwebke. 2000 Detection of trichomonosis in vaginal and urine specimens from women by culture and PCR. J. Clin. Microbiol. 38:3585-3588.[Abstract/Free Full Text]
  20. 11
  21. Madico, G., T. C. Quinn, A. Rompalo, K. T. McKee Jr., and C. A. Gaydos. 1998. Diagnosis of Trichomonas vaginalis infection by PCR using vaginal swab samples. J. Clin. Microbiol. 36:3205-3210.[Abstract/Free Full Text]
  22. 12
  23. McAdam, A. J. 2000. Discrepant analysis: how can we test a test? J. Clin. Microbiol. 38:2027-2029.[Free Full Text]
  24. 13
  25. Miller, W. C. 1998. Bias in discrepant analysis: when two wrongs don't make a right. J. Clin. Epidemiol. 51:219-231.[CrossRef][Medline]
  26. 14
  27. Petrin, D., K. Delgaty, R. Bhatt, and G. Garber. 1998. Clinical and microbiological aspects of Trichomonas vaginalis. Clin. Microbiol. Rev. 11:300-317.[Abstract/Free Full Text]
  28. 15
  29. Riley, D. E., M. C. Roberts, T. Takayama, and J. N. Krieger. 1992. Development of a polymerase chain reaction-based diagnosis of Trichomonas vaginalis. J. Clin. Microbiol. 30:465-472.[Abstract/Free Full Text]
  30. 16
  31. Walsh, P. S., D. A. Metzger, and Higuchi R. 1991. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing of forensic material. BioTechniques 10:506-513.[Medline]
  32. 17
  33. Wang, C. C., R. S. McClelland, and M. Reilly. 2001. The effect of treatment of vaginal infections on shedding of human immunodeficiency virus type 1. J. Infect. Dis. 183:1017-1022.[CrossRef][Medline]
  34. 18
  35. Wendel, K. A., E. J Erbelding, C. A. Gaydos, and A. M Rompalo. 2002. Trichomonas vaginalis polymerase chain reaction compared with standard diagnostic and therapeutic protocols for detection and treatment of vaginal trichomoniasis. Clin. Infect. Dis. 35:576-580.[CrossRef][Medline]
  36. 19
  37. Wendel, K. A., E. J. Erbelding, C. A. Gaydos, and A. M. Rompalo. 2003. Use of urine polymerase chain reaction to define the prevalence and clinical presentation of Trichomonas vaginalis in men attending an STD clinic. Sex. Transm. Infect. 79:151-153.[Abstract/Free Full Text]
  38. 20
  39. Wiese, W., S. R. Patel, S. C. Patel, C. A. Ohl, and C. A. Estrada. 2000. A meta-analysis of the Papanicolaou smear and wet mount for the diagnosis of vaginal trichomoniasis. Am. J. Med. 108:301-308.[CrossRef][Medline]
  40. 21
  41. Zhang, Z. F., S. Graham, S. Z. Yu, J. Marshall, M. Zielezny, Y. X. Chen, M. Sun, S. L. Tang, C. S. Liao, J. L. Xu, et al. 1995. Trichomonas vaginalis and cervical cancer: a prospective study in China. Ann. Epidemiol. 5:325-332.[CrossRef][Medline]


Journal of Clinical Microbiology, December 2003, p. 5619-5622, Vol. 41, No. 12
0095-1137/03/$08.00+0     DOI: 10.1128/JCM.41.12.5619-5622.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Gaydos, C, Maldeis, N E, Hardick, A, Hardick, J, Quinn, T C (2009). Mycoplasma genitalium compared to chlamydia, gonorrhoea and trichomonas as an aetiological agent of urethritis in men attending STD clinics. Sex. Transm. Infect. 85: 438-440 [Abstract] [Full Text]  
  • Sobngwi-Tambekou, J, Taljaard, D, Nieuwoudt, M, Lissouba, P, Puren, A, Auvert, B (2009). Male circumcision and Neisseria gonorrhoeae, Chlamydia trachomatis and Trichomonas vaginalis: observations after a randomised controlled trial for HIV prevention. Sex. Transm. Infect. 85: 116-120 [Abstract] [Full Text]  
  • Gaydos, C A, Hsieh, Y-H, Galbraith, J S, Barnes, M, Waterfield, G, Stanton, B (2008). Focus-on-Teens, sexual risk-reduction intervention for high-school adolescents: impact on knowledge, change of risk-behaviours, and prevalence of sexually transmitted diseases. Int J STD AIDS 19: 704-710 [Abstract] [Full Text]  
  • Simpson, P., Higgins, G., Qiao, M., Waddell, R., Kok, T. (2007). Real-time PCRs for detection of Trichomonas vaginalis {beta}-tubulin and 18S rRNA genes in female genital specimens. J Med Microbiol 56: 772-777 [Abstract] [Full Text]  
  • Hardick, A., Hardick, J., Wood, B. J., Gaydos, C. (2006). Comparison between the Gen-Probe Transcription-Mediated Amplification Trichomonas vaginalis Research Assay and Real-Time PCR for Trichomonas vaginalis Detection Using a Roche LightCycler Instrument with Female Self-Obtained Vaginal Swab Samples and Male Urine Samples. J. Clin. Microbiol. 44: 4197-4199 [Abstract] [Full Text]  
  • Hobbs, M. M., Lapple, D. M., Lawing, L. F., Schwebke, J. R., Cohen, M. S., Swygard, H., Atashili, J., Leone, P. A., Miller, W. C., Sena, A. C. (2006). Methods for Detection of Trichomonas vaginalis in the Male Partners of Infected Women: Implications for Control of Trichomoniasis. J. Clin. Microbiol. 44: 3994-3999 [Abstract] [Full Text]  
  • Van Der Pol, B., Kraft, C. S., Williams, J. A. (2006). Use of an Adaptation of a Commercially Available PCR Assay Aimed at Diagnosis of Chlamydia and Gonorrhea To Detect Trichomonas vaginalis in Urogenital Specimens. J. Clin. Microbiol. 44: 366-373 [Abstract] [Full Text]  
  • Espy, M. J., Uhl, J. R., Sloan, L. M., Buckwalter, S. P., Jones, M. F., Vetter, E. A., Yao, J. D. C., Wengenack, N. L., Rosenblatt, J. E., Cockerill, F. R. III, Smith, T. F. (2006). Real-Time PCR in Clinical Microbiology: Applications for Routine Laboratory Testing. Clin. Microbiol. Rev. 19: 165-256 [Abstract] [Full Text]  
  • Mallat, H., Podglajen, I., Lavarde, V., Mainardi, J.-L., Frappier, J., Cornet, M. (2004). Molecular Characterization of Trichomonas tenax Causing Pulmonary Infection. J. Clin. Microbiol. 42: 3886-3887 [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hardick, J.
Right arrow Articles by Gaydos, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hardick, J.
Right arrow Articles by Gaydos, C.