Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services E-mail this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Felek, S. Articles by Rikihisa, Y. Search for Related Content PubMed PubMed Citation Articles by Felek, S. Articles by Rikihisa, Y.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, February 2003, p. 886-888, Vol. 41, No. 2
0095-1137/03/$08.00+0     DOI: 10.1128/JCM.41.2.886-888.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Transcriptional Analysis of p30 Major Outer Membrane Protein Genes of Ehrlichia canis in Naturally Infected Ticks and Sequence Analysis of p30-10 of E. canis from Diverse Geographic Regions

Suleyman Felek,¹ Russell Greene,² and Yasuko Rikihisa^1*

Department of Veterinary Biosciences, College of Veterinary Medicine, The Ohio State University, Columbus, Ohio 43210-1093,¹ Phoenix Veterinary Internal Medicine Services, Phoenix, Arizona 85028²

Received 12 August 2002/ Returned for modification 23 October 2002/ Accepted 22 November 2002

Top Abstract Text References

 
Rhipicephalus sanguineus ticks transmit Ehrlichia canis, the etiologic agent of canine ehrlichiosis. In experimentally infected ticks, only p30-10 transcript was detected among 22 p30 paralogs encoding immunodominant major outer membrane P30 proteins of E. canis. The present study revealed transcription of p30-10 by E. canis in naturally infected ticks and sequence conservation of p30-10 genes for E. canis from diverse geographic regions.

Top Abstract Text References

 
Ehrlichia canis is the etiologic agent of canine monocytic ehrlichiosis (CME) (5, 9). CME has been recognized as a significant canine disease worldwide and at a higher frequency in tropical and subtropical regions (5, 9). E. canis is primarily transmitted to dogs by nymph and adult stages of the brown dog tick Rhipicephalus sanguineus (2). CME develops in three consecutive phases: acute, subclinical, and chronic. The acute phase lasts 2 to 4 weeks and is characterized by fever, oculonasal discharge, depression, anorexia, weight loss, and lymphadenomegaly with laboratory findings of thrombocytopenia, leukopenia, mild anemia, hypergammaglobulinemia, and increases in serum aminotransferase activities and acute-phase proteins (5, 11). In the subclinical phase of persistent ehrlichial infection, dogs appear normal clinically but abnormalities in laboratory findings may persist. Mild thrombocytopenia and hypergammaglobulinemia may be seen. In the chronic phase, in addition to the clinical signs and laboratory findings of the acute phase, hemorrhages, epistaxis, edema, and hypotensive shock may occur, which are often exacerbated by superinfection with other organisms (5, 9). Without or often even with antibiotic treatment, dogs infected with E. canis remain infected (3, 18). There is no vaccine available for this disease.

E. canis 30-kDa proteins (P30s) are immunodominant major outer membrane proteins that are strongly recognized by sera from naturally and experimentally infected dogs (3, 6, 10). P30s are encoded by a multigene family (6, 7). We found that p30-10 is the only p30 transcribed by the E. canis Oklahoma type strain in experimentally infected R. sanguineus ticks, whereas in the blood of experimentally infected dogs, p30-10 is transcribed with eight other p30 paralogs during the 2-month period after infection (15). However, transcriptional analysis has so far been limited to a single laboratory-maintained strain (Oklahoma strain) and the sequence of the p30-10 gene was determined only in this strain. It is important to examine transcriptional profiles of E. canis in naturally infected ticks and learn the genetic diversity of E. canis strains infecting dogs to design an effective vaccine that will prevent the transmission of E. canis by ticks in the future. Therefore, the present study investigated the expression of p30-10, p30, and p30-3 paralogs by E. canis in naturally infected ticks and analyzed the complete base sequence of p30-10 genes of E. canis in the blood of naturally infected dogs from diverse geographic regions.

A total of 226 R. sanguineus ticks were removed from 59 dogs in 23 different veterinary clinics in Phoenix, Ariz., from October 2001 to March 2002 in a random survey. One to 18 live nymph and/or adult engorged and/or unengorged ticks from each dog were divided into 59 groups. Ticks were kept at room temperature at 95 to 100% relative humidity with a 12-h photoperiod for more than 10 days to digest blood meals prior to specimen preparation. The ticks were ground with a pellet pestle in RLT buffer (Qiagen Inc., Valencia, Calif.), and RNA was extracted from the tick pools by using an RNeasy Protect kit (Qiagen). RNA was treated with DNase and reverse transcribed with SuperScript II reverse transcriptase (Invitrogen, San Diego, Calif.). To find E. canis-infected ticks, cDNA was used as the template for E. canis-specific nested PCR amplification of 16S rRNA as previously described (18). Expression of p30-10, p30, and p30-3 was analyzed in five E. canis 16S rRNA-positive tick pool samples. Template cDNA was subjected to PCR by using 10 pmol of p30-, p30-3-, and p30-10-specific primer pairs (15).

Peripheral blood mononuclear cells were isolated from dog blood samples as described elsewhere (1). Dog blood samples from different clinics were sent to our laboratory for diagnosis. Four E. canis-specific PCR (18)-positive DNA samples from blood of dogs in Arizona, California, New Mexico, and Hawaii were used for this study. An E. canis VDE strain from a naturally infected dog in Venezuela was isolated in our laboratory (16). The strain was cultivated in the DH82 dog macrophage cell line as previously described (16). A QIAmp DNA blood mini kit (Qiagen) was used for extraction of DNA from infected DH82 cells and dog peripheral blood mononuclear cells. To amplify the entire p30-10 gene, several degenerate primers were designed on the basis of a comparison of corresponding regions of E. chaffeensis and E. canis (7), since levels of conservation of intergenic regions flanking the p30-10 gene were unknown among strains of E. canis. After experimental evaluation of a combination of these primers, a DP30-10F1 (TCTTTTATAAAAGGTTTATTAACATG)-DP30-10R1 (AAACTTGAAATAACTTCACATTTTN) combination was selected for amplification of the p30-10 gene. Ten microliters of each template sample was amplified in a 50-µl reaction mixture containing 5 µl of 10x PCR buffer (10 mM Tris-HCl [pH 8.4]-50 mM KCl), 5 µl of 50 mM MgCl₂, 1 µl of 10 mM deoxynucleoside triphosphate mixture, 2.5 U of Taq DNA polymerase (Invitrogen), and 10 pmol of primers DP30-10F1 and DP30-10R1. Amplification was performed in a GeneAmp PCR System 9700 thermal cycler (Perkin-Elmer Applied Biosystems, Norwalk, Conn.) with a three-step program (5 min of denaturation at 94°C; 40 cycles of 1 min of denaturation at 94°C, 1 min of annealing at 55°C, and 1 min of extension at 72°C; and a final extension at 72°C for 10 min). The 954-bp PCR products were extracted from the gel, and DNA was cloned into the PCRII TA cloning vector (Invitrogen). Three clones were sequenced for each sample and each strand.

We focused on ticks attached to dogs, since this population is more likely to transmit E. canis than are ticks field collected by flagging. CME is enzootic in Phoenix, Ariz. (18). Five (8.5%) of 59 groups of R. sanguineus ticks (a total of 11 ticks) were found to be positive for E. canis 16S rRNA. Three groups of ticks removed from dogs in Venezuela were all infected with E. canis (16). Murphy et al. reported that E. canis PCR was positive in two (33.3%) of six groups of R. sanguineus ticks collected from PCR-positive dogs (4). There is no other report on the E. canis infection rate of field-collected ticks. All five groups of naturally infected ticks, including males and females, engorged or unengorged, expressed p30-10 (Fig. 1). The two other most prevalent p30 transcripts found in experimentally infected dog blood, p30 and p30-3 (15), were not detected in the tick specimens (Fig. 1).

View larger version (27K): [in this window] [in a new window]

FIG. 1. mRNA expression of the p30-10, p30, and p30-3 genes of E. canis in naturally infected R. sanguineus tick groups. Total RNA was extracted and subjected to reverse transcription-PCR. The amplified products were separated on agarose gel containing ethidium bromide. Lanes: M, molecular size marker (1 Kb Plus DNA Ladder; Invitrogen); PC, product amplified by PCR with DNA from E. canis Oklahoma as a template and respective primer pairs, used as a positive control for PCR and as a determinant of amplicon size on the gel; NT, no template as a negative control. Sizes of amplified products are indicated on the right. Symbols: +, reverse transcription-PCR with reverse transcriptase; -, without reverse transcriptase. Tick groups: R12 (one engorged female), R13 (two engorged females, one unengorged male), R24 (one male, one semiengorged female), R48 (two males, one semiengorged female), and R56 (two unengorged females).

The full-length p30-10 genes of E. canis from four dog blood DNA samples from several different states of the United States and one VDE DNA culture from Venezuela were amplified, and 954-bp PCR products were sequenced. These sequences were compared to the Oklahoma type strain p30-10 gene sequence. Five p30-10 sequences were 100% identical to the sequence from E. canis Oklahoma. The Hawaii strain contained three base differences resulting in two deduced amino acid changes (Table 1).

View this table: [in this window] [in a new window]

TABLE 1. Nucleotide and deduced amino acid differences among p30-10 genes of E. canis in the blood of dogs from various geographic regions

Several arthropod-transmitted pathogens use antigenic variation for effective transmission and persistence in reservoir mammals (12-14, 17). Antigenic variation presents a challenge in the development of vaccines against vector-borne pathogens. P30s are immunodominant major surface antigens of E. canis encoded by a p30 multigene family. Twenty-two p30 paralogs have been described (7). p30-10 is the only p30 expressed in experimentally infected R. sanguineus ticks. It is expressed in the tick salivary glands and midguts of in both adult female and male ticks and nymphs prior to and after a blood meal, but several p30 paralogs are expressed in dog blood (15). Like E. canis, Borrelia burgdorferi changes its outer surface during its alternating infections in ticks and mammals (14). OspA is abundantly expressed in B. burgdorferi in the guts of blood-feeding ticks. OspA is not expressed in mammals. The current licensed OspA-based Lyme disease vaccine prevents transmission of B. burgdorferi to mammals by neutralizing borreliae in the tick gut after the tick has taken a blood meal (8). We speculated, by analogy, that P30-10 might be a vaccine candidate for the prevention of E. canis transmission from ticks to dogs.

E. canis strain diversity appears to be limited, since 16S rRNA genes were only up to five bases different among the different strains compared (16). Antigenic diversity among different isolates is an important factor in the selection of vaccine candidates. It would be ideal if antigenic epitopes were conserved to protect against all strains. In the present study, p30-10 sequences appeared to be highly conserved among the strains examined. These results suggest that P30-10 is a potential vaccine candidate for the prevention of tick transmission of E. canis, but this remains to be tested.

 
This research was supported by grant RO1AI47407 from the National Institutes of Health, and the Ohio State University Canine Research grant.

We appreciate Kathrine Kovach for assistance in shipping ticks and record keeping, Roger W. Stitch and Elizabeth R. Wagner for maintaining ticks, and Norio Ohashi for help in designing p30-10-specific primers.

 
* Corresponding author. Mailing address: Department of Veterinary Biosciences, College of Veterinary Medicine, The Ohio State University, 1925 Coffey Rd., Columbus, OH 43210-1093. Phone: (614) 292-5661. Fax: (614) 292-6473. E-mail: rikihisa.1{at}osu.edu.

Top Abstract Text References

 

1
1. Felek, S., A. Unver, R. W. Stich, and Y. Rikihisa. 2001. Sensitive detection of Ehrlichia chaffeensis in cell culture, blood, and tick specimens by reverse transcription-PCR. J. Clin. Microbiol. 39:460-463.[Abstract/Free Full Text]
2
2. Groves, M. G., G. L. Dennis, H. L. Amyx, and D. L. Huxsoll. 1975. Transmission of Ehrlichia canis to dogs by ticks (Rhipicephalus sanguineus). Am. J. Vet. Res. 36:937-940.[Medline]
3
3. Iqbal, Z., and Y. Rikihisa. 1994. Reisolation of Ehrlichia canis from blood and tissues of dogs after treatment with doxycycline. J. Clin. Microbiol. 32:1644-1649.[Abstract/Free Full Text]
4
4. Murphy, G. L., S. A. Ewing, L. C. Whitworth, J. C. Fox, and A. A. Kocan. 1998. A molecular and serologic survey of Ehrlichia canis, E. chaffeensis, and E. ewingii in dogs and ticks from Oklahoma. Vet. Parasitol. 79:325-339.[CrossRef][Medline]
5
5. Neer, T. M. 1998. Ehrlichiosis, p. 139-154. In C. E. Greene (ed.), Infectious diseases of dog and cat. 2nd ed., The W. B. Saunders Co., Philadelphia, Pa.
6
6. Ohashi, N., A. Unver, N. Zhi, and Y. Rikihisa. 1998. Cloning and characterization of multigenes encoding immunodominant 30-kDa major outer membrane protein of Ehrlichia canis and application of the recombinant protein for serodiagnosis. J. Clin. Microbiol. 36:2671-2680.[Abstract/Free Full Text]
7
7. Ohashi, N., Y. Rikihisa, and A. Unver. 2001. Analysis of transcriptionally active gene clusters of major outer membrane protein multigene family in Ehrlichia canis and E. chaffeensis. Infect. Immun. 69:2083-2091.[Abstract/Free Full Text]
8
8. Pal, U., R. R. Montgomery, D. Lusitani, P. Voet, V. Weynants, S. E. Malawista, Y. Lobet, and E. Fikrig. 2001. Inhibition of Borrelia burgdorferi-tick interactions in vivo by outer surface protein A antibody. J. Immunol. 166:7398-7403.[Abstract/Free Full Text]
9
9. Rikihisa, Y. 1991. The tribe Ehrlichieae and ehrlichial diseases. Clin. Microbiol Rev. 4:286-308.[Abstract/Free Full Text]
10
10. Rikihisa, Y., S. A. Ewing, and J. C. Fox. 1994. Western blot analysis of Ehrlichia chaffeensis, E. canis, or E. ewingii infection of dogs and humans. J. Clin. Microbiol. 32:2107-2112.[Abstract/Free Full Text]
11
11. Rikihisa, Y., S. Yamamoto, I. Kwak, Z. Iqbal, J. Mott, and G. Kociba. 1994. Plasma C reactive protein and 1-acid glycoprotein concentrations in dogs infected with Ehrlichia canis. J. Clin. Microbiol. 32:912-917.[Abstract/Free Full Text]
12
12. Rurangirwa, F. R., D. Stiller, and G. H. Palmer. 2000. Strain diversity in major surface protein 2 expression during tick transmission of Anaplasma marginale. Infect. Immun. 68:3023-3027.[Abstract/Free Full Text]
13
13. Schwan, T. G., and B. J. Hinnebusch. 1998. Bloodstream- versus tick-associated variants of a relapsing fever bacterium. Science 280:1938-1940.[Abstract/Free Full Text]
14
14. Schwan, T., J. Piesman, W. T. Golde, M. C. Dolan, and P. A. Rosa. 1995. Induction of an outer surface protein on Borrelia burgdorferi during tick feeding. Proc. Natl. Acad. Sci. USA 92:2909-2913.[Abstract/Free Full Text]
15
15. Unver, A., N. Ohashi, T. Tajima, R. W. Stich, D. Grover, and Y. Rikihisa. 2001. Transcriptional analysis of p30 major outer membrane multigene family of Ehrlichia canis in dogs, ticks, and cell culture at different temperatures. Infect. Immun. 69:6172-6178.[Abstract/Free Full Text]
16
16. Unver, A., M. Perez, N. Orellana, H. Huang, and Y. Rikihisa. 2001. Molecular and antigenic comparison of Ehrlichia canis isolates from dogs, ticks, and a human in Venezuela. J. Clin. Microbiol. 39:2788-2793.[Abstract/Free Full Text]
17
17. Vanhamme, L., and E. Pays. 1995. Control of gene expression in trypanosomes. Microbiol. Rev. 59:223-240.[Abstract/Free Full Text]
18
18. Wen, B., Y. Rikihisa, J. Mott, R. Greene, H. Y. Kim, N. Zhi, G. C. Couto, A. Unver, and R. Bartsch. 1997. Comparison of nested PCR with immunofluorescent antibody assay for detection of Ehrlichia canis infection in dogs treated with doxycycline. J. Clin. Microbiol. 35:1852-1855.[Abstract/Free Full Text]

---

Journal of Clinical Microbiology, February 2003, p. 886-888, Vol. 41, No. 2
0095-1137/03/$08.00+0     DOI: 10.1128/JCM.41.2.886-888.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Zhang, X., Luo, T., Keysary, A., Baneth, G., Miyashiro, S., Strenger, C., Waner, T., McBride, J. W. (2008). Genetic and Antigenic Diversities of Major Immunoreactive Proteins in Globally Distributed Ehrlichia canis Strains. CVI 15: 1080-1088 [Abstract] [Full Text]  
• Noh, S. M., Brayton, K. A., Knowles, D. P., Agnes, J. T., Dark, M. J., Brown, W. C., Baszler, T. V., Palmer, G. H. (2006). Differential Expression and Sequence Conservation of the Anaplasma marginale msp2 Gene Superfamily Outer Membrane Proteins. Infect. Immun. 74: 3471-3479 [Abstract] [Full Text]  
• Bekker, C. P. J., Postigo, M., Taoufik, A., Bell-Sakyi, L., Ferraz, C., Martinez, D., Jongejan, F. (2005). Transcription Analysis of the Major Antigenic Protein 1 Multigene Family of Three In Vitro-Cultured Ehrlichia ruminantium Isolates. J. Bacteriol. 187: 4782-4791 [Abstract] [Full Text]  
• Felek, S., Huang, H., Rikihisa, Y. (2003). Sequence and Expression Analysis of virB9 of the Type IV Secretion System of Ehrlichia canis Strains in Ticks, Dogs, and Cultured Cells. Infect. Immun. 71: 6063-6067 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services E-mail this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Felek, S. Articles by Rikihisa, Y. Search for Related Content PubMed PubMed Citation Articles by Felek, S. Articles by Rikihisa, Y.