Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Levi, M. H. Articles by Herbst, L. H. Search for Related Content PubMed PubMed Citation Articles by Levi, M. H. Articles by Herbst, L. H.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, May 2003, p. 2147-2152, Vol. 41, No. 5
0095-1137/03/$08.00+0     DOI: 10.1128/JCM.41.5.2147-2152.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Characterization of Mycobacterium montefiorense sp. nov., a Novel Pathogenic Mycobacterium from Moray Eels That Is Related to Mycobacterium triplex

Michael H. Levi,^1* John Bartell,² Leanne Gandolfo,² Sandra C. Smole,^3,4 Sylvia F. Costa,⁵ Louis M. Weiss,^1,5 Linda K. Johnson,^1,6 Gerard Osterhout,² and Lawrence H. Herbst^1,6

Department of Pathology,¹ Institute for Animal Studies,⁶ Department of Medicine, Montefiore Medical Center The Albert Einstein College of Medicine, Bronx, New York 10461,⁵ MIDI, Inc., and MIDI Labs, Inc., Newark, Delaware 19713,² Infectious Disease Section, Department of Medicine, Boston University School of Medicine,³ Medical Service, VA Boston Healthcare System, Boston, Massachusetts 02130⁴

Received 27 August 2002/ Returned for modification 10 January 2003/ Accepted 29 January 2003

Top Abstract Text References

 
The characterization of a novel Mycobacterium sp. isolated from granulomatous skin lesions of moray eels is reported. Analysis of the hsp65 gene, small-subunit rRNA gene, rRNA spacer region, and phenotypic characteristics demonstrate that this organism is distinct from its closest genetic match, Mycobacterium triplex, and it has been named M. montefiorense sp. nov.

Top Abstract Text References

 
Granulomatous skin disease has occurred sporadically and persistently within captive exhibit populations of moray eels, including green moray (Gymnothorax funebris) and spotted moray (G. moringa) eels (5), where it has led to eel death, reducing sizable aquarium collections of these fish. We have identified a mycobacterium as the etiologic agent of granulomatous skin disease in moray eels (5). On sequence analysis, the 16S rRNA gene of the eel Mycobacterium sp. was most closely related to that of Mycobacterium triplex, an opportunistic pathogen of humans (3, 4). The present report describes the phenotypic and genotypic characterization of this novel, slow-growing, acid-fast bacterium and clarifies the taxonomy of this isolate in the genus Mycobacterium. On the basis of previous recommendations for the description of new mycobacteria (10) and the data presented here, we propose this as a new mycobacterium species called M. montefiorense.

M. triplex (ATCC 700071) was obtained from the American Type Culture Collection (ATCC; Manassas, Va.). The Mycobacterium sp. previously described by Herbst et al. was stored at -70^oC (5). All phenotypic and genetic analyses were performed with biomass obtained from growth of this isolate on either Trypticase soy agar with 5% sheep blood or Middlebrook 7H10 agar. Type strains have been deposited at the American Type Culture Collection (ATCC BAA-256) and the Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany (DSM-44602).

As 16S ribosomal typing indicated that the organism isolated from moray eels was a Mycobacterium sp., acid-fast stains and biochemical tests were performed. Both the coccus form from blood agar and the rod form from Middlebrook medium were acid fast when stained with Kinyoun stain. The coccobacillary morphology of M. montefiorense on blood agar was consistent with the "streptococcus-like" organisms observed in previous studies of the pathology of eel skin lesions (5). Mycobacterial biochemical tests were performed by using standard methods as previously described (7). M. triplex has previously been demonstrated to be similar to M. simiae and M. avium complex (3) by conventional biochemical tests. Several differences in biochemical reactions were demonstrated for M. triplex and M. montefiorense (Table 1); e.g., M. triplex was urease positive and M. montefiorense was urease negative. There was a clear difference in temperature requirements and colony morphology. M. montefiorense would not grow at temperatures of >30°C. Growth from Middlebrook-based medium at 25°C demonstrated beaded acid-fast rods that were slow growing and nonchromogenic. The colonies were small and transparent. M. triplex grew poorly at temperatures of <30°C but grew well at 37°C, producing a mucoid opaque colony.

View this table: [in this window] [in a new window]

TABLE 1. Growth and biochemical differences between M. montefiorense and M. triplexa

Fatty acid methyl esters were obtained from M. montefiorense and M. triplex by saponification, methylation, and extraction. These were then separated by gas-liquid chromatography and identified by using the Sherlock Microbial Identification System (MIDI, Inc.), which identifies bacteria on the basis of their unique fatty acid profiles (15, 18). The profiles of M. triplex and M. montefiorense were qualitatively similar, but three fatty acid peaks had significant quantitative differences (18:2 w6,9c/18:0 ANTE, 4.36% [M. montefiorense] and 2.0% [M. triplex]; 18:0, 4.73% [M. montefiorense] and 1.48% [M. triplex]; 18:0 10-methyl, 1.14% [M. montefiorense] and 5.23% [M. triplex]). This data are consistent with the idea that these are closely related but distinct organisms as the presence or absence of peaks or a >2% difference in similar peaks constitutes a significant difference between species (15, 18).

Mycolic acids were extracted from M. montefiorense and M. triplex by using the following modifications of the previously published procedure (6): saponification for 30 min, derivatization for 10 min at 60°C in an uncapped vial precoated with potassium bicarbonate, and no clarification step. Dried extracts were resuspended in isopropanol (IPA) and transferred to a vial containing fluorescently derivatized mycolic acids (Corixa Corporation), which were used as reference standards. High-performance liquid chromatography (HPLC) analysis was performed on an Agilent 1100 HPLC system (Agilent, Wilmington, Del.) with a column heater (70°C) and a fluorescence detector. Separation of the mycolic acids was achieved with a Zorbax SB-C₁₈ column (4.6 by 75 mm), a mobile phase of methanol-IPA, and a linear gradient of 25 to 95% IPA over a 10-min period with a flow rate of 1.5 ml/min. Raw chromatographic data were acquired with ChemStation software and processed by using Sherlock software for calculation of relative percentages. Chromatograms were aligned, and adjusted retention times were calculated by ChemStation on the basis of the retention times of the two internal standards. Each peak may be a pure compound (mycolic acid) or a mixture of several mycolic acid classes (methoxy, keto, etc.). When analyzed under standard conditions, the compounds elute in a reproducible pattern. The mycolic acid profile of M. montefiorense was visually compared to that of M. triplex, and the peaks were aligned (Fig. 1). For convenience, only those peaks with heights of >2% of the total peak height are labeled. M. triplex produced a triple-cluster HPLC profile consistent with previously published results (3, 4). There were significant qualitative (peaks 2 and 5) and quantitative (peaks 3 and 4) differences between M. triplex and M. montefiorense, indicating that these are distinct organisms.

View larger version (23K): [in this window] [in a new window]

FIG. 1. Mycolic acid profiles of M. triplex ATCC 700071 (A) and M. montefiorense BAA-256 (B). LU, luminosity units; IS, internal standard. Note that luminosity units are just a measure of the fluorescence detector's signal intensity, a relative scale.

Sequencing of the 16S rRNA gene and subsequent phylogenetic analysis had previously revealed the eel isolate to be a Mycobacterium sp., with its closest match being M. triplex (5, 12). Bootstrap analysis was therefore performed with a 50% majority rule consensus tree by using PAUP 4.0 (D. Swofford, Sinauer Associates, Inc., Sunderland, Mass.) with additional Mycobacterium sp. sequences. The 16S rRNA gene analysis indicates that M. montefiorense (AF330038) formed a subclade in the phylogenetic tree together with M. triplex, as supported by the high bootstrap value of this subclade (Fig. 2). A neighbor-joining tree constructed by using the MicroSeq Microbial Identification and analysis software and database (Applied Biosystems) yielded similar results (data not shown) (5). M. montefiorense differs from M. triplex at nine positions in its 16S rRNA gene sequence (0.59%). For slow-growing mycobacteria, differences such as these within the 16S rRNA gene have been considered significant for the identification of a genetically unique and distinct taxon (8, 9).

View larger version (45K): [in this window] [in a new window]

FIG. 2. Phylogenetic tree of Mycobacterium sp. type strains based on full 16S rRNA gene sequences including a bootstrap (with a heuristic search) 50% majority rule consensus tree (100 bootstrap replicates were run). Bootstrap analysis was performed with a 50% majority rule consensus tree by using PAUP 4.0 (D. Swofford, Sinauer Associates, Inc.) One hundred bootstrap replicates were run. The optimality criterion was maximum parsimony, and there were 95 parsimony-informative characters among the 1,533 characters (nucleotide positions) analyzed. M. marinum is known to cluster between M. tuberculosis and M. conspicuum. A neighbor-joining tree constructed by using the MicroSeq Microbial Identification and analysis software and database (Applied Biosystems) yielded similar results (data not shown; 12). On the phylogenetic tree, each organism is indicated by the genus, species, GenBank accession number, ATCC or DSM strain number, and MicroSeq accession number (if available).

Sequencing of M. montefiorense internal transcribed spacer (ITS) rRNA, amplified by using the Sp1(5'ACCTCCTTTCTAAGGAGCACC3')-Sp2 (5'GATGCTCGCAACCACTATCCA3') primer pair (16), demonstrated that it is distinct from that of M. triplex (Fig. 3), and BLASTN analysis demonstrated that it does not correspond to any known ITS rRNA in the GenBank database (1). Roth (16) has proposed a method for the identification of Mycobacterium spp. that is based on the restriction patterns generated from the ITS region amplified with primers Sp1 and Sp2. Restriction sites of the ITS rRNAs were examined and compared by using MapDraw (Lasergene; DNASTAR, Inc., Madison, Wis.). Under Roth's system, M. montefiorense would cluster with M. genavense, M. lentiflavum, and M. triplex in that it would not be resolved from these organisms by restriction cleavage with AvaII, TaqI, or DdeI. M. montefiorense can, however, be distinguished from M. triplex by using MspI, which produces three fragments from the ITS of M. triplex and only two fragments from the ITS of M. montefiorense.

View larger version (22K): [in this window] [in a new window]

FIG. 3. Alignment (Lasergene MegAlign; DNASTAR, Inc.) of rRNA 16S-23S ITS regions of M. triplex, M. montefiorense, M. simiae, M. genavense, and an M. triplex-like organism (4).

To further support the characterization of this new species, an 400-bp PCR fragment was obtained from the 65-kDa heat shock protein gene (hsp65) sequences of M. montefiorense, M. triplex, and M. genavense by using TB11 (5'-ACCAACGATGGTGTGTCCAT-3') and TB12 (5'-CTTGTCGAACCGCATACCCT-3') (14). Sequences of the hsp65 amplicon demonstrated that M. montefiorense differs from M. triplex by 10 of 441 nucleotides and M. genavense by 14 of 441 nucleotides of the hsp65 gene sequence (Table 2). Comparison of the hsp65 sequence from 385 bp of M. montefiorense with those of 385 bp of M. triplex and 360 bp of M. genavense by BLASTN demonstrated sequence similarities of 97.4 and 96.1%, respectively (Table 3) (1). The hsp65 phylogenetic data are consistent with the idea that M. montefiorense is a unique species.

View this table: [in this window] [in a new window]

TABLE 2. Differences among the hsp65 gene sequences of M. triplex (AY027786), the novel species M. montefiorense ATCC BAA-256 (AY027785), and M. genevense (U17932)

View this table: [in this window] [in a new window]

TABLE 3. Similarity of related mycobacterial hsp65 gene sequences with that of M. montefiorense (AY027785)

This polyphasic taxonomic study was carried out to demonstrate that this moray eel isolate is a new species of mycobacterium, M. montefiorense. Three different genetic approaches demonstrated that the isolate belongs to the slow-growing clade of mycobacteria. Although analysis of the 16S rRNA gene has become a standard technique in bacterial taxonomy (13), a second method is often necessary to confirm a new species because of limited variation in the 16S rRNA gene in many mycobacterial species (3, 11, 14, 17, 19). The hsp65 gene is a housekeeping gene that has been used extensively both for species identification and for species differentiation based on species-specific variation (2, 11). Both the 16S rRNA gene and hsp65 data support the conclusions that this isolate is distinct from M. triplex and that it is a new Mycobacterium species. The variability in the ITS region is also very useful for the separation of closely related species. For example, the ITS region has been used to characterize a new M. triplex-like organism that caused a human infection (4). Analysis of the ITS sequences of M. triplex, an M. triplex-like human isolate (4), and M. montefiorense demonstrated that each is unique. While moles percent G+C content has been recommended as another descriptive factor for slow-growing mycobacteria, this value was not determined for M. montefiorense (10). Phenotypic methods were consistent with the genotypic data. Fatty acid analysis, mycolic acid analysis, and biochemical testing supported the idea that M. montefiorense is distinct from M. triplex. It should be noted, however, that the biochemical tests are designed for organisms that grow at temperatures of >30°C. Analysis of M. montefiorense and M. triplex at their optimal growth temperatures demonstrated clear biochemical differences. All of the data presented in this paper, therefore, demonstrate that the Mycobacterium sp. isolated from moray eels is unique, and we believe that they are sufficient to justify the designation of this eel isolate as a new species within the genus Mycobacterium named M. montefiorense.

Our original description of this organism was the first isolation of an M. triplex-related species from fish (5). M. triplex is a member of a group of slowly growing mycobacteria classified by the Centers for Disease Control and Prevention as SAV organisms on the basis of their relatedness to M. simiae and M. avium (3, 4). We are, however, aware of other groups finding similar organisms in other marine fish (20), suggesting that these slow-growing organisms are more common in the marine environment than previously suspected. It is possible that many SAV organisms are pathogens of fish and other organisms in the marine ecosystem. Further study of the epizootiology and pathogenesis of M. montefiorense and other SAV organisms in fish, aquatic mammals, and humans will be critical in the elucidation of the impact of these mycobacteria on ecosystems, as well as human health.

Taxonomic description of M. montefiorense sp. nov. Mycobacterium montefiorense (mon.te.fi.or.en'se. N. L. adj. montefiorense, of Montefiore, referring to the Montefiore Medical Center). M. montefiorense was named after the Montefiore Medical Center, Bronx, N.Y., the medical institution where it was isolated that has provided medical care to the Bronx, N.Y., community for >100 years. These bacteria grow at 25°C but not at 30 or 37°C. Growth from Middlebrook-based medium at 25°C demonstrates beaded acid-fast rods that are slow growing and nonchromogenic. The bacteria are biochemically inactive (negative urease, arylsulfatase, niacin, nitrate reduction, Tween 80 hydrolysis, 5% NaCl tolerance, and catalase). This organism can be isolated on sheep blood agar if the cultures are kept for up to 20 weeks at 25°C. Growth on blood agar demonstrates coccobacillary forms when stained with methylene blue, but these bacteria resist Gram stain. M. montefiorense has been demonstrated to be an etiologic agent of a granulomatous skin disease of moray eels.

Nucleotide sequence accession numbers. The 16S ribosomal gene and the ITS region sequence (AF330038) and a partial hsp65 gene sequence (AY027785) have been deposited in the GenBank database.

 
We thank Hitesh Patel and Ervin Melton for valuable help in the mycobacteriology laboratory, Michael Alexander for help with HPLC, and Aidan C. Parte for advice on nomenclature. We thank Neal Steigbigel for his inspired teaching of infectious diseases at Montefiore Medical Center.

L.M.W. is supported by National Institutes of Health grants AI31788 and AI39454.

 
* Corresponding author. Mailing address: Microbiology Laboratory, Montefiore Medical Center, 111 E. 210th St., Bronx, NY 10467. Phone: (718) 920-4189. Fax: (718) 654-7402. E-mail: Mlevi{at}Montefiore.org.

Top Abstract Text References

 

1
1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
2
2. Bahrmand, A. R., T. G. Bakayeva, and V. V. Bakayev. 1998. Use of restriction enzyme analysis of amplified DNA coding for the hsp65 gene and polymerase chain reaction with universal primer for rapid differentiation of mycobacterium species in the clinical laboratory. Scand. J. Infect. Dis. 30:477-480.[CrossRef][Medline]
3
3. Floyd, M. M., L. S. Guthertz, V. A. Silcox, P. S. Duffey, Y. Jang, E. P. Desmond, J. T. Crawford, and W. R. Butler. 1996. Characterization of an SAV organism and proposal of Mycobacterium triplex sp. nov. J. Clin. Microbiol. 34:2963-2967.[Abstract]
4
4. Hazra, R., M. M. Floyd, A. Sloutsky, and R. N. Husson. 2001. Novel mycobacterium related to Mycobacterium triplex as a cause of cervical lymphadenitis. J. Clin. Microbiol. 39:1227-1230.[Abstract/Free Full Text]
5
5. Herbst, L. H., S. F. Costa, L. M. Weiss, L. K. Johnson, J. Bartell, R. Davis, M. Walsh, and M. Levi. 2001. Granulomatous skin lesions in moray eels caused by a novel Mycobacterium related to Mycobacterium triplex. Infect. Immun. 69:4639-4646.[Abstract/Free Full Text]
6
6. Jost, K. C., Jr., D. F. Dunbar, S. S. Barth, V. L. Headley, and L. B. Elliott. 1995. Identification of Mycobacterium tuberculosis and M. avium complex directly from smear-positive sputum specimens and BACTEC 12B cultures by high-performance liquid chromatography with fluorescence detection and computer-driven pattern recognition models. J. Clin. Microbiol. 33:1270-1277.[Abstract]
7
7. Kent, P. T., and G. P. Kubica. 1985. Public health mycobacteriology—a guide for the level III laboratory. U.S. Department of Health and Human Services publication (CDC) 86-8230. Centers for Disease Control, Atlanta, Ga.
8
8. Kirschner, P., B. Springer, U. Vogel, A. Meier, A. Wrede, M. Kiekenbeck, F.-C. Bange, and E. C. Böttger. 1993. Genotypic identification of mycobacteria by nucleic acid sequence determination: report of a 2-year experience in a clinical laboratory. J. Clin. Microbiol. 31:2882-2889.[Abstract/Free Full Text]
9
9. Kirschner, P., A. Meier, and E. Böttger. 1993. Genotypic identification and detection of mycobacteria—facing novel and uncultured pathogens, p. 173-190. In D. H. Persing, T. F. Smith, F. C. Tenover, and T. J. White (ed.), Diagnostic molecular microbiology. Mayo Foundation, Rochester, Minn.
10
10. Lévy-Frébault, V. V., and F. Portaels. 1992. Proposed minimal standards for the genus Mycobacterium and for description of new slowly growing Mycobacterium species. Int. J. Syst. Bacteriol. 42:315-323.[Abstract/Free Full Text]
11
11. Pai, S., N. Esen, X. Pan, and J. M. Musser. 1997. Routine rapid Mycobacterium species assignment based on species-specific allelic variation in the 65-kilodalton heat shock protein gene (hsp65). Arch. Pathol. Lab. Med. 121:859-864.[Medline]
12
12. Patel, J. B., D. G. B. Leonard, X. Pan, J. M. Musser, R. E. Berman, and I. Nachamkin. 2000. Sequence-based identification of Mycobacterium species using the MicroSeq 500 16S rDNA bacterial identification system. J. Clin. Microbiol. 38:246-251.[Abstract/Free Full Text]
13
13. Relman, D. A. 1993. Universal bacterial 16S rDNA amplification and sequencing, p. 489-495. In D. H. Persing, T. F. Smith, F. C. Tenover, and T. J. White (ed.), Diagnostic molecular microbiology: principles and applications. American Society for Microbiology, Washington, D.C.
14
14. Ringuet, H., C. Akoua-Koffi, S. Honore, A. Varnerot, V. Vincent, P. Berche, J. L. Gaillard, and C. Pierre-Audigier. 1999. hsp65 sequencing for identification of rapidly growing mycobacteria. J. Clin. Microbiol. 37:852-857.[Abstract/Free Full Text]
15
15. Roth, A., U. Reischl, N. Schönfeld, L. Naumann, S. Emler, M. Fischer, H. Mauch, R. Loddenkemper, and R. M. Kroppenstedt. 2000. Mycobacterium heckeshornense sp. nov., a new pathogenic slowly growing Mycobacterium sp. causing cavitary lung disease in an immunocompetent patient. J. Clin. Microbiol. 38:4102-4107.[Abstract/Free Full Text]
16
16. Roth, A., U. Reischl, A. Streubel, L. Naumann, R. M. Kroppenstedt, M. Habicht, M. Fischer, and H. Mauch. 2000. Novel diagnostic algorithm for identification of mycobacteria using genus-specific amplification of the 16S-23S rRNA gene spacer and restriction endonucleases. J. Clin. Microbiol. 38:1094-1104.[Abstract/Free Full Text]
17
17. Shinnick, T. M. 1987. The 65-kilodalton antigen of Mycobacterium tuberculosis. J. Bacteriol. 169:1080-1088.[Abstract/Free Full Text]
18
18. Springer, B., E. Tortoli, I. Richter, R. Grünewald, S. Rüsch-Gerdes, K. Uschmann, F. Suter, M. D. Collins, R. M. Kroppenstedt, and E. C. Böttger. 1995. Mycobacterium conspicuum sp. nov., a new species isolated from pa-tients with disseminated infections. J. Clin. Microbiol. 33:2805-2811.[Abstract]
19
19. Telenti, A., F. Marchesi, M. Balz, F. Bally, E. C. Böttger, and T. Bodmer. 1993. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis. J. Clin. Microbiol. 31:175-178.[Abstract/Free Full Text]
20
20. Whipps, C. M., V. G. Watral, and M. L. Kent. 2003. Characterization of a Mycobacterium sp. in rockfish, Sebastes alutus (Gilbert) and Sebastes reedi (Westrheim & Tyuki), using rDNA sequences. J. Fish. Dis. 26:1-5.[CrossRef][Medline]

---

Journal of Clinical Microbiology, May 2003, p. 2147-2152, Vol. 41, No. 5
0095-1137/03/$08.00+0     DOI: 10.1128/JCM.41.5.2147-2152.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Pourahmad, F., Cervellione, F., Thompson, K. D., Taggart, J. B., Adams, A., Richards, R. H. (2008). Mycobacterium stomatepiae sp. nov., a slowly growing, non-chromogenic species isolated from fish. Int. J. Syst. Evol. Microbiol. 58: 2821-2827 [Abstract] [Full Text]  
• Whipps, C. M., Butler, W. R., Pourahmad, F., Watral, V. G., Kent, M. L. (2007). Molecular systematics support the revival of Mycobacterium salmoniphilum (ex Ross 1960) sp. nov., nom. rev., a species closely related to Mycobacterium chelonae. Int. J. Syst. Evol. Microbiol. 57: 2525-2531 [Abstract] [Full Text]  
• Uyttebroek, M., Vermeir, S., Wattiau, P., Ryngaert, A., Springael, D. (2007). Characterization of Cultures Enriched from Acidic Polycyclic Aromatic Hydrocarbon-Contaminated Soil for Growth on Pyrene at Low pH. Appl. Environ. Microbiol. 73: 3159-3164 [Abstract] [Full Text]  
• McNabb, A., Adie, K., Rodrigues, M., Black, W. A., Isaac-Renton, J. (2006). Direct Identification of Mycobacteria in Primary Liquid Detection Media by Partial Sequencing of the 65-Kilodalton Heat Shock Protein Gene. J. Clin. Microbiol. 44: 60-66 [Abstract] [Full Text]  
• Tortoli, E., Rindi, L., Goh, K. S., Katila, M. L., Mariottini, A., Mattei, R., Mazzarelli, G., Suomalainen, S., Torkko, P., Rastogi, N. (2005). Mycobacterium florentinum sp. nov., isolated from humans. Int. J. Syst. Evol. Microbiol. 55: 1101-1106 [Abstract] [Full Text]  
• Rhodes, M. W., Kator, H., McNabb, A., Deshayes, C., Reyrat, J.-M., Brown-Elliott, B. A., Wallace, R. Jr, Trott, K. A., Parker, J. M., Lifland, B., Osterhout, G., Kaattari, I., Reece, K., Vogelbein, W., Ottinger, C. A. (2005). Mycobacterium pseudoshottsii sp. nov., a slowly growing chromogenic species isolated from Chesapeake Bay striped bass (Morone saxatilis). Int. J. Syst. Evol. Microbiol. 55: 1139-1147 [Abstract] [Full Text]  
• (2003). Validation of publication of new names and new combinations previously effectively published outside the IJSEM. Int. J. Syst. Evol. Microbiol. 53: 1701-1702 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Levi, M. H. Articles by Herbst, L. H. Search for Related Content PubMed PubMed Citation Articles by Levi, M. H. Articles by Herbst, L. H.