Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ikewaki, J. Articles by Nasu, M. Search for Related Content PubMed PubMed Citation Articles by Ikewaki, J. Articles by Nasu, M.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, September 2003, p. 4382-4387, Vol. 41, No. 9
0095-1137/03/$08.00+0     DOI: 10.1128/JCM.41.9.4382-4387.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Real-Time PCR Assay Compared to Nested PCR and Antigenemia Assays for Detecting Cytomegalovirus Reactivation in Adult T-Cell Leukemia-Lymphoma Patients

Junji Ikewaki,^* Eiichi Ohtsuka, Rie Kawano, Masao Ogata, Hiroshi Kikuchi, and Masaru Nasu

Department of Infectious Diseases, Oita Medical University, Oita, Japan

Received 25 March 2003/ Returned for modification 14 April 2003/ Accepted 14 June 2003

Top Abstract Introduction Materials and Methods Results Discussion References

 
We analyzed the efficiency of the quantitative real-time PCR assay for cytomegalovirus (CMV) reactivation in adult T-cell leukemia-lymphoma (ATL) patients and compared the results with those obtained with qualitative nested PCR and antigenemia assays. The viral load obtained by the real-time PCR assay closely paralleled the number of antigen-positive cells obtained with the antigenemia assay. Real-time PCR revealed that a large number of DNA copies could be present even in samples assessed as negative or low in antigen-positive cells (0 to 10 antigen-positive cells/50,000 cells) by antigenemia assay. CMV copy numbers did not differ between the negative and low-antigen-positive groups. When the input concentration for real-time PCR assay was 2,500 to 5,000 copies/ml, the positivity rate for the nested PCR assay was 47.3%, while the positivity rate was more than 90% at an input concentration of 50,000 copies/ml. Real-time PCR is more sensitive than the antigenemia and nested PCR assays. Moreover, real-time PCR was able to detect CMV reactivation earlier than the antigenemia and nested PCR assays through the use of longitudinal analysis in four ATL patients with CMV pneumonia. In longitudinal assessments, analysis of the results suggested that a cutoff level of 5,000 copies/ml might be used to initiate treatment. Real-time PCR is more suitable for monitoring CMV reactivation in ATL patients than the antigenemia and nested PCR assays. CMV viral loads of 5,000 copies/ml are proposed as the cutoff for initiating antiviral therapy in ATL patients.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Adult T-cell leukemia-lymphoma (ATL) is a peripheral T-cell malignancy caused by human T-cell leukemia virus type 1 (18). Cytomegalovirus (CMV) is a particularly lethal pathogen for ATL patients (5). It is an important pathogen of immunocompromised hosts, including those with human immunodeficiency virus (HIV) infection (2) and patients following allogeneic stem cell transplantation (SCT) (15) or organ transplantation (17). The virus causes such CMV-related diseases as pneumonia, enterocolitis, and retinitis. Ganciclovir and foscarnet are effective drugs for treating CMV-caused disease, but they have various side effects, including pancytopenia and renal dysfunction (9). Moreover, inappropriate dosage regimens can lead to the appearance of drug-resistant virus strains (12). Early and accurate diagnosis and reliable methods for monitoring CMV infection are essential for managing ATL patients.

The recent development of real-time PCR procedures for rapidly quantifying genome load should prove useful for accurately monitoring these infections. Although many reports describing real-time PCR assays have improved our understanding of their utility for patients with HIV infection (26) or for those having undergone SCT (11, 13) or organ transplantation (4), there have been no reports of using real-time PCR in monitoring for CMV reactivation in ATL patients. The development of a standard method for monitoring ATL patients has remained elusive because the monitoring protocols for CMV reactivation in ATL patients differ in each institution. The CMV antigenemia assay is the most widely used method for detecting CMV infection, and antigenemia-guided preemptive therapy has been shown to be effective in preventing CMV-related diseases (1). Real-time PCR methods have been demonstrated to be superior to antigenemia assays with respect to cost, simplicity, sensitivity, repeatability, and reproducibility (16, 20). Moreover the antigenemia assay is unreliable during repeated neutropenia by chemotherapy. Nested PCR has also been reported to be useful in detecting CMV infection (22). However, nested PCR is not quantitative, and the level of CMV infection in some patients is often difficult to infer from the results. Therefore, to provide more data toward developing a standard methodology for the monitoring and diagnosis of CMV infections, we investigated the potential of real-time PCR assay procedures and compared our results with those obtained using the qualitative nested PCR and antigenemia assays in ATL patients.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Patients. Between January 1996 and May 2002, 27 patients with a diagnosis of ATL as determined by serologic, immunophenotypic, and genomic findings were enrolled. Patients who presented in either chronic or smoldering phase according to the Lymphoma Study Group classification (19) were excluded because they had fewer risks associated with CMV infection and had yet to undergo intensive chemotherapy. All patients were seropositive for CMV before chemotherapy and received combined chemotherapy with anthracycline, vinca alkaloid, and alkylating agent. Prednisolone was used only with chemotherapy for short periods of 4 or 5 days. The patients comprised 16 men and 11 women (median age, 59.7 years; range, 35 to 80 years). Twenty-one patients demonstrated the acute type, and six patients demonstrated the lymphoma type, according to the Lymphoma Study Group classification. Blood samples were obtained weekly during repeated intensive chemotherapy. A total of 239 samples were obtained from 27 patients and were examined with both real-time PCR and nested PCR assays. Ninety-nine of the 239 samples that were obtained from 16 of 27 patients were examined with the antigenemia assay.

Four of 27 patients developed CMV-related pneumonia during the clinical courses; transbronchial lung biopsies were obtained from two patients, and diagnoses for these patients were confirmed by histologic analyses (hematoxylin-eosin staining and immunohistochemistry). The other two patients were diagnosed histologically based on autopsy results.

Nested PCR and real-time PCR. Viral DNA was extracted from plasma (0.2 ml) with a QIAamp Blood mini-kit (Qiagen, Valencia, Calif.) according to the manufacturer's instructions. DNA was eluted from the Qiagen columns in a final volume of 100 µl of distilled water and was stored at -30°C until used.

Nested PCR was carried out as described by Tokimatsu et al. (22). Briefly, the primers used for PCR were complementary to immediate-early gene region 1. The outer primer set consisted of MIE-4 (5'-CCAAGCGGCCTCTGATAACCAAGCC-3') and MIE-5 (5'-CAGCACCATCCTCCTCTTCTCTGG-3'), which amplified a sequence of 435 bp. The inner primer set consisted of IE-1 (5'-CCACCCGTGGTGCCAGCTCC-3') and IE-2 (5'-CCCGCTCCTCCTGAGCACCC-3') and amplified a 159-bp sequence. All reaction mixtures used TaKaRa Ex Taq (Takara, Ohtsu, Japan). For each PCR with the outer primers, 20 pmol of each outer primer was used with 5 µl of the prepared sample in a 50-µl final reaction volume. PCRs consisted of 30 cycles of DNA denaturation at 94°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 1 min. The final extension step was carried out for 10 min. In the nested PCR step, 5 µl of the product from the first PCR was added to a new reaction mixture containing 20 pmol of each inner primer and was then reamplified as before. The nested PCR products were electrophoresed on 4% agarose gels containing ethidium bromide, and the gels were photographed.

Real-time PCR was performed according to the method described by Machida et al. (13). Briefly, the designs of the PCR primers (5'-GCGTGCTTTTTAGCCTCTGCA-3' and 5'-AAAAGTTTGTGCCCCAACGGTA-3') and a fluorogenic probe (5'-[FAM]TGATCGGCGTTATCGCGTTCTTGATC[TAMRA]-3') were based on open reading frame US17 of CMV AD169. To standardize the quantification, we subcloned part of open reading frame US17 into a plasmid. DNA fragments were amplified with an ABI PRISM 7700 Sequence Detection System (Perkin-Elmer Biosystems, Foster City, Calif.) in a 50-µl reaction mixture containing 10 µl of DNA sample, 25 µl of TaqMan Universal PCR master mix (Perkin-Elmer Biosystems), 15 pmol of each primer, and 10 pmol of TaqMan probe. Thermal cycling conditions were as follows: 50°C for 2 min, 95°C for 10 min, and 50 cycles of 95°C for 15 s and 61°C for 1 min.

Antigenemia assay. Antigenemia assays were conducted with a Teijin antigenemia kit (Teijin, Osaka, Japan) according to the manufacturer's instructions (8). EDTA-treated blood (3 ml) was mixed with phosphate-buffered saline (PBS) (1.5 ml) and a 5% solution of dextran (0.5 ml) and was allowed to settle at 37°C. After 15 min, the entire supernatant was harvested and was centrifuged for 10 min at 300 x g. The pelleted cells were suspended in an NH₄Cl solution (NH₄Cl [8.3 g/liter], KHCO₃ [1.0 g/liter], and EDTA [0.03 g/liter], pH 7.4) on iced water for 5 min to lyse the contaminating erythrocytes. After centrifugation for 10 min at 300 x g, the leukocytes were suspended in PBS and were counted. Cytocentrifuge preparations were mainly made with 100 µl of a suspension of 1.5 x 10⁶ cells per ml centrifuged for 5 min at 550 rpm (Cytospin-3; Shandon Scientific Ltd., Astmoor, United Kingdom). The slides were dried quickly and were fixed with acetone (10 min at -20°C) and were then rinsed in methanol (150 ml) containing 1% hydrogen peroxide to eliminate endogenous peroxidase activity. After washing twice with PBS, slide contents were incubated in a solution of the peroxidase-conjugated monoclonal antibody C7-HRP (50 µl) for 60 min at room temperature. After being washed with PBS, slide contents were incubated with substrate (including diaminobenzidine) and chromogen (including H₂O₂) solution (100 µl) for 10 min at room temperature. Slides were washed with PBS and were counterstained with hematoxylin counterstain solution (150 µl) for 30 s. After being washed with PBS, CMV antigen-positive cells were enumerated by light microscopy. The degree of antigenemia was expressed as the number of CMV antigen-positive cells per 5 x 10⁴ leukocytes.

Statistical analysis. Differences between two groups were assessed by the Mann-Whitney test or Fisher's exact test. Correlations between two groups were analyzed by Spearman's test. P values less than 0.05 were considered statistically significant.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Stability of real-time PCR. A standard curve was produced by using seven 10-fold dilutions of a plasmid standard covering 10 to 10⁷ plasmid copies per reaction, which corresponded to 5 x 10² to 5 x 10⁸ copies/ml of plasma. The standard curve possessed a correlation coefficient of 0.990 with a slope of -3.40 and y-intercept value of 38.50 (Fig. 1). The real-time PCR assay detected between 18 and 3,653,361 copies of CMV genome/ml in 239 samples. The reproducibility was determined from three blood samples. The coefficients of variation obtained for control low (500 copies/well)-, middle (10⁴ copies/well)-, and high (10⁵ copies/well)-viral-load samples in intra-assay variation testing were 0.23, 0.10, and 0.11, respectively, and in interassay variation testing, the coefficients of variation were 1.51, 1.71, and 1.43, respectively. All measurements in the above tests were conducted in quintuplicate.

View larger version (12K): [in this window] [in a new window]

FIG. 1. Standard curve for CMV DNA quantification. Tenfold serial dilutions ranging from 107 to 10 plasmid copies were tested in duplicate, and the mean threshold cycle values were plotted against the copy number.

Comparison of antigenemia, real-time PCR, and nested PCR assays. Correlations between pp65 antigenemia and real-time PCR assays were investigated using blood samples taken from the ATL patients. A total of 99 weekly samples was obtained from 16 patients and was analyzed with both real-time PCR and antigenemia assays. The CMV DNA copy number and the pp65-positive cell count were closely paralleled. Samples from patients were classified into four groups according to the results of the antigenemia assay. Group 1 corresponded to samples assessed as negative by the antigenemia assay, group 2 corresponded to low values (1 to 10 positive cells), group 3 corresponded to moderate values (11 to 100 positive cells), and group 4 corresponded to high values (>100 positive cells). As shown in Fig. 2, the CMV DNA load did not differ between groups 1 and 2, while the CMV DNA load was significantly different between groups 2 and 3 as well as between groups 3 and 4.

View larger version (28K): [in this window] [in a new window]

FIG. 2. Comparison of CMV DNA viral load obtained by real-time PCR with number of antigen-positive cells obtained by the antigenemia assay. Samples from patients were classified into four groups according to the results of the antigenemia assay, and the results by real-time PCR assay were plotted. Box and whisker plots are explained in the key.

Assessment of viral load by real-time PCR and nested PCR assays was investigated by using 239 weekly samples obtained from 27 ATL patients. A comparison between real-time PCR and nested PCR assays is shown in Table 1. When input concentration for real-time PCR was 2,500 to 4,999 copies/ml, the positivity rate for the nested PCR assay was 47.3%, while the positivity rate was more than 90% at an input concentration of 50,000 copies/ml.

View this table: [in this window] [in a new window]

TABLE 1. Comparison between real-time PCR and nested PCR assays

Longitudinal analysis for detection of CMV reactivation. The temporal pattern of CMV detection by real-time PCR assay was analyzed and was then compared with antigenemia and nested PCR assays. First, the real-time PCR assay was compared with the antigenemia assay (Tables 2 to 4). CMV DNA copy number and antigen-positive cells roughly paralleled the clinical course in two cases (Table 2; patients 1 and 2) of CMV pneumonia in which an antigenemia assay could be carried out. The real-time PCR assay became positive before the antigenemia assay did in one case (patient 1), and both assays became positive from the first specimen in one case (patient 2). In patient 1, the CMV copy number on a real-time PCR assay increased to 9.9 x 10³ copies/ml 4 weeks before the antigenemia became positive. Out of 14 cases in which CMV disease did not ensue, both assays remained negative for the whole period of observation in seven cases, both assays became positive simultaneously in three cases, and real-time PCR alone was positive in four cases.

View this table: [in this window] [in a new window]

TABLE 2. Longitudinal analysis in patients with CMV pneumoniaa

Real-time PCR was then compared with nested PCR. Out of four cases of CMV pneumonia (Table 2; patients 1 to 4), the real-time PCR assay became positive before the nested PCR assay did in three cases (patients 1, 3, and 4), and both assays became positive from the first specimen in one case (patient 2). Out of 23 cases where CMV-related disease did not develop, both assays remained negative for the period of observation in 10 cases, both assays became positive simultaneously in eight cases, real-time PCR alone gave positive results in three cases, and nested PCR alone was positive in two cases. The cases of six patients who underwent antiviral therapy for CMV reactivation without developing CMV-related disease are shown in Table 3. Both assays became positive simultaneously in four cases (patients 5, 7, 9, and 10), and the real-time PCR assay became positive before the nested PCR assay did in one case (patient 8). CMV viral load decreased after initiation of ganciclovir therapy (patients 5 and 8 to 10). Real-time PCR indicated a rapid temporary elevation of viral load in one case (patient 6), but this patient received valaciclovir orally for herpes zoster, and the CMV DNA copy number as determined by real-time PCR decreased following this treatment. However, the antigenemia assay classified all six patients as negative or low antigen positive. The two cases that nested PCR alone identified as positive are shown in Table 4. The real-time PCR assay revealed low viral load, and the antigenemia assay was negative, while nested PCR became positive in two cases, but these positive results were temporary.

View this table: [in this window] [in a new window]

TABLE 3. Longitudinal analysis for CMV detection in ATL patients who received antiviral treatment without CMV diseasea

View this table: [in this window] [in a new window]

TABLE 4. Longitudinal analysis for CMV detection in patients for whom nested PCR alone became positivea

Top Abstract Introduction Materials and Methods Results Discussion References

 
The quantitative detection of CMV DNA by real-time PCR assay has been a benefit for immunocompromised hosts, and some reports have maintained that this assay offers several advantages over the antigenemia assay. However, there has been no published research that describes the use of real-time PCR for ATL patients, and no standard method for detecting CMV in ATL patients has been developed. The goals of the present study were to ascertain whether real-time PCR could be used for ATL patients, by comparing these results with those obtained from qualitative nested PCR and antigenemia assays.

Recent studies of patients with HIV infection and after SCT or organ transplantation have demonstrated that the real-time PCR assay and antigenemia assay are precisely correlated (20, 25). Our examination of ATL patients also demonstrated a good correlation between the antigenemia and real-time PCR assays. The antigenemia assay is the most popular method for monitoring CMV infection (1). Several studies of CMV infection in ATL patients have adopted this method (6, 7), but repeated and protracted neutropenia caused by chemotherapy may preclude the clinical application of this method. Moreover, real-time PCR revealed high viral load, even in samples assessed as negative by the antigenemia assay, and CMV DNA viral load did not differ between groups 1 and 2 (Fig. 2). This indicates that real-time PCR is more sensitive than the antigenemia assay. In addition, the antigenemia assay might be unreliable with lower numbers of antigen-positive cells. For two patients having CMV pneumonia in which antigenemia could be carried out, real-time PCR became positive before the antigenemia assay did. Based on these results, real-time PCR appears to be superior to the antigenemia assay in terms of sensitivity for early detection in addition to its low cost, time effectiveness, ease of use, and reliability of CMV detection during severe neutropenia due to chemotherapy. For patients undergoing antiviral treatment for CMV reactivation without developing CMV disease, real-time PCR revealed high viral loads while the antigenemia assay showed negative or few positive cells. Although the clinical significance of a high CMV viral load associated with low antigenemia remains to be established, this might indicate an early stage of CMV disease or latent disease, which may become medical targets in the future. Real-time PCR may be more suitable in these cases.

We also compared the real-time PCR and nested PCR assays. When input concentration was 2,500 to 5,000 copies/ml, the sensitivity of nested PCR was 47.3%, while sensitivity was more than 90% at an input concentration of 50,000 copies/ml. This indicates that nested PCR is unreliable in the middle viral load range that is associated with early detection. Caliendo et al. reported a similar difference between real-time PCR and qualitative PCR assays (3). The locations of the primers used in this study actually differed for real-time PCR and nested PCR assays. However, Tanaka et al. have demonstrated with real-time PCR that results obtained with the respective primer sets for the immediate-early and US17 regions are correlated (21). Therefore, we compared the nested PCR protocols being used at our institution with results obtained by using the most popular primers in real-time PCR assays. We believe that the real-time PCR assay would be more sensitive than nested PCR. With regard to early detection, out of four cases of CMV pneumonia, real-time PCR became positive before nested PCR did in three. Moreover, real-time PCR is able to quantitatively evaluate the effects of treatment. The case progression of the four patients who contracted CMV-related pneumonia in our study may have been prevented if they were monitored by real-time PCR. Real-time PCR is more suitable for early detection and monitoring ATL patients than is nested PCR.

For patients after allogeneic SCT (25) and for those with HIV infection, the CMV-positive value has been defined as 200 copies/ml for the real-time PCR assay or 1/50,000 CMV antigen-positive cells for the antigenemia assay (10, 14). While the condition of the immune system varies between each pair of diseases, the cutoff was given the same value but remains obscure. To determine whether this definition also applies to ATL patients, we attempted to define a cutoff by using the real-time PCR assay. In four cases of CMV pneumonia, the viral load as measured by real-time PCR increased to 5,000 copies/ml before positive results for the other assays or disease onset. Moreover, this increase occurred 3 weeks before disease onset. In five patients undergoing treatment with an antiviral drug for CMV reactivation in the absence of CMV disease, CMV viral load increased to 5,000 copies/ml before initiation of antiviral treatment. On the other hand, two patients for whom nested PCR alone gave positive results had counts of less than 5,000 copies/ml by real-time PCR assay. Although more research is necessary, the cutoff for detection may be better defined as 5,000 copies/ml for ATL patients.

In conclusion, real-time PCR is more suitable than are nested PCR and the antigenemia assay for detecting CMV reactivation in ATL patients. Recently, autologous SCT and allogeneic SCT have been adopted for ATL patients (23, 24), and SCT is expected to improve these patients' prognoses. Early detection and monitoring of CMV viral loads are critical for preventing complications of CMV infection in patients following SCT. Strict monitoring with the real-time PCR assay should be required for such patients.

 
We thank Takako Satou for technical assistance and advice, as well as Yoshio Saburi (Department of Hematology, Oita Prefectural Hospital) and Keiji Ono (Department of Hematology, Almeida Memorial Hospital) for providing clinical samples.

 
* Corresponding author. Mailing address: Department of Infectious Disease, Oita Medical University, Hasama-Machi, Oita 879-5593, Japan. Phone: 81-97-586-5804. Fax: 81-97-549-4245. E-mail: ikewaki{at}oita-med.ac.jp.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Boeckh, M., R. A. Bowden, T. A. Gooley, D. Myerson, and L. Corey. 1999. Successful medication of a pp65 antigenemia-based early treatment strategy for prevention of cytomegalovirus disease in allogeneic marrow transplant recipients. Blood 93:1781-1782.[Free Full Text]
2
2. Bowen, E. F. 1999. Cytomegalovirus reactivation in patients infected with HIV: the use of polymerase chain reaction in prediction and management. Drugs 57:735-741.[CrossRef][Medline]
3
3. Caliendo, A. M., R. Schuurman, B. Yen-Lieberman, S. A. Spector, J. Andersen, R. Manjiry, C. Crumpacker, N. S. Lurain, and A. Erice for the CMV Working Group of the Complications of HIV Disease RAC, AIDS Clinical Trials Group. 2001. Comparison of quantitative and qualitative PCR assays for cytomegalovirus DNA in plasma. J. Clin. Microbiol. 39:1334-1338.[Abstract/Free Full Text]
4
4. Camergo, L. F. A., D. E. Uip, A. A. Simpson, O. Caballero, N. A. Stolf, L. S. Vilas-Boas, and C. S. Pannuti. 2001. Comparison between antigenemia and a quantitative competitive polymerase chain reaction for the diagnosis of cytomegalovirus infection after heart transplantation. Transplantation 71:412-417.[CrossRef][Medline]
5
5. Eizuru, Y., K. Tamura, Y. Minamishima, K. Ogata, S. Tada, S. Inoue, M. Takeshita, and M. Kikuchi. 1987. Cytomegalovirus infection in adult T-cell leukemia patients. J. Med. Virol. 23:123-133.[Medline]
6
6. Fujiwara, H., T. Matsumoto, Y. Eizuru, K. Matsushita, H. Ohtsubo, T. Kukita, R. Imaizumi, M. Matsumoto, S. Hidaka, N. Arima, and C. Tei. 2000. Cytomegalovirus infection is not necessarily a poor prognostic factor in adult T-cell leukemia/lymphoma. J. Med. Virol. 62:140-143.[CrossRef][Medline]
7
7. Fujiwara, H., Y. Eizuru, T. Matsumoto, T. Kukita, R. Imaizumi, H. Kawada, H. Ohtsubo, K. Matsushita, N. Arima, and C. Tei. 2001. The significance of cytomegalovirus infection over the clinical course of adult T-cell leukemia/lymphoma. Microbiol. Immunol. 45:97-100.[Medline]
8
8. Gondo, H., T. Minematsu, M. Harada, K. Akashi, S. Hayashi, S. Taniguchi, K. Yamasaki, T. Shibuya, Y. Takamatsu, T. Teshima, T. Eto, K. Nagafuji, S. Mizuno, K. Hosoda, R. Mori, Y. Minamishima, and Y. Niho. 1994. Cytomegalovirus (CMV) antigenemia for rapid diagnosis and monitoring of CMV-associated disease after bone marrow transplantation. Br. J. Haematol. 86:130-137.[Medline]
9
9. Goodrich, J. M., R. A. Bowden, L. Fisher, C. Keller, G. Schoch, and J. D. Meyers. 1993. Ganciclovir prophylaxis to prevent cytomegalovirus disease after allogeneic marrow transplant. Ann. Intern. Med. 118:173-178.[Abstract/Free Full Text]
10
10. Humar, A., J. Lipton, S. Welsh, G. Moussa, H. Messner, and T. Mazzulli. 2001. A randomized trial comparing cytomegalovirus antigenemia assay vs screening bronchoscopy for the early detection and prevention of disease in allogeneic bone marrow and peripheral blood stem cell transplant recipients. Bone Marrow Transplant. 28:485-490.[CrossRef][Medline]
11
11. Limaye, A. P., M. L. Huang, W. Leisenring, L. Stensland, L. Corey, and M. Boeckh. 2001. Cytomegalovirus (CMV) DNA load in plasma for the diagnosis of CMV disease before engraftment in hematopoietic stem-cell transplant recipients. J. Infect. Dis. 183:377-382.[CrossRef][Medline]
12
12. Limaye, A. P. 2002. Ganciclovir-resistant cytomegalovirus in organ transplant recipients. Clin. Infect. Dis. 35:866-872.[CrossRef][Medline]
13
13. Machida, U., M. Kami, T. Fukui, Y. Kazuyama, M. Kinoshita, Y. Tanaka, Y. Kanda, S. Ogawa, H. Honda, S. Chiba, K. Mitani, Y. Muto, K. Osumi, S. Kimura, and H. Hirai. 2000. Real-time automated PCR for early diagnosis and monitoring of cytomegalovirus infection after bone marrow transplantation. J. Clin. Microbiol. 38:2536-2542.[Abstract/Free Full Text]
14
14. Mori, T., S. Okamoto, R. Watanabe, T. Yajima, Y. Iwao, R. Yamazaki, T. Nakazato, N. Sato, T. Iguchi, H. Nagayama, N. Takayama, T. Hibi, and Y. Ikeda. 2002. Dose-adjusted preemptive therapy for cytomegalovirus disease based on real-time polymerase chain reaction after allogeneic hematopoietic stem cell transplantation. Bone Marrow Transplant. 29:777-782.[CrossRef][Medline]
15
15. Myers, J. D., N. Flournoy, and E. D. Thomas. 1986. Risk factors for cytomegalovirus infection after human marrow transplantation. J. Infect. Dis. 153:478-488.[Medline]
16
16. Najioullah, F., D. Thouvenot, and B. Lina. 2001. Development of a real-time PCR procedure including an internal control for the measurement of HCMV viral load. J. Virol. Methods 92:55-64.[CrossRef][Medline]
17
17. Nazzari, C., A. Gaeta, M. Lazzarini, T. D. Castelli, and C. Mancini. 2000. Multiplex polymerase chain reaction for the evaluation of cytomegalovirus DNA load in organ transplant recipients. J. Med. Virol. 61:251-258.[CrossRef][Medline]
18
18. Poiesz, B. J., F. W. Ruscetti, A. F. Gazdar, P. A. Bunn, J. D. Minna, and R. C. Gallo. 1980. Detection and isolation of type C retrovirus particle from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc. Natl. Acad. Sci. USA 77:7415-7419.[Abstract/Free Full Text]
19
19. Shimoyama, M. 1991. Diagnostic criteria and classification of clinical subtypes of adult T-cell leukaemia-lymphoma. A report from the Lymphoma Study Group (1984-1987). Br. J. Haematol. 79:428-437.[Medline]
20
20. Tanaka, N., H. Kimura, K. Iida, Y. Saito, I. Tsuge, A. Yoshimi, T. Matsuyama, and T. Morishima. 2000. Quantitative analysis of cytomegalovirus load using a real-time PCR assay. J. Med. Virol. 60:455-462.[CrossRef][Medline]
21
21. Tanaka, Y., Y. Kanda, M. Kami, S. Mori, T. Hamaki, E. Kusumi, S. Miyakoshi, Y. Nannya, S. Chiba, Y. Arai, K. Mitani, H. Hirai, and Y. Mutou for the Japan Hematology and Oncology Clinical Study Group (J-HOCS). 2002. Monitoring cytomegalovirus infection by antigenemia assay and two distinct plasma real-time PCR methods after hematopoietic stem cell transplantation. Bone Marrow Transplant. 30:315-319.[CrossRef][Medline]
22
22. Tokimatsu, I., T. Tashiro, and M. Nasu. 1995. Early diagnosis and monitoring of human cytomegalovirus pneumonia in patients with adult T-cell leukemia by DNA amplification in serum. Chest 107:1024-1027.[Abstract/Free Full Text]
23
23. Utsunomiya, A., Y. Miyazaki, Y. Takatsuka, S. Hanada, K. Uozumi, S. Yoshiki, M. Tara, F. Kawano, Y. Saburi, H. Kikuchi, M. Hara, H. Sao, Y. Morishima, Y. Kodera, S. Sonoda, and M. Tomonaga. 2001. Improved outcome of adult T cell leukemia/lymphoma with allogeneic hematopoietic stem cell transplantation. Bone Marrow Transplant. 27:15-20.[CrossRef][Medline]
24
24. Watanabe, J., H. Kondo, and K. Hatake. 2001. Autologous stem cell transplantation for recurrent adult T cell leukaemia/lymphoma using highly purified CD34+ cells derived from cryopreserved peripheral blood stem cells. Leuk. Lymphoma 42:1115-1117.[Medline]
25
25. Yakushiji, K., H. Gondo, K. Kamezaki, K. Shigematsu, S. Hayashi, M. Kuroiwa, S. Taniguchi, Y. Ohno, K. Takase, A. Numata, K. Aoki, K. Kato, K. Nagafuji, K. Shimoda, T. Okamura, N. Kinukawa, N. Kasuga, M. Sata, and M. Harada. 2002. Monitoring of cytomegalovirus reactivation after allogeneic stem cell transplantation: comparison of an antigenemia assay and quantitative real-time polymerase chain reaction. Bone Marrow Transplant. 29:599-606.[CrossRef][Medline]
26
26. Yoshida, A., S. Hitomi, T. Fukui, H. Endo, Y. Morisawa, Y. Kazuyama, K. Osumi, S. Oka, and S. Kimura. 2001. Diagnosis and monitoring of human cytomegalovirus disease in patients with human immunodeficiency virus infection by use of a real-time PCR assay. Clin. Infect. Dis. 33:1756-1761.[CrossRef][Medline]

---

Journal of Clinical Microbiology, September 2003, p. 4382-4387, Vol. 41, No. 9
0095-1137/03/$08.00+0     DOI: 10.1128/JCM.41.9.4382-4387.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Smolej, L. (2008). Valganciclovir versus valaciclovir for prevention of alemtuzumab-induced cytomegalovirus reactivation: what are the implications for routine clinical practice?. Blood 112: 2167-2167 [Full Text]  
• Espy, M. J., Uhl, J. R., Sloan, L. M., Buckwalter, S. P., Jones, M. F., Vetter, E. A., Yao, J. D. C., Wengenack, N. L., Rosenblatt, J. E., Cockerill, F. R. III, Smith, T. F. (2006). Real-Time PCR in Clinical Microbiology: Applications for Routine Laboratory Testing. Clin. Microbiol. Rev. 19: 165-256 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ikewaki, J. Articles by Nasu, M. Search for Related Content PubMed PubMed Citation Articles by Ikewaki, J. Articles by Nasu, M.