This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Foulon, I.
Right arrow Articles by Lauwers, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Foulon, I.
Right arrow Articles by Lauwers, S.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, September 2003, p. 4428-4430, Vol. 41, No. 9
0095-1137/03/$08.00+0     DOI: 10.1128/JCM.41.9.4428-4430.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Prevalence of Fragilysin Gene in Bacteroides fragilis Isolates from Blood and Other Extraintestinal Samples

Ina Foulon, Denis Piérard,* Gaëtan Muyldermans, Kristof Vandoorslaer, Oriane Soetens, Paul Rosseel, and Sabine Lauwers

Department of Microbiology, Academisch Ziekenhuis Vrije Universiteit Brussel, Brussels, Belgium

Received 18 March 2003/ Returned for modification 22 April 2003/ Accepted 3 June 2003


arrow
ABSTRACT
 
Of 166 Bacteroides fragilis isolates, 26.2% of 103 isolates from blood and 20.6% of 63 extraintestinal isolates harbored the fragilysin gene (difference not statistically significant). Clinical characteristics and evolution were comparable in patients with B. fragilis bacteremia with or without this enterotoxin. Fragilysin seems not to be an important virulence factor in B. fragilis disease.


arrow
TEXT
 
Bacteroides fragilis is an obligatory anaerobic microorganism found in the normal intestinal flora of humans. It plays an important role in intra-abdominal infections. Some strains of B. fragilis associated with diarrhea in young farm animals (7, 8) and humans (9) produce an extracellular enterotoxin also known as fragilysin. This zinc metalloprotease (6, 10), constituted by a single polypeptide (20 kDa) (17), may also play a role in extraintestinal infections (3). The target of fragilysin is the cell surface protein E-cadherin (19), which is the principal structural component of the zonula adherens, responsible for cell-cell adhesions. The action of fragilysin can lead to cytoskeletal rearrangements (14), cellular damage to epithelial cells, and fluid accumulation in ligated lamb ileal loops (7). It is cytotoxic for certain human intestinal carcinoma cell lines, particularly HT-29 (17, 18). The clinical implications of fragilysin remain unclear, since strains producing this enterotoxin may be carried as part of the normal colonic flora.

Fragilysin-producing strains have been found in different parts of the world (United States, Europe, India, and Japan) (2, 5, 9, 11-13, 15, 16) among isolates from various specimens, such as abscesses, blood, and feces. Their prevalence varies between 9 and 25% of all B. fragilis isolates, according to author and country (2, 16). Kato et al. (5) showed that fragilysin production is more prevalent in blood isolates (28.1%) than in isolates from other extraintestinal specimens (13.7%).

In this study, we examined 103 B. fragilis strains isolated from blood and 63 strains isolated from other extraintestinal sites for the presence of the gene encoding fragilysin. Gene expression, requiring much more elaborated techniques, was not studied, since Kato et al. did not find discrepancies between the presence of the gene and production of the toxin (5). The strains we examined were isolated from samples routinely submitted to the department of microbiology for culture. The blood isolates were collected between 1989 and 2002, and the extraintestinal isolates were prospectively collected since 2000. All were saved at -20°C on glass beads after identification by standard anaerobic bacteriological methods (4): growth on fastidious anaerobe agar (LAB M, Bury, Lancashire, United Kingdom) with 5% horse blood (FAS blood agar) incubated in anaerobic atmosphere but not in 5% CO2 or in air, morphology on Gram stain, good growth on Bacteroides bile esculin medium with hydrolysis of esculin, resistance to kanamycin, negative indole test, absence of fermentation of trehalose, arabinose, rhamnose, and salicin, and positive fermentation of sucrose. For detection of the fragilysin gene, single colonies of cultures of one glass bead were seeded on FAS blood agar and incubated anaerobically. After a visual check of the culture for purity, a few colonies were suspended in TE buffer (10 mM Tris.HCl, 1 mM EDTA [pH 8.0]), vortexed, heated for 10 min at 100°C, and used directly for the PCR. Primers GBF 101 (5'-GAGCCGAAGACGGTGTATGT-3') and GBF 110 (5'-TCCCACTGGCTTCAAAATCCGAAGC-3') (5) were used. The expected PCR product was a fragment of 358 bp. B. fragilis strains ATCC 4299 and ATCC 4302 were used, respectively, as positive and negative controls. As an inhibition control, the presence of a 16S rRNA gene fragment was demonstrated on all bacterial DNA samples by an amplification reaction using the primers PSL (AGGATTAGATACCCTGGTAGTCCA) and PSR (ACTTAACCCAACATCTCACGACAC) (1). The amplifications were performed in a 50-µl reaction mixture containing 1x reaction buffer II, 1.5 mM MgCl2, 200 mM deoxynucleoside triphosphates, 1 µM (each) primer, 1 U of TaqDNA polymerase (Applied Biosystems), and 1 µl of bacterial sample DNA. Conditions were optimized as follows: denaturation, 5 min at 94°C; amplification, 24 s at 94°C, 26 s at 55°C, and 26 s at 72°C for 30 cycles; extension, 5 min at 72°C. Product samples were held at 4°C prior to analysis. Gel electrophoresis was performed for 45 min at 120 V on a 1.5% agarose gel, with visualization by ethidium bromide staining.

Overall, 40 of the 166 B. fragilis isolates (24.1%) yielded a positive PCR for the fragilysin gene. This corresponds to the results of other studies, yielding percentages varying from 9 to 25% (2, 16). The proportion of gene-positive strains was higher for blood isolates (26.2%) than for the other extraintestinal isolates (20.6%). However, this difference was not statistically significant (chi-square test). Furthermore, in extraintestinal isolates, the percentages of gene-positive strains did not differ according to isolation site, as shown in Table 1. Three studies compared the prevalences of fragilysin-producing B. fragilis among blood isolates and other extraintestinal isolates and found it higher among blood isolates. However, in two studies as well as in our study, the difference was statistically not significant (2, 15), while only in the study of Kato et al. (5) did the difference reach statistical significance.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Prevalence of B. fragilis isolates positive for fragilysin PCR in different clinical specimens

We also compared the presence of the fragilysin gene in blood isolates with the clinical presentation. For 69 of the 103 bacteremia patients, including 20 with a fragilysin-positive isolate (29%) and 49 with fragilysin-negative isolate (71%), complete medical records were available. The parameters presented in Table 2 were reviewed. Qualitative parameters were analyzed by using the chi-square test, and quantitative parameters were analyzed by using the Student's t test: no significant difference was seen between the two groups.


View this table:
[in this window]
[in a new window]
  		TABLE 2. Clinical evaluation of 69 patients with B. fragilis bacteremia

We conclude that fragilysin production does not seem to be a virulence factor playing an important role in bacteremia or leading to more-severe disease.

(This work was presented at the 3rd World Congress on Anaerobic Bacteria and Infections, Glasgow, Scotland, 7 to 9 May 2003.)


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology, Academisch Ziekenhuis Vrije Universiteit Brussel, Laarbeeklaan 101, B-1090 Brussels, Belgium. Phone: 32 2 477 50 02. Fax: 32 2 477 50 15. E-mail: denis.pierard{at}az.vub.ac.be. Back


arrow
REFERENCES
 
    1
  1. Campbell, P. W., III, J. A. Phillips III, G. J. Heidecker, M. R. S. Krishnamani, R. Zahorchak, and T. L. Stull. 1995. Detection of Pseudomonas (Burkholderia) cepacia using PCR. Pediatr. Pulmonol. 20:44-49.[Medline]
    2. 2
  2. Claros, M. C., Z. C. Claros, Y. J. Tang, S. H. Cohen, J. Silva, Jr., E. J. Goldstein, and A. C. Rodloff. 2000. Occurrence of Bacteroides fragilis enterotoxin gene-carrying strains in Germany and the United States. J. Clin. Microbiol. 38:1996-1997.[Abstract/Free Full Text]
    3. 3
  3. Hase, C. C., and R. A. Finkelstein. 1993. Bacterial extracellular zinc-containing metalloproteases. Microbiol. Rev. 57:823-837.[Abstract/Free Full Text]
    4. 4
  4. Jousimies-Somer, H., P. Summanen, D. M. Citron, E. J. Baron, H. M. Wexler, and S. M. Finegold. 2002. Wadsworth-KTL anaerobic bacteriology manual, 6th ed. Star Publishing Company, Belmont, Calif.
    5. 5
  5. Kato, N., H. Kato, K. Watanabe, and K. Ueno. 1996. Association of enterotoxigenic Bacteroides fragilis with bacteremia. Clin. Infect. Dis. 23:S83-S86.
    6. 6
  6. Moncrief, J. S., R. Obiso, Jr., L. A. Barroso, J. J. Kling, R. L. Wright, R. L. Van Tassell, D. M. Lyerly, and T. D. Wilkins. 1995. The enterotoxin of Bacteroides fragilis is a metalloprotease. Infect. Immun. 63:175-181.[Abstract]
    7. 7
  7. Myers, L. L., B. D. Firehammer, D. S. Shoop, and M. M. Border. 1984. Bacteroides fragilis: a possible cause of acute diarrheal disease in newborn lambs. Infect. Immun. 44:241-244.[Abstract/Free Full Text]
    8. 8
  8. Myers, L. L., D. S. Shoop, B. D. Firehammer, and M. M. Border. 1985. Association of enterotoxigenic Bacteroides fragilis with diarrheal disease in calves. J. Infect. Dis. 152:1344-1347.[Medline]
    9. 9
  9. Myers, L. L., D. S. Shoop, L. L. Stackhouse, F. S. Newman, R. J. Flaherty, G. W. Letson, and R. B. Sack. 1987. Isolation of enterotoxigenic Bacteroides fragilis from humans with diarrhea. J. Clin. Microbiol. 25:2330-2333.[Abstract/Free Full Text]
    10. 10
  10. Obiso, R. J., Jr., D. R. Bevan, and T. D. Wilkins. 1997. Molecular modeling and analysis of fragilysin, the Bacteroides fragilis toxin. Clin. Infect. Dis. 25:S153-S155.
    11. 11
  11. Pantosti, A., M. Cerquetti, R. Colangeli, and F. D'Ambrosio. 1994. Detection of intestinal and extraintestinal strains of enterotoxigenic Bacteroides fragilis by the HT-29 cytotoxicity assay. J. Med. Microbiol. 41:191-196.[Abstract/Free Full Text]
    12. 12
  12. Pantosti, A., M. G. Menozzi, A. Frate, L. Sanfilippo, F. D'Ambrosio, and M. Malpeli. 1997. Detection of enterotoxigenic Bacteroides fragilis and its toxin in stool samples from adults and children in Italy. Clin. Infect. Dis. 24:12-16.[Medline]
    13. 13
  13. Sack, R. B., M. J. Albert, K. Alam, P. K. Neogi, and M. S. Akbar. 1994. Isolation of enterotoxigenic Bacteroides fragilis from Bangladeshi children with diarrhea: a controlled study. J. Clin. Microbiol. 32:960-963.[Abstract/Free Full Text]
    14. 14
  14. Sears, C. L., L. L. Myers, A. Lazenby, and R. L. Van Tassell. 1995. Enterotoxigenic Bacteroides fragilis. Clin. Infect. Dis. 20:S142-S148.
    15. 15
  15. Sédaillan, A., S. Bland, and I. Kroeli. 2001. Bacteroides fragilis entérotoxinogène: détermination et prévalence. Bull. Soc. Fr. Microbiol. 16:279-284.
    16. 16
  16. Szoke, I., E. Dosa, and E. Nagy. 1997. Enterotoxigenic Bacteroides fragilis in Hungary. Anaerobe 3:87-89.
    17. 17
  17. Van Tassell, R. L., D. M. Lyerly, and T. D. Wilkins. 1992. Purification and characterization of an enterotoxin from Bacteroides fragilis. Infect. Immun. 60:1343-1350.[Abstract/Free Full Text]
    18. 18
  18. Weikel, C. S., F. D. Grieco, J. Reuben, L. L. Myers, and R. B. Sack. 1992. Human colonic epithelial cells, HT29/C1, treated with crude Bacteroides fragilis enterotoxin dramatically alter their morphology. Infect. Immun. 60:321-327.[Abstract/Free Full Text]
    19. 19
  19. Wu, S., K. C. Lim, J. Huang, R. F. Saidi, and C. L. Sears. 1998. Bacteroides fragilis enterotoxin cleaves the zonula adherens protein, E-cadherin. Proc. Natl. Acad. Sci. USA 95:14979-14984.[Abstract/Free Full Text]

Journal of Clinical Microbiology, September 2003, p. 4428-4430, Vol. 41, No. 9
0095-1137/03/$08.00+0     DOI: 10.1128/JCM.41.9.4428-4430.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Sears, C. L. (2009). Enterotoxigenic Bacteroides fragilis: a Rogue among Symbiotes. Clin. Microbiol. Rev. 22: 349-369 [Abstract] [Full Text]  
  • Robertson, K. P., Smith, C. J., Gough, A. M., Rocha, E. R. (2006). Characterization of Bacteroides fragilis Hemolysins and Regulation and Synergistic Interactions of HlyA and HlyB. Infect. Immun. 74: 2304-2316 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Foulon, I.
Right arrow Articles by Lauwers, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Foulon, I.
Right arrow Articles by Lauwers, S.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»