This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tanaka, R.
Right arrow Articles by Nishimura, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tanaka, R.
Right arrow Articles by Nishimura, K.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, September 2003, p. 4457-4459, Vol. 41, No. 9
0095-1137/03/$08.00+0     DOI: 10.1128/JCM.41.9.4457-4459.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Difference in FKS1 Gene Sequences between Serotypes A and D of Cryptococcus neoformans

Reiko Tanaka,* Yumi Imanishi,{dagger} and Kazuko Nishimura

Research Center for Pathogenic Fungi and Microbial Toxicoses, Chiba University, Chiba 260-8673, Japan

Received 15 April 2003/ Returned for modification 21 April 2003/ Accepted 11 June 2003


arrow
ABSTRACT
 
We compared sequences of the glucan synthase (FKS1) gene in serotypes A and D of Cryptococcus neoformans. Four introns were present in serotype D but not serotype A. PCR with primers that flank these introns permits simple differentiation of serotypes A and D.


arrow
TEXT
 
Cryptococcus neoformans is a medically important yeast that causes disseminated infection and attacks the central nervous system of immunocompromised hosts. On the basis of the capsular polysaccharide antigen, C. neoformans has been classified into serotypes A, B, C, D, and AD (5). Morphological, biochemical, and genetic characteristics have been used to subdivide C. neoformans into varieties C. neoformans var. neoformans (serotypes A, D, and AD) and C. neoformans var. gattii (serotypes B and C) (7). Nakamura et al. (9) reported that the phylogenetic relations based on alignments of CAP59 gene sequences for the five serotypes of C. neoformans were consistent with the biochemical and serological data. Franzot et al. (4) suggested that serotypes A and D be distinguished on the basis of URA5 gene sequences, DNA fingerprinting patterns, and phenotypic differences. They restricted C. neoformans var. neoformans to serotype D isolates and created a new variety, C. neoformans var. grubii, for serotype A isolates. Another study previously reported the relations among serotype, mating type, and ploidy in C. neoformans (10). In that report, it was suggested that the serotype AD strain of C. neoformans is a hybrid of serotypes A and D, and several other reports have also discussed the origin of the serotype AD strain (1, 2, 8). In the present study, we screened for differences between serotypes A and D in the nucleotide sequence of the glucan synthase gene (FKS1). We analyzed FKS1 sequences for serotype D strains and compared these sequences with that of serotype A strain (GenBank accession no. AF102882) (11).

In the present study, we analyzed C. neoformans strains H99 (serotype A, mating type {alpha}; ATCC 208821), IFM 41469 (serotype A, mating type {alpha}), IFM 46660 (serotype A, mating type {alpha}), JEC 21 (serotype D, mating type {alpha}), IFM 5844 (serotype D, mating type {alpha}, B-3501), IFM 5845 (serotype D, mating type a, B-3502), IFM 5889 (serotype D, mating type {alpha}), CBS 132 (serotype AD, sterile), and IFM 46137 (serotype AD, mating type a{alpha}; F1 progeny of IFM 46660 and IFM 5845). JEC 21 and H99 were used in the Cryptococcus neoformans Genome Project by the Stanford Genome Technology Center (http://www-sequence.stanford.edu/group/C.neoformans/index.html). Serotyping was done with the slide agglutination test of the Crypto Check kit (Iatron Labs, Tokyo, Japan). Mating tests were performed as described previously (10).

Genomic DNA was extracted with GenTLE (Takara Bio, Inc., Shiga, Japan). Primers for sequencing FKS1 were designed from the sequence of GenBank accession no. AF102882 (H99). PCR was performed with Ready-To-Go PCR beads (Amersham Biosciences AB, Uppsala, Sweden) with an initial denaturation step of 94°C for 10 min followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 60°C for 1 min, extension at 72°C for 2 min, and a final single extension at 72°C for 10 min. PCR products were purified and sequenced with an ABI Prism 377 sequencer (Applied Biosystems, Foster City, Calif.) and the Thermo Sequenase II dye terminator cycle sequencing kit (Amersham Biosciences AB). Total RNA was prepared from yeast cells with the hot phenol method (6). cDNA was synthesized from total RNA with the SuperScript preamplification system (Invitrogen, Carlsbad, Calif.) according to the manufacturer's instructions. For differentiation of serotypes A and D, genomic DNA was amplified with primers GS (5'-CATTGTTTTCTACCGAGGCG-3') and Ha (5'-AGTGGCGATATACCTGGCAC-3') by PCR under the conditions described above.

In our sequence analysis of the FKS1 gene, we determined 5,304 bp of sequence for JEC 21 (serotype D) in the region corresponding to nucleotides (nt) 1965 to 7070 (5,106 bp) of H99 (serotype A). We detected four different insertion events in the sequence of H99 (Fig. 1): 45 bp at nt 3958, 53 bp at nt 5293, 46 bp at nt 5614, and 54 bp at nt 5831. The length of the fragment from JEC 21 was 198 bp longer than that from H99. Comparison of PCR products from amplification of cDNAs and genomic DNAs is shown in Fig. 2a. In serotype A strains, the cDNA and genomic DNA PCR product sizes were identical, but in serotype D strains, the cDNA PCR product was smaller than that of the genomic DNA, indicating that some sequences were not included in the mRNA. As shown in Fig. 1, each inserted fragment has the GT-AG motif at the ends, suggesting that the inserted sequences are introns. PCR specific for the regions containing the introns yielded products of different sizes for each serotype (Fig. 2b). In serotype A strains (H99, IFM 41469), an approximately 1,000-bp fragment (expected size, 1,003 bp) was amplified, whereas a 1,156-bp fragment was amplified in serotype D strains (JEC 21, IFM 5845, IFM 5889). Furthermore, in serotype AD (diploid) strains (10), two distinct bands were amplified. After electrophoresis, the gel (Fig. 2b) was blotted onto Gene Screen Plus nylon membrane (NEN Life Science Products, Boston, Mass.) and cross-linked by UV irradiation for 15 min. A 30-nt serotype A-specific probe (GTTTCCACATCAACAACATTTTGGTCATGA) and a 46-nt serotype D-specific probe (GTGAGTTACACTTGTGGCATTTGGAGTGCAAACTGACTCCTTGTAG) were labeled with digoxigenin (DIG) by with a DIG oligonucleotide 3'-end labeling kit (Roche Diagnostics, Basel, Switzerland). Hybridization was performed at 65°C overnight, and hybridization products were detected with a DIG luminescent detection kit (Roche Diagnostics). The results of Southern hybridization with serotype A- and D-specific probes are shown in Fig. 2c and d, respectively. The positive bands in Fig. 2c and d confirm that the two PCR bands for serotype AD (Fig. 2b) were derived from serotypes A and D. These findings indicate that serotypes A and D can be differentiated on the basis of FKS1 sequences.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 1. Sequences and positions of four introns in FKS1 of JEC 21 (serotype D). Positions are relative to the sequence of GenBank accession number AF102882.



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 2. PCR fragment of the FKS1 gene including the introns found in serotype D. (a) Fragments amplified from cDNA and genomic DNA. (b) Electrophoretic profiles of the predicted 1,003-bp fragment amplified with primers GS and Ha. (c) Southern hybridization of the gel in panel b with serotype A-specific probe. (d) Southern hybridization of the gel in panel b with serotype D-specific probe.

Recently, genotype data have led to genus and species rearrangements in yeast taxonomy. Traditional methods of classification, such as morphological and physiological characteristics, are not sufficient to classify new species of yeasts. Several genotyping studies of C. neoformans suggested that the phylogenetic differences between serotypes A and D (var. neoformans) were more significant than those between serotypes B and C (var. gattii) (3, 9). Franzot et al. (4) created var. grubii, which includes all serotype A isolates. In the present study, we identified four introns in the FKS1 gene of a serotype D strain (JEC 21) that were absent in a serotype A strain (H99). Our genotype data support the use of var. grubii proposed by Franzot et al. (4); however, genotype data alone may not convince mycologists to recognize var. grubii (1). Further studies including protein expression or enzyme activity are needed.

It is easy to differentiate serotypes A and D, as shown in Fig. 2b. Nakamura et al. (9) suggested that there were limitations to serotyping with antisera and atypical biochemical characteristics. It was previously reported that IFM 5889 was serotype AD and haploid (10), but the present analysis revealed that IFM 5889 is serotype D. These results as well as those of Nakamura et al. (9) emphasize the limitations of serotyping with antisera. Restricted to serotypes A and D, our PCR primer set is a useful and simple means to differentiate serotypes A and D. Furthermore, our present results support the previous findings (10) that serotype AD strains are diploid hybrids of serotypes A and D.

Nucleotide sequence accession numbers. Sequences determined in this study are deposited in DNA Data Bank of Japan (DDBJ) under accession numbers AB091347 (JEC 21), AB091348 (IFM 5844), AB091349 (IFM 5845), AB091350 (IFM 5889), AB091351 (IFM 41469), and AB091352 (IFM 46660).


arrow
ACKNOWLEDGMENTS
 
This study was performed as part of the program Frontier Studies and International Networking of Genetic Resources in Pathogenic Fungi and Actinomycetes (FN-GRPF) through the Special Coordination Funds for Promoting Science and Technology from the Ministry of Education, Culture, Sports, Science and Technology of the Japanese Government in 2002.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Research Center for Pathogenic Fungi and Microbial Toxicoses, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8673, Japan. Phone: 81-43-226-2788. Fax: 81-43-226-2486. E-mail: moru{at}faculty.chiba-u.jp. Back

{dagger} Present address: NITE Biological Resource Center, National Institute of Technology and Evaluation, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba 292-0818, Japan. Back


arrow
REFERENCES
 
    1
  1. Boekhout, T., B. Theelen, M. Diaz, J. W. Fell, W. C. J. Hop, E. C. A. Abeln, F. Dromer, and W. Meyer. 2001. Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans. Microbiology 147:891-907.[Abstract/Free Full Text]
  2. 2
  3. Cogliati, M., M. C. Esposto, D. L. Clarke, B. L. Wickes, and M. A. Viviani. 2001. Origin of Cryptococcus neoformans var. neoformans diploid strains. J. Clin. Microbiol. 39:3889-3894.[Abstract/Free Full Text]
  4. 3
  5. Franzot, S. P., B. C. Fries, W. Cleare, and A. Casadevall. 1998. Genetic relationship between Cryptococcus neoformans var. neoformans strains of serotypes A and D. J. Clin. Microbiol. 36:2200-2204.
  6. 4
  7. Franzot, S. P., I. F. Salkin, and A. Casadevall. 1999. Cryptococcus neoformans var. grubii: separate varietal status for Cryptococcus neoformans serotype A isolates. J. Clin. Microbiol. 37:838-840.[Abstract/Free Full Text]
  8. 5
  9. Ikeda, R., T. Shinoda, Y. Fukazawa, and L. Kaufman. 1982. Antigenic characterization of Cryptococcus neoformans serotypes and its application to serotyping of clinical isolates. J. Clin. Microbiol. 16:22-29.[Abstract/Free Full Text]
  10. 6
  11. Kohrer, K., and H. Domdey. 1991. Preparation of high molecular weight RNA. Methods Enzymol. 194:398-405.[Medline]
  12. 7
  13. Kwon-Chung, K. J., J. E. Bennett, and T. S. Theodore. 1978. Cryptococcus basillisporus sp. nov.: serotype B-C of Cryptococcus neoformans. Int. J. Syst. Bacteriol. 28:616-620.[Abstract/Free Full Text]
  14. 8
  15. Lengeler, K. B., G. M. Cox, and J. Heitman. 2001. Serotype AD strains of Cryptococcus neoformans are diploid or aneuploid and are heterozygous at the mating-type locus. Infect. Immun. 69:115-122.[Abstract/Free Full Text]
  16. 9
  17. Nakamura, Y., R. Kano, S. Watanabe, and A. Hasegawa. 2000. Molecular analysis of CAP59 gene sequences from five serotypes of Cryptococcus neoformans. J. Clin. Microbiol. 38:992-995.[Abstract/Free Full Text]
  18. 10
  19. Tanaka, R., K. Nishimura, and M. Miyaji. 1999. Ploidy of serotype AD strains of Cryptococcus neoformans. Jpn. J. Med. Mycol. 40:31-34.
  20. 11
  21. Thompson, J. R., C. M. Douglas, W. Li, C. K. Jue, B. Pramanik, X. Yuan, T. H. Rude, D. L. Toffaletti, J. R. Perfect, and M. Kurtz. 1999. A glucan synthase FKS1 homolog in Cryptococcus neoformans is single copy and encodes an essential function. J. Bacteriol. 181:444-453.[Abstract/Free Full Text]


Journal of Clinical Microbiology, September 2003, p. 4457-4459, Vol. 41, No. 9
0095-1137/03/$08.00+0     DOI: 10.1128/JCM.41.9.4457-4459.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Enache-Angoulvant, A., Chandenier, J., Symoens, F., Lacube, P., Bolognini, J., Douchet, C., Poirot, J. L., Hennequin, C. (2007). Molecular Identification of Cryptococcus neoformans Serotypes. J. Clin. Microbiol. 45: 1261-1265 [Abstract] [Full Text]  
  • Stajich, J. E., Dietrich, F. S. (2006). Evidence of mRNA-Mediated Intron Loss in the Human-Pathogenic Fungus Cryptococcus neoformans. Eukaryot Cell 5: 789-793 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tanaka, R.
Right arrow Articles by Nishimura, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tanaka, R.
Right arrow Articles by Nishimura, K.