This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hashikawa, S.
Right arrow Articles by Ohta, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hashikawa, S.
Right arrow Articles by Ohta, M.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, January 2004, p. 186-192, Vol. 42, No. 1
0095-1137/04/$08.00+0     DOI: 10.1128/JCM.42.1.186-192.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Characterization of Group C and G Streptococcal Strains That Cause Streptococcal Toxic Shock Syndrome

Shinnosuke Hashikawa,1 Yoshitsugu Iinuma,2 Manabu Furushita,1,3 Teruko Ohkura,1,4 Toshi Nada,4 Keizo Torii,1 Tadao Hasegawa,1 and Michio Ohta1*

Departments of Bacteriology,1 Clinical Laboratory Medicine, Nagoya University Graduate School of Medicine, Showa-ku, Nagoya 466-8550,4 Department of Central Clinical Laboratory, Kyoto University Hospital, Konoe-cho, Yoshida, Sakyo-ku, Kyoto 606-8501,2 Department of Food Science and Technology, National Fisheries University, Shimonoseki, Yamaguchi 759-6595, Japan3

Received 29 March 2003/ Returned for modification 2 June 2003/ Accepted 7 October 2003


arrow
ABSTRACT
 
Twelve strains (the largest number ever reported) of group C and G1 streptococci (GCS and GGS, respectively) that caused streptococcal toxic shock syndrome (STSS) were collected and characterized. Eleven strains were identified as Streptococcus dysgalactiae subsp. equisimilis, and one strain was identified as Streptococcus equi subsp. zooepidemicus. We found that it was the first reported case of STSS caused by S. equi subsp. zooepidemicus. Cluster analysis according to the 16S rRNA gene (rDNA) sequences revealed that the S. dysgalactiae strains belonged to clusters I and II, both of which were closely related. The emm types and the restriction patterns of chromosomal DNA measured by pulsed-field gel electrophoresis were highly variable in these strains except BL2719 and N1434. The 16S rDNA sequences and other characteristics of these two strains were indistinguishable, suggesting the clonal dissemination of this particular S. dysgalactiae strain in Japan. As the involvement of superantigens in the pathogenesis of group A streptococcus-related STSS has been suggested, we tried to detect known streptococcal superantigens in GCS and GGS strains. However, only the spegg gene was detected in seven S. dysgalactiae strains, with none of the other superantigen genes being detected in any of the strains. However, the sagA gene was detected in all of the strains except Tokyo1291. In the present study no apparent factor(s) responsible for the pathogenesis of STSS was identified, although close genetic relationships of GCS and GGS strains involved in this disease were suggested.


arrow
INTRODUCTION
 
A toxic shock-like syndrome due to group A streptococcus (GAS) (Streptococcus pyogenes) was reported in the late 1980s (8). Since then the number of patients of this serious infectious disease has been increasing in North America, Europe, and other parts of the world (2, 10, 18, 21, 34). The Working Group on Severe Streptococcal Infections suggested a case definition of streptococcal toxic shock syndrome (STSS) and necrotizing fasciitis (52). STSS caused by GAS was characterized as a severe infectious disease which progresses to septic shock and multiple organ failure with a frequent occurrence of necrotizing fasciitis.

Recently, case reports referring to STSS caused by the Lancefield group C streptococci (GCS and Gi and GGS, respectively) have also accumulated (1, 2, 11, 14, 17, 24, 27, 30, 35, 38, 45, 49; H. Watanabe (ed.), Rep. 24th Hyg. Microbe Meet., p. 23-27, 2002 [In Japanese]). However, epidemiological analysis and study for toxin production profiles of the causative organisms have not been fully conducted yet, whereas such analysis and study have been carried out for those organisms associated with GAS-induced STSS. Most clinical isolates of GCS and GGS show beta-hemolysis on sheep blood agar, and some isolates are susceptible to bacitracin. Therefore, these beta-hemolytic GCS and GGS may be misidentified as GAS unless Lancefield serologic testing is performed. Beta-hemolytic GCS include S. equi (subspecies equi and zooepidemicus), S. dysgalactiae (subspecies dysgalactiae and equisimilis), S. anginosus, and S. constellatus, and beta-hemolytic GGS include S. dysgalactiae, S. canis, S. uberis, S. intestinalis, and S. anginosus, respectively. Some of these bacteria cause various infections in domestic animals and, sometimes, in humans. Previous studies have demonstrated that none of these beta-hemolytic GCS and GGS secrete any major exotoxins (17, 27, 35, 38, 45, 49). Unlike GAS-induced STSS, underlying conditions have been noted in most patients with STSS related to GCS and GGS. These patients had cardiopulmonary disease, diabetes mellitus, malignancy, and renal or hepatic failure, etc.

In the present study we collected and characterized GCS and GGS strains that caused STSS. We determined the 16S rRNA gene (rDNA) sequences of these strains for identification of the species, since the 16S rDNA is highly conserved within a streptococcal species and can be used as the "gold standard" for identification of the species of bacteria (51). We performed epidemiological analyses with chromosomal pulsed-field gel electrophoresis (PFGE) and emm typing of these GCS and GGS strains. We further searched for the genes encoding superantigenic or mitogenic toxins, including a number of novel streptococcal exotoxins that are believed to express superantigenic or mitogenic activities (1, 39, 49), for more understanding of the pathogenesis of this rare, severe infection.


arrow
MATERIALS AND METHODS
 
Bacterial strains. GGS and GCS strains collected in this study are shown in Table 1. All these strains were recently isolated as causative organisms from STSS patients in Japan. S. pyogenes SF370 was provided courtesy of J. J. Ferretti (13, 44). This strain carried superantigenic genes of speB, speC, speF, mf-2, mf-3, speG, speH, speI, speJ, smeZ, and sagA and was used as a positive control. S. pyogenes 1246 (29) and S. pyogenes Ji are clinical isolates harboring speA, speC, and speL and were also used as positive controls to detect these superantigenic genes.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Species and emm type of GCS and GGS strains used in this study

Identification of bacteria. The GGS and GCS strains that caused STSS were identified on the basis of phenotypic characteristics as determined by a rapid ID 32 STREP kit (bioMérieux, Marcy-l'Etoile, France). Phylogenetic analysis of these strains was performed with 16S rDNA sequence. The 16S rDNA was amplified by PCR using a thermal cycler (GeneAmp PCR 9700; Applied Biosystems, Foster City, Calif.) and degenerate primers 27F [AGAGTTTGATC(A/C)TGGCTCAG] and 1492R (GGCTACCTTGTTACGACTT). PCR template DNA was prepared according to the emm typing protocol (http://www.cdc.gov /ncidod/biotech/strep/strepindex.html). The PCR for 16S rDNA was carried out by denaturation over 2 min at 94°C, followed by 30 cycles of 60 s at 94°C, 45 s at 55°C, and 90 s at 72°C with a final extension at 72°C for 5 min. PCR products were purified with a Qiaquick PCR purification kit (Qiagen, Hilden, Germany) and were sequenced on a CEQ 2000 DNA analysis system (Beckman Coulter, Fullerton, Calif.) using a Beckman Dye terminator cycle sequencing kit (CEQ DTCS kit) with the primers 27F, 323F (AGACACGGCCCAGACTCCTA), 702F (GTAGCGGTGAAATGCGTAGA), 683R (CTACGCATTTCACCGCTAC), 1238R (TTGTAGCACGTGTGTAGCCC), and 1492R. These kits were used according to the manufacturer's instructions. The search for 16S rDNA sequences of streptococci was performed using Similar Rank in the RDP database (28). The 16S rDNA sequences were aligned using CLUSTAL W software (46). Kimura's two-parameter model was applied for the calculation of evolutionary distance (25), and a phylogenetic tree was constructed by using the neighbor-joining method. Bootstrap analyses of 1,000 replicates were carried out using CLUSTAL W. The classification of S. dysgalactiae into two subgroups was based on the recent approval of this classification (47, 48). The 16S rDNA sequences used for depicting a phylogenetic tree include the sequences of S. dysgalactiae subsp. dysgalactiae ATCC 43078 (GenBank accession no. AB002485) and ATCC 27957 (AB002484); S. dysgalactiae V26 (AB002512), A5 (AB002490), L7 (AB002507), A24 (AB002488), A7 (AB002492), L1 (AB002494), V24 (AB002510), L33 (AB002501), and A20 (AB002487); S. dysgalactiae subsp. equisimilis AC-2074 (AJ314611), AC-2832 (AJ314611), AC-2713 (AJ314609), and NCFB1356 (AB008926); S. uberis JCM 5709 (AB023573) and HN1 (AB023576); S. equi subsp. zooepidemicus ATCC 19615 (AB002516); S. equi subsp. equi ATCC 33398 (AB002515); S. pyogenes ATCC 19613 (Y12924); and S. pneumoniae MFF911410 (AB002522).

Typing of M protein gene (emm). The M protein types of the GCS and GGS strains were determined according to the M protein gene (emm) typing protocol by the sequencing of the emm gene (http://www.cdc.gov/ncidod/biotech/strep /strepindex.html).

Susceptibility testing and detection of resistance genes. Antimicrobial susceptibilities were determined by a MicroScan (Dade Behring, Deerfield, Ill.) microdilution method and Etest (AB Biodisk, Solna, Sweden) and were confirmed by an agar dilution method.

Erythromycin resistance genes (ermB, ermTR, and mefA) were searched by PCR (12, 42, 43). For amplification of erythromycin resistance genes, the following primers were used: 5'-GAAAARGTACTCAACCAAATA-3' (R indicates A or G) and 5'-AGTAACGGTACTTAAATTGTTTAC-3' for ermB (43), 5'-TCAGGAAAAGGACATTTTAC-3' and 5'-ATACTTTTTGTAGTCCTTCTTT-3' for ermTR (designed on the basis of the homologous region of ermTR and ermA), and 5'-AGTATCATTAATCACTAGTGC-3' and 5'-TTCTTCTGGTACTAAAAGTGG-3' for mefA (43).

The tetracycline resistance gene (tetM) was detected by PCR (4, 23). The sequences of the primers for amplification of tetM were 5'-TTATCAACGGTTTATCAGG-3' and 5'-CGTATATATGCAAGACG-3'.

PCR for erythromycin resistance genes (ermB, ermTR, and mefA) was carried out by denaturation over 2 min at 94°C, followed by 30 cycles of 30 s at 94°C, 30 s at 49°C, and 90 s at 72°C with a final extension at 72°C for 5 min. For tetM, the annealing temperature was changed to 50°C.

Detection of superantigenic genes and streptolysin S gene (sagA) by PCR. PCR primers were designed to detect superantigenic genes speA, speB, speC, speF, speH, speI, speJ, speL, mf-2, mf-3, and smeZ found in S. pyogenes and a superantigenic gene, spegg (GenBank accession no. AJ294849). spegg is a homologue of the S. pyogenes superantigenic gene speG and was found in S. dysgalactiae subsp. equisimilis (39). PCR template DNA was the same as that for emm typing. For amplification of superantigenic genes as well as the sagA gene, primers listed in Table 2 were designed according to the indicated references.


View this table:
[in this window]
[in a new window]
 
TABLE 2. PCR primer sets for detection of superantigenic genes and streptolysin S gene (sagA)

PCR for speA, speC, spegg, and speI was carried out by denaturation over 2 min at 94°C, followed by 30 cycles of 45 s at 94°C, 45 s at 51°C, and 90 s at 72°C with a final extension at 72°C for 5 min. For speB, speF, mf-2, and mf-3, the annealing temperature was changed to 55°C. For speH, speJ, speL, and smeZ, the annealing temperature was changed to 49°C. For sagA, the annealing temperature was changed to 50°C.

PFGE. PFGE of restriction enzyme-digested chromosomal DNA was carried out according to the previously described method (20). Briefly, chromosomal DNA was digested overnight with SmaI (Takara, Kyoto, Japan), and the digested sample was electrophoresed through 1% agarose gel in 0.5x TBE buffer (0.05 M Tris, 0.05 M boric acid, 1 mM EDTA [pH 8]) by using a Gene Navigator pulsed-field system (Amersham Pharmacia Biotech, Uppsala, Sweden). Electrophoresis was carried out at 200 V for 18 h, with the pulse time ranging from 1 to 20 s. Thereafter, the gel was stained with ethidium bromide, washed with distilled water, and photographed. Lambda DNA PFGE markers (Amersham Pharmacia Biotech) were used as size standards.

Nucleotide sequence accession numbers. The nucleotide sequences determined in this study were submitted to the DDBJ nucleotide sequence database, and the accession numbers for each strain were given as follows: BL2719 (AB10483), 1149 (AB104840), 1201 (AB104841), Fukuoka (AB104842), Tokyo1291 (AB104843), N1434 (AB104844), Hiroshima (AB104845), Ichi (AB104846), A-22-84 (AB104847), A-ka (AB104848), A-yo (AB104849), and A-sa (AB104850).


arrow
RESULTS
 
Differentiation of GCS and GGS strains and typing of the M protein gene (emm). The species of the GCS and GGS strains isolated from STSS patients were determined with a rapid ID 32 STREP kit (bioMérieux). The PCR-amplified 16S rDNA fragments ranging from positions 27 to 1511 of the 16S rDNA sequence of Escherichia coli were directly sequenced. These sequences corresponded to an estimated 93% of the total 16S rDNA primary sequence. These sequences were compared with the published 16S rDNA sequences of the streptococcal reference strains as described in Materials and Methods. According to the 16S rDNA sequences a dendrogram depicting the estimated phylogenetic relationships was constructed by the neighbor-joining clustering method (Fig. 1). Three sequence clusters could be defined in S. dysgalactiae subsp. equisimilis: cluster I contained strains Ichi, BL2719, N1434, 1149, 1201, and A-yo and had a mean 16S rDNA sequence similarity of 99.84 to 100%; cluster II contained Hiroshima, Fukuoka, A-22-84, A-ka, and A-sa and had a mean 16S rDNA sequence similarity of 99.77 to 100%; and cluster III had a mean 16S rDNA sequence similarity of 99.77 to 100%. The 16S rDNA sequences of strains belonging to clusters I and II were close to each other (99.62 to 99.92%), with 99.39 to 99.84% differences from cluster III. The reference strains belonging to cluster III have not been divided into subspecies based on the new classification (47, 48). We identified strains BL2719, 1149, 1201, Fukuoka, N1434, Hiroshima, Ichi, A-22-84, A-ka, A-yo, and A-sa as S. dysgalactiae subsp. equisimilis and identified strain Tokyo1291 as S. equi subsp. zooepidemicus based on the results of the rapid ID 32 STREP assay and of 16S rDNA analysis (Table 1).



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 1. Phylogenetic tree of GCS and GGS strains isolated from patients with STSS. A phylogenetic tree based on the 16S rDNA sequences was constructed by the neighbor-joining method. Bootstrap analyses of 1,000 replicates were carried out using CLUSTAL W software. Each of the STSS-related strains analyzed in this study is indicated as a square. Sequences of other strains were derived from the GenBank database. Species names of reference strains S. dysgalactiae V26, A5, L7, A24, A7, L1, V24, L33, and A20 appeared in the database under the old classification and were not identified into subspecies.

The M protein type was determined according to the emm typing protocol. As Table 1 shows, the emm types of BL2719, 1201, Fukuoka, N1434, Ichi, A-22-84, A-ka, A-yo, and A-sa were stg2078, stc839, stg6-1, stg2078, stc74a, stc36, stg480, stg485, and stg11, respectively. The emm types of strains 1149 and Hiroshima were novel types. The emm gene of Tokyo1291 was not amplified. These results indicate that no specific M proteins are related to the pathogenesis of STSS caused by GCS and GGS.

Detection of superantigenic genes and the sagA gene. In previous reports the involvement of superantigens in the pathogenesis of GAS-related STSS has been strongly suspected (26, 32, 33). We therefore tried to detect known streptococcal superantigens and putative superantigens by PCR with specific primers in the GCS and GGS strains that caused STSS. As shown in Table 3, spegg was detected in 1149, 1201, Ichi, A-22-84, A-ka, A-yo, and A-sa, but none of the other superantigenic genes were detected in any strains. The sagA gene was detected in all strains except Tokyo1291 (Table 3). It should be noted that a negative reaction in PCR implies simply loss or alteration of the target sequences for the primers and the presence of the entire superantigenic gene may not be excluded, although such a possibility is quite low.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Detection of superantigenic genes and streptolysin S gene (sagA) by PCR

Antimicrobial susceptibility and detection of resistance genes. All strains were sensitive to ß-lactam antibiotics such as penicillin G (MIC <= 0.03 µg/ml). These strains were also sensitive to vancomycin (MIC <= 0.5 µg/ml), trimethoprim-sulfamethoxazole (MIC <= 0.5 µg/ml), levofloxacin (MIC <= 1.0 µg/ml), chloramphenicol (MIC <= 0.5 µg/ml), and rifampin (MIC <= 1.0 µg/ml). However, for 6 out of 12 strains resistance to tetracycline was high (MIC = 32 µg/ml) or moderate (MIC = 2 to 8 µg/ml). The tetracycline resistance gene tetM was detected in both 1149 and Ichi, for which resistance to tetracycline was high. The strain A-sa was resistant to erythromycin, clarithromycin, and clindamycin (MICs >= 256 µg/ml) and other strains were susceptible to these antibiotics. We detected the erythromycin resistance gene ermB in A-sa.

PFGE. PFGE patterns of all 12 GCS and GGS strains are shown in Fig. 2. The restriction patterns of BL2719 and N1434 are indistinguishable from each other. Note that these two strains were isolated in different places and years. Other strains were genetically diverse.



View larger version (114K):
[in this window]
[in a new window]
 
FIG. 2. PFGE separation of SmaI-restricted fragments of the chromosomal DNA of the GCS and GGS strains.


arrow
DISCUSSION
 
In the past case reports of STSS caused by GCS and GGS (1, 2, 11, 14, 17, 24, 27, 30, 35, 38, 45, 49; H. Watanabe, Rep. 24th Hyg. Microbe Meet.), the causative bacteria in six cases were identified as S. dysgalactiae subsp. equisimilis (2, 27, 38) and S. equisimilis (24, 45), which was renamed as S. dysgalactiae subsp. equisimilis according to the latest classification (47, 48), while other reports did not identify the species of the causative bacteria. To the best of our knowledge, in the present study we report the first case of STSS caused by S. equi subsp. zooepidemicus. Clinical information is as follows. A 64-year-old male patient visited an emergency room on foot with lumbago, and 2 h later he lost consciousness and died. Autopsy of the patient indicated necrotic fasciitis of the left arm and underlying cirrhosis. The organism was isolated from the blood culture and the left arm. Strains of S. dysgalactiae subsp. equisimilis belong to Lancefield group C or G, whereas strains of S. equi subsp. zooepidemicus belongs to only group C. While S. dysgalactiae subsp. equisimilis colonizes and causes various infections in humans (51, 53), S. equi subsp. zooepidemicus is a common pathogen in domestic animals and causes various infections in animals. Therefore, most cases of human infection can be traced to an animal source (5). As our present study and earlier reports have indicated, these organisms secrete only a few superantigenic exotoxins or unknown exotoxins (1, 17, 27, 35, 38, 45, 49). Although clinical manifestations of STSS related to GCS and GGS are the same as those caused by GAS, the involvement of major superantigens such as SpeA, SpeB, and SpeC secreted from GAS are excluded. It has been proposed that streptococcal superantigens, especially pyrogenic exotoxins, are potentially responsible for at least some of the manifestations of STSS caused by GAS through the activation of Th1 cells and the liberation of large amounts of interleukins as well as inflammatory cytokines, such as tumor necrosis factor (9). Therefore, unidentified superantigenic exotoxins or exoenzymes may play a role in the development of STSS caused by GCS and GGS. Indeed, it has been reported that some GAS strains that caused STSS lacked one or more major superantigens (2, 18, 21).

Streptolysin S encoded by sagA was considered to be a contributing factor in the pathogenesis of streptococcal necrotizing soft tissue infection (19). The sagA gene was detected in all of the investigated GCS and GGS strains except Tokyo1291. However, the patient infected with Tokyo1291 showed necrotizing fasciitis, suggesting that streptolysin S may not be essential for the development of streptococcal necrotizing soft tissue infection, or in this case, underlying host factors might have an important role in the pathogenesis.

M protein is known to be the major virulence factor of GAS that inhibits the activation of the alternative complement pathway (9) and impedes phagocytosis by polymorphonuclear leukocytes (9). In epidemiological studies of STSS caused by GAS, M1 and M3 strains were most commonly isolated (2, 22, 34; H. Watanabe, Rep. 23rd Hyg. Microbe Meet.). However, other M serotypes of GAS have infrequently also been isolated from STSS patients. Therefore, the role of specific M proteins in the pathogenesis of STSS is still unknown. Since GCS and GGS have been shown to express M proteins that show high sequence homology to those of GAS (3, 15, 41), M proteins of GCS and GGS may also have antiphagocytic activity. However, whether or not GCS and GGS strains of specific emm (M) types are involved in the pathogenesis of STSS remains unknown, since only a few epidemiological studies on emm types of GCS and GGS that caused STSS have been performed (H. Watanabe, Rep. 23rd Hyg. Microbe Meet.). We found that the M types of GCS and GGS strains isolated from STSS patients were highly variable, suggesting that no specific types of M proteins were responsible for the pathogenesis of STSS caused by GCS and GGS. Interestingly, M type stg2078 was identified in two strains that were isolated in different places and on different occasions. Moreover, the PFGE patterns and the sequences of 16S rDNA of these strains were indistinguishable from each other. We therefore suspect the clonal dissemination of this particular S. dysgalactiae subsp. equisimilis strain in Japan. Additionally, we add two new emm types found in this study to the M protein group of S. dysgalactiae.

Unlike those with GAS-induced STSS, most patients with STSS caused by GCS and GGS have been noted to have serious underlying diseases. Patients with STSS in this study also had various underlying diseases such as malignancy, chronic renal or hepatic failure, diabetes mellitus, and collagen diseases. Most of these patients were given antibiotic therapy with penicillins and/or other antibiotics. As the present study indicated, all STSS strains were penicillin-sensitive. However, six strains were resistant to tetracycline and one strain was resistant to erythromycin. Among six strains that were resistant to tetracycline, strains 1149 and Ichi harbored tetM. Strain A-sa, which was resistant to erythromycin, harbored ermB. These sensitivity patterns were similar to those of other reports (6, 31) and GAS strains (6, 31, 40).

A nationwide surveillance for GAS-induced STSS started in Japan in 1999 by the enforcement of a new infection control law. However, cases of GCS and GGS-induced STSS were excluded in that surveillance. Because it seems likely that the frequency of STSS caused by GCS and GGS has increased recently, a surveillance study must be required for more understanding of the disease. In the present study we analyzed a larger number of STSS-causing GCS and GGS strains than had been analyzed in previous reports. Although we found no apparent STSS-related pathogenic factors in these strains, most of the strains belonged to the specific groups of S. dysgalactiae subsp. equisimilis. Epidemiological studies for more GCS and GGS strains related to STSS are expected to be helpful for the identification of the common pathogenic factors in this disease.


arrow
ACKNOWLEDGMENTS
 
We warmly thank J. J. Ferretti, University of Oklahoma Health Sciences Center, for providing the S. pyogenes strain SF370. We also thank Nihon University School of Medicine, Tokyo Metropolitan Research Laboratory of Public Health, Fukuoka University Hospital, Tokyo Medical University Department Anesthesia, Asahi General Hospital, Ichinomiya City Hospital, and Hiroshima City Hospital for providing us patient information with GCS or GGS clinical isolates that caused STSS.

This study was supported by Grants-in-Aid for Scientific Research (12557027 and 14370090) from the Ministry of Education and a grant for research on emerging and reemerging infectious disease (H12 Shinkou-27) from the Ministry of Health and Welfare, Japan.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Bacteriology, Nagoya University Graduate School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550, Japan. Phone: 81-52-744-2106. Fax: 81-52-744-2107. E-mail: mohta{at}med.nagoya-u.ac.jp. Back


arrow
REFERENCES
 
    1
  1. Assimacopoulos, A. P., J. A. Stoehr, and P. M. Schlievert. 1997. Mitogenic factors from group G streptococci associated with scarlet fever and streptococcal toxic shock syndrome. Adv. Exp. Med. Biol. 418:109-114.[Medline]
  2. 2
  3. Barnham, M. R., N. C. Weightman, A. W. Anderson, and A. Tanna. 2002. Streptococcal toxic shock syndrome: a description of 14 cases from North Yorkshire, UK. Clin. Microbiol. Infect. 8:174-181.[CrossRef][Medline]
  4. 3
  5. Ben Nasr, A., A. Wistedt, U. Ringdahl, and U. Sjobring. 1994. Streptokinase activates plasminogen bound to human group C and G streptococci through M-like proteins. Eur. J. Biochem. 222:267-276.[Medline]
  6. 4
  7. Blanchard, A., D. M. Crabb, K. Dybvig, L. B. Duffy, and G. H. Cassell. 1992. Rapid detection of tetM in Mycoplasma hominis and Ureaplasma urealyticum by PCR: tetM confers resistance to tetracycline but not necessarily to doxycycline. FEMS Microbiol. Lett. 74:277-281.[CrossRef][Medline]
  8. 5
  9. Bradley, S. F., J. J. Gordon, D. D. Baumgartner, W. A. Marasco, and C. A. Kauffman. 1991. Group C streptococcal bacteremia: analysis of 88 cases. Rev. Infect. Dis. 13:270-280.[Medline]
  10. 6
  11. Carroll, K. C., P. Monroe, S. Cohen, M. Hoffman, L. Hamilton, K. Korgenski, L. Reimer, D. Classen, and J. Daly. 1997. Susceptibility of beta-hemolytic streptococci to nine antimicrobial agents among four medical centers in Salt Lake City, Utah, USA. Diagn. Microbiol. Infect. Dis. 27:123-128.[CrossRef][Medline]
  12. 7
  13. Chaussee, M. S., J. Liu, D. L. Stevens, and J. J. Ferretti. 1996. Genetic and phenotypic diversity among isolates of Streptococcus pyogenes from invasive infections. J. Infect. Dis. 173:901-908.[Medline]
  14. 8
  15. Cone, L. A., D. R. Woodard, P. M. Schlievert, and G. S. Tomory. 1987. Clinical and bacteriologic observations of a toxic shock-like syndrome due to Streptococcus pyogenes. N. Engl. J. Med. 317:146-149.[Medline]
  16. 9
  17. Cunningham, M. W. 2000. Pathogenesis of group A streptococcal infections. Clin. Microbiol. Rev. 13:470-511.[Abstract/Free Full Text]
  18. 10
  19. Davies, H. D., A. McGeer, B. Schwartz, K. Green, D. Cann, A. E. Simor, D. E. Low, et al. 1996. Invasive group A streptococcal infections in Ontario, Canada. N. Engl. J. Med. 335:547-554.[Abstract/Free Full Text]
  20. 11
  21. Eskens, F. A., P. E. Verweij, J. F. Meis, and A. Soomers. 1995. Septic shock caused by group G beta-haemolytic streptococci as presenting symptom of acute myeloid leukaemia. Neth. J. Med. 46:153-155.[CrossRef][Medline]
  22. 12
  23. Facinelli, B., C. Spinaci, G. Magi, E. Giovanetti, and E. V. P. 2001. Association between erythromycin resistance and ability to enter human respiratory cells in group A streptococci. Lancet 358:30-33.[CrossRef][Medline]
  24. 13
  25. Ferretti, J. J., W. M. McShan, D. Ajdic, D. J. Savic, G. Savic, K. Lyon, C. Primeaux, S. Sezate, A. N. Suvorov, S. Kenton, H. S. Lai, S. P. Lin, Y. Qian, H. G. Jia, F. Z. Najar, Q. Ren, H. Zhu, L. Song, J. White, X. Yuan, S. W. Clifton, B. A. Roe, and R. McLaughlin. 2001. Complete genome sequence of an M1 strain of Streptococcus pyogenes. Proc. Natl. Acad. Sci. USA 98:4658-4663.[Abstract/Free Full Text]
  26. 14
  27. Fujiwara, Y., et al. 1999. Two case reports of toxic shock-like syndrome (TSLS). Cent. Jpn. J. Orthop. Traumat. 42:1187-1188. (In Japanese.)
  28. 15
  29. Geyer, A., A. Roth, S. Vettermann, E. Gunther, A. Groh, E. Straube, and K. Schmidt. 1999. M protein of a Streptococcus dysgalactiae human wound isolate shows multiple binding to different plasma proteins and shares epitopes with keratin and human cartilage. FEMS Immunol. Med. Microbiol. 26:11-24.[CrossRef][Medline]
  30. 16
  31. Hasegawa, T., K. Torii, S. Hashikawa, Y. Iinuma, and M. Ohta. 2002. Cloning and characterization of two novel DNases from Streptococcus pyogenes. Arch. Microbiol. 177:451-456.[CrossRef][Medline]
  32. 17
  33. Hirose, Y., K. Yagi, H. Honda, H. Shibuya, and E. Okazaki. 1997. Toxic shock-like syndrome caused by non-group A beta-hemolytic streptococci. Arch. Intern. Med. 157:1891-1894.[Abstract/Free Full Text]
  34. 18
  35. Hsueh, P. R., J. J. Wu, P. J. Tsai, J. W. Liu, Y. C. Chuang, and K. T. Luh. 1998. Invasive group A streptococcal disease in Taiwan is not associated with the presence of streptococcal pyrogenic exotoxin genes. Clin. Infect. Dis. 26:584-589.[Medline]
  36. 19
  37. Humar, D., V. Datta, D. J. Bast, B. Beall, J. C. De Azavedo, and V. Nizet. 2002. Streptolysin S and necrotising infections produced by group G streptococcus. Lancet 359:124-129.[CrossRef][Medline]
  38. 20
  39. Ichiyama, S., M. Ohta, K. Shimokata, N. Kato, and J. Takeuchi. 1991. Genomic DNA fingerprinting by pulsed-field gel electrophoresis as an epidemiological marker for study of nosocomial infections caused by methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 29:2690-2695.[Abstract/Free Full Text]
  40. 21
  41. Ikebe, T., A. Wada, Y. Inagaki, K. Sugama, R. Suzuki, D. Tanaka, A. Tamaru, Y. Fujinaga, Y. Abe, Y. Shimizu, and H. Watanabe. 2002. Dissemination of the phage-associated novel superantigen gene speL in recent invasive and noninvasive Streptococcus pyogenes M3/T3 isolates in Japan. Infect. Immun. 70:3227-3233.[Abstract/Free Full Text]
  42. 22
  43. Inagaki, Y., T. Konda, S. Murayama, S. Yamai, A. Matsushima, Y. Gyobu, D. Tanaka, A. Tamaru, C. Katsukawa, A. Katayama, M. Tomita, Y. Fuchi, K. Hoashi, H. Watanabe, et al. 1997. Serotyping of Streptococcus pyogenes isolated from common and severe invasive infections in Japan, 1990-5: implication of the T3 serotype strain-expansion in TSLS. Epidemiol. Infect. 119:41-48.[CrossRef][Medline]
  44. 23
  45. Jeric, P. E., H. Lopardo, P. Vidal, S. Arduino, A. Fernandez, B. E. Orman, D. O. Sordelli, and D. Centron. 2002. Multicenter study on spreading of the tet(M) gene in tetracycline-resistant Streptococcus group G and C isolates in Argentina. Antimicrob. Agents Chemother. 46:239-241.[Abstract/Free Full Text]
  46. 24
  47. Keiser, P., and W. Campbell. 1992. 'Toxic strep syndrome' associated with group C Streptococcus. Arch. Intern. Med. 152:882-884.
  48. 25
  49. Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16:111-120.[CrossRef][Medline]
  50. 26
  51. Kotb, M. 1995. Bacterial pyrogenic exotoxins as superantigens. Clin. Microbiol. Rev. 8:411-426.[Abstract]
  52. 27
  53. Kugi, M., H. Tojo, I. Haraga, T. Takata, K. Handa, and K. Tanaka. 1998. Toxic shock-like syndrome caused by group G Streptococcus. J. Infect. 37:308-309.[Medline]
  54. 28
  55. Maidak, B. L., J. R. Cole, T. G. Lilburn, C. T. Parker, Jr., P. R. Saxman, R. J. Farris, G. M. Garrity, G. J. Olsen, T. M. Schmidt, and J. M. Tiedje. 2001. The RDP-II (Ribosomal Database Project). Nucleic Acids Res. 29:173-174.[Abstract/Free Full Text]
  56. 29
  57. Matsumoto, M., T. Murai, S. Ichiyama, M. Saito, Y. Arakawa, and M. Ohta. 1997. Prevalence of the speA2 and speA3 alleles in Streptococcus pyogenes isolated from TSLS patients in Japan. FEMS Microbiol. Lett. 150:233-237.[Medline]
  58. 30
  59. Natoli, S., C. Fimiani, N. Faglieri, L. Laurenzi, A. Calamaro, A. M. Frasca, and E. Arcuri. 1996. Toxic shock syndrome due to group C streptococci. A case report. Intensive Care Med. 22:985-989.[Medline]
  60. 31
  61. Navaneeth, B. V., N. Ray, S. Chawda, P. Selvarani, M. Bhaskar, and N. Suganthi. 2001. Prevalence of beta hemolytic streptococci carrier rate among schoolchildren in Salem. Indian J. Pediatr. 68:985-986.[Medline]
  62. 32
  63. Norrby-Teglund, A., S. Chatellier, D. E. Low, A. McGeer, K. Green, and M. Kotb. 2000. Host variation in cytokine responses to superantigens determine the severity of invasive group A streptococcal infection. Eur. J. Immunol. 30:3247-3255.[CrossRef][Medline]
  64. 33
  65. Norrby-Teglund, A., R. Lustig, and M. Kotb. 1997. Differential induction of Th1 versus Th2 cytokines by group A streptococcal toxic shock syndrome isolates. Infect. Immun. 65:5209-5215.[Abstract]
  66. 34
  67. O'Brien, K. L., B. Beall, N. L. Barrett, P. R. Cieslak, A. Reingold, M. M. Farley, R. Danila, E. R. Zell, R. Facklam, B. Schwartz, and A. Schuchat. 2002. Epidemiology of invasive group a streptococcus disease in the United States, 1995-1999. Clin. Infect. Dis. 35:268-276.[CrossRef][Medline]
  68. 35
  69. Ojukwu, I. C., D. W. Newton, A. E. Luque, M. Y. Kotb, and M. Menegus. 2001. Invasive Group C Streptococcus infection associated with rhabdomyolysis and disseminated intravascular coagulation in a previously healthy adult. Scand. J. Infect. Dis. 33:227-229.[CrossRef][Medline]
  70. 36
  71. Proft, T., V. L. Arcus, V. Handley, E. N. Baker, and J. D. Fraser. 2001. Immunological and biochemical characterization of streptococcal pyrogenic exotoxins I and J (SPE-I and SPE-J) from Streptococcus pyogenes. J. Immunol. 166:6711-6719.[Abstract/Free Full Text]
  72. 37
  73. Proft, T., S. L. Moffatt, C. J. Berkahn, and J. D. Fraser. 1999. Identification and characterization of novel superantigens from Streptococcus pyogenes. J. Exp. Med. 189:89-102.[Abstract/Free Full Text]
  74. 38
  75. Roth, S., K. Andrassy, K. H. Schmidt, E. Gunther, and E. Ritz. 1999. Febrile lady with acute renal failure and desquamating erythema. Am. J. Kidney Dis. 34:150-154.[Medline]
  76. 39
  77. Sachse, S., P. Seidel, D. Gerlach, E. Gunther, J. Rodel, E. Straube, and K. H. Schmidt. 2002. Superantigen-like gene(s) in human pathogenic Streptococcus dysgalactiae, subsp equisimilis: genomic localisation of the gene encoding streptococcal pyrogenic exotoxin G (speG(dys)). FEMS Immunol. Med. Microbiol. 34:159-167.[CrossRef][Medline]
  78. 40
  79. Sauermann, R., R. Gattringer, W. Graninger, A. Buxbaum, and A. Georgopoulos. 2003. Phenotypes of macrolide resistance of group A streptococci isolated from outpatients in Bavaria and susceptibility to 16 antibiotics. J. Antimicrob. Chemother. 51:53-57.[Abstract/Free Full Text]
  80. 41
  81. Schnitzler, N., A. Podbielski, G. Baumgarten, M. Mignon, and A. Kaufhold. 1995. M or M-like protein gene polymorphisms in human group G streptococci. J. Clin. Microbiol. 33:356-363.[Abstract]
  82. 42
  83. Seppälä, H., M. Skurnik, H. Soini, M. C. Roberts, and P. Huovinen. 1998. A novel erythromycin resistance methylase gene (ermTR) in Streptococcus pyogenes. Antimicrob. Agents Chemother. 42:257-262.[Abstract/Free Full Text]
  84. 43
  85. Sutcliffe, J., T. Grebe, A. Tait-Kamradt, and L. Wondrack. 1996. Detection of erythromycin-resistant determinants by PCR. Antimicrob. Agents Chemother. 40:2562-2566.[Abstract]
  86. 44
  87. Suvorov, A. N., and J. J. Ferretti. 1996. Physical and genetic chromosomal map of an M type 1 strain of Streptococcus pyogenes. J. Bacteriol. 178:5546-5549.[Abstract/Free Full Text]
  88. 45
  89. Tanno, M., K. Oe, Y. Shimizu, K. Murata, T. Kubota, and J. Suzuki. 2000. A case of acute group G streptococcal myositis associated with toxic shock like syndrome. J. Jpn. Soc. Intensive Care Med. 7:115-120. (In Japanese.)
  90. 46
  91. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.[Abstract/Free Full Text]
  92. 47
  93. Vandamme, P., B. Pot, E. Falsen, K. Kersters, and L. A. Devriese. 1996. Taxonomic study of Lancefield streptococcal groups C, G, and L (Streptococcus dysgalactiae) and proposal of S. dysgalactiae subsp. equisimilis subsp. nov. Int. J. Syst. Bacteriol. 46:774-781.[Abstract/Free Full Text]
  94. 48
  95. Vieira, V. V., L. M. Teixeira, V. Zahner, H. Momen, R. R. Facklam, A. G. Steigerwalt, D. J. Brenner, and A. C. Castro. 1998. Genetic relationships among the different phenotypes of Streptococcus dysgalactiae strains. Int. J. Syst. Bacteriol. 48:1231-1243.[Abstract/Free Full Text]
  96. 49
  97. Wagner, J. G., P. M. Schlievert, A. P. Assimacopoulos, J. A. Stoehr, P. J. Carson, and K. Komadina. 1996. Acute group G streptococcal myositis associated with streptococcal toxic shock syndrome: case report and review. Clin. Infect. Dis. 23:1159-1161.[Medline]
  98. 50
  99. Weeks, C. R., and J. J. Ferretti. 1986. Nucleotide sequence of the type A streptococcal exotoxin (erythrogenic toxin) gene from Streptococcus pyogenes bacteriophage T12. Infect. Immun. 52:144-150.[Abstract/Free Full Text]
  100. 51
  101. Woo, P. C., A. M. Fung, S. K. Lau, S. S. Wong, and K. Y. Yuen. 2001. Group G beta-hemolytic streptococcal bacteremia characterized by 16S ribosomal RNA gene sequencing. J. Clin. Microbiol. 39:3147-3155.[Abstract/Free Full Text]
  102. 52
  103. The Working Group on Severe Streptococcal Infections. 1993. Defining the group A streptococcal toxic shock syndrome. Rationale and consensus definition. JAMA 269:390-391.[Abstract/Free Full Text]
  104. 53
  105. Zaoutis, T., B. Schneider, L. Steele Moore, and J. D. Klein. 1999. Antibiotic susceptibilities of group C and group G streptococci isolated from patients with invasive infections: evidence of vancomycin tolerance among group G serotypes. J. Clin. Microbiol. 37:3380-3383.[Abstract/Free Full Text]


Journal of Clinical Microbiology, January 2004, p. 186-192, Vol. 42, No. 1
0095-1137/04/$08.00+0     DOI: 10.1128/JCM.42.1.186-192.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Webb, K., Jolley, K. A., Mitchell, Z., Robinson, C., Newton, J. R., Maiden, M. C. J., Waller, A. (2008). Development of an unambiguous and discriminatory multilocus sequence typing scheme for the Streptococcus zooepidemicus group. Microbiology 154: 3016-3024 [Abstract] [Full Text]  
  • Commons, R., Rogers, S., Gooding, T., Danchin, M., Carapetis, J., Robins-Browne, R., Curtis, N. (2008). Superantigen genes in group A streptococcal isolates and their relationship with emm types. J Med Microbiol 57: 1238-1246 [Abstract] [Full Text]  
  • Tanaka, D., Isobe, J., Watahiki, M., Nagai, Y., Katsukawa, C., Kawahara, R., Endoh, M., Okuno, R., Kumagai, N., Matsumoto, M., Morikawa, Y., Ikebe, T., Watanabe, H., and the Working Group for Group A Streptococci in, (2008). Genetic Features of Clinical Isolates of Streptococcus dysgalactiae subsp. equisimilis Possessing Lancefield's Group A Antigen. J. Clin. Microbiol. 46: 1526-1529 [Abstract] [Full Text]  
  • Menon, T., Lloyd, C., Malathy, B., Sakota, V., Jackson, D., Beall, B. (2008). emm type diversity of {beta}-haemolytic streptococci recovered in Chennai, India. J Med Microbiol 57: 540-542 [Full Text]  
  • Linge, H. M., Sastalla, I., Nitsche-Schmitz, D. P., Egesten, A., Frick, I.-M. (2007). Protein FOG is a moderate inducer of MIG/CXCL9, and group G streptococci are more tolerant than group A streptococci to this chemokine's antibacterial effect. Microbiology 153: 3800-3808 [Abstract] [Full Text]  
  • Zhao, J., Hayashi, T., Saarinen, S., Papageorgiou, A. C., Kato, H., Imanishi, K., Kirikae, T., Abe, R., Uchiyama, T., Miyoshi-Akiyama, T. (2007). Cloning, Expression, and Characterization of the Superantigen Streptococcal Pyrogenic Exotoxin G from Streptococcus dysgalactiae. Infect. Immun. 75: 1721-1729 [Abstract] [Full Text]  
  • Horii, T., Izumida, S., Takeuchi, K., Tada, T., Ishikawa, J., Tsuboi, K. (2006). Acute peritonitis and salpingitis associated with streptococcal toxic shock syndrome caused by Lancefield group G {alpha}-haemolytic Streptococcus dysgalactiae subsp. equisimilis.. J Med Microbiol 55: 953-956 [Abstract] [Full Text]  
  • Liu, L.-C., Tsai, J.-C., Hsueh, P.-R., Teng, L.-J. (2006). Rapid Differentiation between Members of the Anginosus Group and Streptococcus dysgalactiae subsp. equisimilis within Beta-Hemolytic Group C and G Streptococci by PCR.. J. Clin. Microbiol. 44: 1836-1838 [Abstract] [Full Text]  
  • Kimoto, H., Fujii, Y., Hirano, S., Yokota, Y., Taketo, A. (2006). Genetic and Biochemical Properties of Streptococcal NAD-glycohydrolase Inhibitor. J. Biol. Chem. 281: 9181-9189 [Abstract] [Full Text]  
  • Pinho, M. D., Melo-Cristino, J., Ramirez, M., the Portuguese Group for the Study of Streptococca, (2006). Clonal Relationships between Invasive and Noninvasive Lancefield Group C and G Streptococci and emm-Specific Differences in Invasiveness.. J. Clin. Microbiol. 44: 841-846 [Abstract] [Full Text]  
  • Tanaka, M., Hasegawa, T., Okamoto, A., Torii, K., Ohta, M. (2005). Effect of Antibiotics on Group A Streptococcus Exoprotein Production Analyzed by Two-Dimensional Gel Electrophoresis. Antimicrob. Agents Chemother. 49: 88-96 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hashikawa, S.
Right arrow Articles by Ohta, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hashikawa, S.
Right arrow Articles by Ohta, M.