This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McEllistrem, M. C.
Right arrow Articles by Harrison, L. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McEllistrem, M. C.
Right arrow Articles by Harrison, L. H.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, January 2004, p. 250-256, Vol. 42, No. 1
0095-1137/04/$08.00+0     DOI: 10.1128/JCM.42.1.250-256.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Serotype 14 Variants of the France 9V-3 Clone from Baltimore, Maryland, Can Be Differentiated by the cpsB Gene

M. Catherine McEllistrem,1* Anna C. Noller,1,2 Shyam Visweswaran,3,4 Jennifer M. Adams,1 and Lee H. Harrison1,5

Infectious Diseases Epidemiology Research Unit, Division of Infectious Diseases, School of Medicine,1 Center for Biomedical Informatics,3 Intelligent Systems Program,4 Department of Infectious Diseases and Microbiology, Graduate School of Public Health, University of Pittsburgh, Pittsburgh, Pennsylvania,2 Department of International Health, Bloomberg School of Hygiene and Public Health, Johns Hopkins University, Baltimore, Maryland5

Received 6 April 2003/ Returned for modification 19 July 2003/ Accepted 22 September 2003


arrow
ABSTRACT
 
European serotype 14 variants of the France 9V-3 clone, which have arisen through recombination events involving the penicillin binding protein 1a (pbp1a) gene, have cpsB sequences distinct from those of the 9V-3 clone. Serotype 14 variants of the 9V-3 clone have not been compared to genetically diverse serotype 14 strains isolated from an entire metropolitan area in the United States. All serotype 14 non-penicillin-susceptible Streptococcus pneumoniae strains causing invasive disease in Baltimore, Md., from 1995 to 1996 were compared by using pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), pbp1a PCR restriction profiles, and cpsB and pbp1a sequences. The cpsB genes from strains of 13 serotypes also were analyzed to assess the correlation with serotype. Twenty-seven percent (3 of 11) of the serotype 14 strains were related by PFGE and MLST to the 9V-3 clone. The serotype 14 variants from Baltimore, unlike the European variants, were related neither to the 9V-3 clone nor to the R6 strain from positions 1498 to 1710 of the pbp1a gene. All serotype 14 strains had cpsB sequences that differed by <=1% (0 to 5 of 476 bp) from each other and that were >=16% (78 to 83 of 476 bp) divergent from that of the 9V-3 clone. Allowing for a 2-bp difference in the cpsB sequence resulted in the highest correlation between the cpsB gene and serotype. Overall, 95% (84 of 88) of the strains were classified correctly by serotype with the cpsB sequence. The distal recombination site of the Baltimore serotype 14 variants of the 9V-3 clone was not identical to that of the European serotype 14 variants. The cpsB gene was serotype specific regardless of whether capsular switching occurred. Although the correlation between serotype and the cpsB sequence was high, the overall diversity of the cpsB gene within a serotype likely will limit the role of this gene in a sequence-based serotyping method.


arrow
INTRODUCTION
 
Pneumococci are naturally transformable, with recombination rates 10-fold higher than mutation rates (5). Griffith et al. (8a) first described pneumococcal transformation in 1928, while Avery et al. determined that the transforming factor was DNA (1). Strains which are found to be highly related by pulsed-field gel electrophoresis (PFGE) and multilocus sequencing typing (MLST) may have different serotypes, indicating serotype capsular recombination (2, 3, 18, 24). The capsular locus is comprised of a series of alphabetically named capsular genes, which are flanked by the conserved genes dexB and aliA; approximately 5.8 kb downstream from aliA is the penicillin binding protein 1a (pbp1a) gene (2). Since a capsular locus has been identified for a variety of serotypes, the capsular genes are attractive targets for a sequence-based serotyping method. An association between some capsular gene sequences and serotype has been noted in the literature, even for strains which have undergone capsular transformation (2, 3).

The France 9V-3 pneumococcal clone is 1 of approximately 20 international clones and has been detected as serotype 14, serotype 9A, and serogroup 19 variants (18). These international clones account for a significant proportion of non-penicillin-susceptible Streptococcus pneumoniae (PNSP) strains in the United States (26). The proximal recombination site for the serotype 14 variants of the 9V-3 clone from Uruguay, Denmark, and Spain, but not Poland, was detected within the cpsA gene (2). The distal site of recombination occurred within the pbp1a gene, which has an orientation divergent from that of the capsular genes. The serotype 14 variants had a pbp1a sequence that was a combination of that of the non-penicillin-susceptible 9V-3 clone and that of the nonencapsulated penicillin-susceptible reference strain R6. The pbp1a gene sequence of the variants was identical to that of the 9V-3 clone until position 1854 or 1922. Thereafter, the gene sequence diverged from that of clone 9V-3 but was identical to that of strain R6.

Among all of the available non-penicillin-susceptible pneumococcal strains collected over a 2-year period from the Baltimore, Md., metropolitan area, 7.7% (11 of 143) were serotype 14 strains; 27.2% (3 of 11) of the serotype 14 strains were highly genetically related to the France 9V-3 clone rather than to the other serotype 14 strains (17). In this study, we characterized all serotype 14 PNSP strains and compared them to the France 9V-3 clone and to a genetically related serotype 9V strain by using PFGE, MLST, and phylogenetic trees of the concatenated housekeeping gene sequences. We also compared the PCR pbp1a restriction profiles and sequenced internal fragments of the pbp1a and cpsB genes from all serotype 14 strains to determine whether serotype 14 variants of the 9V-3 clone detected in Baltimore were similar to the European variants. Finally, we compared the internal fragments of the cpsB genes from all serotype 9V and 14 strains from Baltimore, 15 pneumococcal clones, and 23 strains from GenBank to assess the correlation between serotype and the cpsB sequence.


arrow
MATERIALS AND METHODS
 
Strains. Eleven serotype 14 strains and 39 serotype 9V strains from a previous study were included (17). In addition, the cpsB genes from 15 international pneumococcal clones (18) and 23 strains listed in GenBank (3, 9, 11-15, 19, 20, 22, 23, 25, 29) were analyzed (Table 1).


View this table:
[in this window]
[in a new window]
  		TABLE 1. cpsB sequences of 88 strains of selected serotypes

PFGE and susceptibility patterns. PFGE initially classified the 11 serotype 14 strains into five clonal groups (17). PFGE-based clonal groups had six or fewer band differences from each other and >=80% relatedness on the dendrogram. Due to an error that occurred while making plugs for PFGE, strain VIII was represented twice, while strain XII was not included. The correction of this error creates six, not five, clonal groups (16, 17). The MIC for penicillin-intermediate strains is 0.12 to 1 µg/ml, while that for penicillin-resistant strains is >=2 µg/ml.

PCR. Pneumococcal strains were incubated overnight on Trypticase soy agar containing 5% sheep blood. Genomic DNA was isolated by using Prepman Ultra in accordance with the manufacturer's instructions (Applied Biosystems, Foster City, Calif.). PCR primers for restriction profiles were pbp1a F (GGCATTCGATTTGATTCGCTTCTATCAT) and pbp1a R (CTGAGAAGATGTCTTCTCAGGCTTTTG) (8). The 30-µl reaction mixture contained 1.5 mM MgCl2, 0.33 µM each primer, 25 µM each deoxyribonucleotide, 1.5 U of the thermostable DNA Taq polymerase mixture, 3 µl of 10x buffer (Invitrogen Corporation, Carlsbad, Calif.) and 20 ng of DNA template. PCR was performed with a model 9700 thermal cycler (Perkin-Elmer, Wellesley, Mass.). The samples were subjected to an initial denaturation at 95°C for 1 min, followed by 10 cycles of denaturation at 94°C for 15 s, annealing at 58°C for 30 s, and elongation at 72°C for 1 min 50 s. This procedure was followed by 20 cycles with the same parameters but with sequential 10-s increments in the elongation cycle. A 7-min extension at 72°C followed the final cycle (8). PCR products were purified with Multiscreen PCR plates (Millipore, Bedford, Mass.). Five microliters of purified PCR products were restricted with 3 U each of MseI and DdeI for 1 to 2 h at 37°C (24). The restriction digests were electrophoresed for 2.5 to 3.0 h at 125 to 150 V through 4% Nusieve 3:1 agarose gels and captured with GelDoc 2000 (Bio-Rad, Hercules, Calif.). Restriction patterns of bands between 300 to 10,000 bp were classified as patterns 1 to 4.

DNA sequencing. (i) MLST. MLST was performed as described at http://www.mlst.net with internal fragments of the following seven housekeeping genes (protein products are shown in parentheses): aroE (shikimate dehydrogenase), gdh (glucose-6-phosphate dehydrogenase), gki (glucose kinase), recP (transketolase), spi (signal peptidase I), xpt (xanthine phosphoribosyltransferase), and ddl (D-alanine-D-alanine ligase). The primer sets were elongated for all except gki as described previously (7). Identical sequence types (ST), single-locus variants (SLV), and double-locus variants were determined, and strains with >=5 of 7 alleles were denoted as a single complex.

(ii) Phylogenetic analysis. Phylogenetic analysis was performed on the nucleotide and amino acid sequences obtained by concatenating the seven genes in order of occurrence in a serotype 4 strain: spi, gki, gdh, aroE, recP, ddl, and xpt (28). The 3,199 nucleotides were translated to 1,064 amino acids with Sequencher. The sequences were edited with Sequencher and aligned with ClustalX. Neighbor-joining (NJ), maximum-likelihood (ML), and maximum-parsimony (MP) trees were created with Paup 4.0, version beta10 (Sinauer Associates, Sunderland, Mass) (10, 27). Five thousand bootstrap replicates were done to assess the statistical significance of the phylogenetic tree generated by the NJ algorithm. Analysis based upon a related ST (BURST analysis) was performed with the START program (http://outbreak.ceid.ox.ac.uk/software.shtml) to determine the MLST lineages.

(iii) pbp1a and cpsB. A 485-bp fragment from positions 1498 to 1982 of the pbp1a gene was sequenced with the following primers: pbp1a (F), 5'-GCAAGTAGTGAAAARATGGCTGCTGC, and pbp1a (R), 5'-GACTGTGAAGTTGAACTWTCTGATG-3'. A 476-bp fragment from positions 72 to 547 of the cpsB gene was analyzed with published primers (3). The cpsB and pbp1a genes were amplified from the genomic DNA with the following PCR parameters: initial denaturation at 94°C for 4 min, followed by 35 cycles of denaturation at 94°C for 45 s, annealing at 50°C for 30 s, and elongation at 72°C for 1 min. A 7-min extension at 72°C followed the final cycle. PCR products were sequenced with a Big Dye terminator cycle sequencing ready reaction kit (Applied Biosystems) and run on a model 3700 DNA sequencer (Applied Biosystems). Both the forward and the reverse strands were sequenced. Raw sequences were aligned with Sequencher and ClustalX. The cpsB genes from 23 strains representing 13 serotypes, obtained from GenBank, also were analyzed. For the serotype 37 strain, a base-pair insertion was present at position 212; thus, a 477-bp fragment was analyzed.


arrow
RESULTS
 
Serotype 14 strains were classified into six clonal groups, five ST complexes or lineages, and eight ST (Fig. 1 and Table 2). The pbp1a restriction profiles correlated with the pbp1a DNA sequences and classified strains into four groups (Table 2). Three serotype 14 variants (strains I to III) and the 9V-3 clone were in PFGE-based clonal group A (Fig. 1). The serotype 14 variants were isolated over an 8-month period from two children and one adult who lived in three different counties within the Baltimore metropolitan area. The 9V-3 clone, strain I, and strain II were ST 156, while strain III was an SLV of ST 156. Strain III had a ddl allele which differed from that of the 9V-3 clone by 32 bp and was penicillin intermediate rather than resistant. The serotype 14 variants had identical pbp1a restriction profiles and pbp1a DNA sequences. However, unlike the European serotype 14 variants, strains I to III were related neither to the 9V-3 clone nor to strain R6 from positions 1498 to 1710 (Fig. 2). From positions 1711 to 1871, the serotype 14 variants were identical to the 9V-3 clone; thereafter, they were identical to strain R6. In contrast, strains that were found to be 60 to 70% related by PFGE and for which six of seven alleles were found by MLST to be different from those of the serotype 14 variants had pbp1a sequences which were highly related to that of either the 9V-3 clone or strain R6. Strain XII had a pbp1a restriction profile and a DNA sequence identical to those of the 9V-3 clone, and strains VII to XI had a pbp1a DNA sequence identical to that of the R6 strain except for four single-nucleotide polymorphisms at positions 1572, 1619, 1872, and 1970.



View larger version (48K):
[in this window]
[in a new window]
  		FIG. 1. PFGE and MLST for serotype 9V and 14 strains and the 9V-3 clone.


View this table:
[in this window]
[in a new window]
  		TABLE 2. PFGE-based clonal groups, MLST alleles, Pbp1a profiles, and penicillin susceptibility patterns for serotype 14 and 9V strains and the 9V-3 clone



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 2. Polymorphic sites within the pbp1a genes of strains R6, VII to IX, I to III, and XII and the 9V-3 clone. Identical sites are represented by dots. The polymorphic sites are numbered in vertical format. From positions 1498 to 1710, the serotype 14 variants had 37-bp differences from the 9V-3 clone and 45-bp differences from strain R6. From positions 1711 to 1874, the serotype 14 variants were identical to the 9V-3 clone and had 41-bp differences from strain R6. From positions 1875 to 1982, the serotype 14 variants had 33-bp differences from the 9V-3 clone and were identical to strain R6. Strain XII was identical to the 9V-3 clone. Strains VII to IX were nearly identical to strain R6.

The other serotype 14 strains were <80% related to the 9V-3 clone and were classified into PFGE-based clonal groups B to F. These strains belonged to either ST 67, ST 81, ST 672, or ST 124, while strain R6 was ST 128. Our data generated three new alleles (spi66, ddl104, xpt110) and four new ST (ST 930, ST 78, ST 679, and ST 689) for the MLST website.

The NJ, ML, and MP trees of the concatenated MLST gene sequences produced clusters similar to those produced by BURST analysis. The ML and NJ methods each produced one tree, while the MP method produced two trees, both with the same structure but slightly different branch lengths. NJ tree bootstrapping with 5,000 replications revealed that strains I to III clustered with the 9V-3 clone 65% of the time. The remainder of the time, strain III clustered with either strain VII (18%) or both strain VII and the 9V-3 clone (17%). When amino acid sequences were used to create an NJ tree with 5,000 bootstrapping replications, strain III always clustered with the 9V-3 clone.

All 41 serotype 9V strains had identical cpsB gene sequences. The cpsB sequences of all of the serotype 14 strains, including the Maryland strains, GenBank strains, and international clones, differed by <=5 bp. All serotype 14 strains were >=16% (78 to 83 of 476 bp) divergent from the 9V-3 clone. The serotype 14 variants could be differentiated from the 9V-3 clone with the cpsB and the pbp1a genes but not by PFGE or MLST.

A bootstrapped NJ tree of the 15 international clones and the 23 strains from GenBank further demonstrated a correlation between serotype and the cpsB sequence. Moreover, the tree graphically displayed the most common sequence for each serotype (Fig. 3). The sensitivity and specificity of using the cpsB sequence as a surrogate for serotype designation were determined. For each serotype, the most common cpsB sequence was chosen as the reference sequence. For example, the identical cpsB sequence among serotype 6B strains occurred in 75% (three of four) of the strains. The sensitivity was defined as the ability of this cpsB sequence to correctly classify 6B strains as belonging to serotype 6B. The specificity was defined as the ability of this cpsB sequence to correctly classify strains from other serotypes as not belonging to serotype 6B. Among serotypes represented by multiple strains, allowing for a <=2-bp difference in the cpsB gene resulted in the highest specificity, and allowing for a >2-bp difference resulted in the highest sensitivity overall. The cpsB sequence had a sensitivity of 75 to 100% and a specificity of 94 to 100% for the following serotypes: 6B, 8, 9V, 14, 19A, 19F, and 23F (Table 3). Overall, 95% (84 of 88) of the strains were classified correctly by serotype with the cpsB sequence.



View larger version (24K):
[in this window]
[in a new window]
  		FIG. 3. NJ tree of 15 international clones and 23 GenBank strains. Strains which clustered >=50% of the time with bootstrapping are indicated.


View this table:
[in this window]
[in a new window]
  		TABLE 3. Sensitivity and specificity for cpsB sequences at various thresholds of base-pair differences


arrow
DISCUSSION
 
We found that serotype 14 variants of the 9V-3 clone accounted for a substantial proportion of PNSP serotype 14 strains in Baltimore, Md., over a 2-year period. To our knowledge, we are the first to include all PNSP serotype 14 strains from a defined population base. Overall, we found a high correlation between PFGE and MLST. The one exception was strain XI, which was classified as a unique PFGE-based clonal group but belonged to the same MLST lineage and ST complex as three other strains.

Unlike the European strains, all three serotype 14 variants of the 9V-3 clone had a unique pbp1a restriction profile and pbp1a DNA sequence from positions 1498 to 1710 compared to all other serotype 14 strains, strain R6, and the 9V-3 clone. Thereafter, the Baltimore variants were related to the 9V-3 clone and then to strain R6. Although the exact crossover point between 9V-3 and R6 was different from that in the European variants, the pattern was conserved. These data suggest two possibilities. Perhaps additional recombination events in the pbp1a gene occurred after capsular transformation with the 9V-3 clone, causing increased diversity in our strains compared to the European strains. Second, perhaps our variants arose through a recombination event different from that of the European strains. Previous studies demonstrated that variants have arisen on multiple occasions through unique recombination events (2, 3).

The variability that we noted within the pbp1a gene simply may reflect the mosaic patterns associated with the penicillin binding proteins. For example, some of the genetically unrelated serotype 14 strains had pbp1a sequences which were identical to or nearly identical to those of the 9V-3 clone or strain R6, respectively. Compared to the Spanish 23F-1 clone, strain XII has the same ST and a highly related PFGE pattern. The 23F-1 clone has the same pbp1a DNA sequence as the 9V-3 clone (21). Therefore, it is not unexpected that strain XII has the same pbp1a sequence as the 9V-3 clone. Strain R6 was not related to any of our serotype 14 strains by MLST but had a pbp1a sequence highly related to those of five strains. A search of the pbp1a sequences of the serotype 14 variants in GenBank demonstrated that this sequence was 99% related to that of a previously described 23F penicillin-resistant strain (6).

An inherent limitation of all studies focusing on recombination is the uncertainty of the original donor and recipient strains. An earlier study assumed that the pbp1a sequence of the original donor was identical to that of strain R6 and that the original recipient had a sequence identical to that of the 9V-3 clone (2). In contrast, we used all serotype 14 PNSP strains from a population base over a 2-year period and the 9V-3 clone as the donors and the recipient, respectively. Perhaps another suitable comparison group would be serotype 14 penicillin-susceptible strains, since the pbp1a gene may have undergone further recombination events after the capsular recombination event.

MLST assigns equal weights to one nucleotide difference and multiple nucleotide differences within the same locus, thereby minimizing differences within a single locus. However, since recombination events are typically several kilobases in size, this approach appears to be an accurate means for assessing the genetic relatedness of strains (4). In our study, the concatenated gene sequence analysis provided results different from those provided by MLST in only one instance. Strain III, found to be an SLV of the 9V-3 clone by MLST, had 32 base-pair differences within the ddl gene. While the ML and MP trees clustered strains I to III with the 9V-3 clone, the bootstrapped NJ tree of the DNA sequence revealed that these strains clustered together only 65% of the time. On the surface, these data suggest that strain III may not be a serotype 14 variant of the 9V-3 clone. However, evidence clearly indicates that the variation seen within the ddl gene can be due to a hitchhiking phenomenon related to a single recombination event associated with the penicillin binding protein 2b gene (4). Our data support this theory, since strain III is the only penicillin-intermediate serotype 14 variant. In contrast, strains I and II and the 9V-3 clone are penicillin resistant.

We found that nearly a third of the serotype 14 PNSP strains collected over a 2-year period from the Baltimore metropolitan area were variants of the 9V-3 clone that differed from the European variants. Since they were detected over an 8-month period from persons residing in three different counties, it appears that this clone is widespread within the Baltimore metropolitan area. As shown previously, MLST and PFGE had a high degree of correlation and concurred with the concatenated gene sequence the majority of the time. The recombination history for the serotype 14 variants from Baltimore was different from that for the European variants.

As noted previously (2), the cpsB genes of all serotype 14 strains were highly related but markedly different from that of the 9V-3 clone, even among strains that had undergone capsular transformation. Allowing for a 2-bp difference, the cpsB sequence usually correlated with the serotype designation among this small sample of strains. The key limitation of this study was the choice of the reference sequence for each serotype; the reference sequence for each serotype was the most common sequence. Since the compositions of strains in other databases may differ markedly, the validity of the cpsB sequence as a surrogate for serotype could decrease dramatically. Thus, although the cpsB sequence was correlated with the serotype among this small sample of strains, the role of this gene as part of a sequence-based serotyping method may be limited.


arrow
ACKNOWLEDGMENTS
 
We thank the participating hospital infection control practitioners and microbiology laboratory personnel in the Baltimore metropolitan area for identifying the pneumococcal cases and providing the bacterial isolates; Yvonne Dean Hibbert and Jackie Hunter for assistance in conducting surveillance; Kim Holmes for assistance with data collection; and Althea Glenn, Laboratories Administration, Maryland Department of Health and Mental Hygiene, for processing the isolates. We thank Jim Jorgensen and his staff, University of Texas Health Sciences Center, for performing susceptibility testing and Richard R. Facklam, Centers for Disease Control and Prevention, for performing serotyping. We gratefully acknowledge Bernard Beall for thoughtful review of the manuscript.

This work was supported in part by the State of Maryland, the Centers for Disease Control and Prevention, and career development awards from the National Institutes of Health to M. C. McEllistrem (K23 AI01788-03) and to L. H. Harrison (K24 AI52788).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Infectious Diseases Epidemiology Research Unit, Division of Infectious Diseases, School of Medicine, University of Pittsburgh, 3601 Fifth Ave., Falk Medical Building, Suite 3A, Pittsburgh, PA 15229. Phone: (412) 648-6301. Fax: (412) 648-6399. E-mail: mcellistremc{at}msx.dept-med.pitt.edu. Back


arrow
REFERENCES
 
    1
  1. Avery, O. T., C. M. MacLeod, and M. McCarty. 1979. Studies on the chemical nature of the substance inducing transformation of pneumococcal types. Inductions of transformation by a desoxyribonucleic acid fraction isolated from pneumococcus type III. J. Exp. Med. 149:297-326.[Free Full Text]
    2. 2
  2. Coffey, T. J., M. Daniels, M. C. Enright, and B. G. Spratt. 1999. Serotype 14 variants of the Spanish penicillin-resistant serotype 9V clone of Streptococcus pneumoniae arose by large recombinational replacements of the cpsA-pbp1a region. Microbiology 145:2023-2031.[Abstract/Free Full Text]
    3. 3
  3. Coffey, T. J., M. C. Enright, M. Daniels, J. K. Morona, R. Morona, W. Hryniewicz, J. C. Paton, and B. G. Spratt. 1998. Recombinational exchanges at the capsular polysaccharide biosynthetic locus lead to frequent serotype changes among natural isolates of Streptococcus pneumoniae. Mol. Microbiol. 27:73-83.[CrossRef][Medline]
    4. 4
  4. Enright, M. C., and B. G. Spratt. 1999. Extensive variation in the ddl gene of penicillin-resistant Streptococcus pneumoniae results from a hitchhiking effect driven by the penicillin-binding protein 2b gene. Mol. Biol. Evol. 16:1687-1695.[Abstract]
    5. 5
  5. Feil, E. J., J. M. Smith, M. C. Enright, and B. G. Spratt. 2000. Estimating recombinational parameters in Streptococcus pneumoniae from multilocus sequence typing data. Genetics 154:1439-1450.[Abstract/Free Full Text]
    6. 6
  6. Ferroni, A., and P. Berche. 2001. Alterations to penicillin-binding proteins 1A, 2B and 2X amongst penicillin-resistant clinical isolates of Streptococcus pneumoniae serotype 23F from the nasopharyngeal flora of children. J. Med. Microbiol. 50:828-832.[Abstract/Free Full Text]
    7. 7
  7. Gertz, R. E., Jr., M. C. McEllistrem, D. J. Boxrud, Z. Li, V. Sakota, T. A. Thompson, R. R. Facklam, J. M. Besser, L. H. Harrison, C. G. Whitney, and B. Beall. 2003. Clonal distribution of invasive pneumococcal isolates from children and selected adults in the United States prior to 7-valent conjugate vaccine introduction. J. Clin. Microbiol. 41:4194-4216.[Abstract/Free Full Text]
    8. 8
  8. Gherardi, G., C. G. Whitney, R. R. Facklam, and B. Beall. 2000. Major related sets of antibiotic-resistant pneumococci in the United States as determined by pulsed-field gel electrophoresis and pbp1a-pbp2b-pbp2x-dhf restriction profiles. J. Infect. Dis. 181:216-229.[CrossRef][Medline]
    9. 8
  9. Griffith, F. 1928. The significance of pneumococcal types. J. Hyg. 27:113-159.
    10. 9
  10. Guidolin, A., J. K. Morona, R. Morona, D. Hansman, and J. C. Paton. 1994. Nucleotide sequence analysis of genes essential for capsular polysaccharide biosynthesis in Streptococcus pneumoniae type 19F. Infect. Immun. 62:5384-5396.[Abstract/Free Full Text]
    11. 10
  11. Hasegawa, M., H. Kishino, and T. Yano. 1985. Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. J. Mol. Evol. 22:160-174.[CrossRef][Medline]
    12. 11
  12. Iannelli, F., B. J. Pearce, and G. Pozzi. 1999. The type 2 capsule locus of Streptococcus pneumoniae. J. Bacteriol. 181:2652-2654.[Abstract/Free Full Text]
    13. 12
  13. Jiang, S. M., L. Wang, and P. R. Reeves. 2001. Molecular characterization of Streptococcus pneumoniae type 4, 6B, 8, and 18C capsular polysaccharide gene clusters. Infect. Immun. 69:1244-1255.[Abstract/Free Full Text]
    14. 13
  14. Kolkman, M. A., D. A. Morrison, B. A. Van Der Zeijst, and P. J. Nuijten. 1996. The capsule polysaccharide synthesis locus of Streptococcus pneumoniae serotype 14: identification of the glycosyl transferase gene cps14E. J. Bacteriol. 178:3736-3741.[Abstract/Free Full Text]
    15. 14
  15. Llull, D., R. Lopez, E. Garcia, and R. Munoz. 1998. Molecular structure of the gene cluster responsible for the synthesis of the polysaccharide capsule of Streptococcus pneumoniae type 33F. Biochim. Biophys. Acta 1443:217-224.[Medline]
    16. 15
  16. Llull, D., R. Munoz, R. Lopez, and E. Garcia. 1999. A single gene (tts) located outside the cap locus directs the formation of Streptococcus pneumoniae type 37 capsular polysaccharide. Type 37 pneumococci are natural, genetically binary strains. J. Exp. Med. 190:241-251.[Abstract/Free Full Text]
    17. 16
  17. McEllistrem, M. C., A. B. Mendelsohn, M. Pass, J. A. Elliott, C. G. Whitney, B. A. Albanese, and L. H. Harrison. 2002. The distribution of penicillin nonsusceptible pneumococcal clones in Baltimore by risk factors associated with drug resistance. Clin. Infect. Dis. 185:1364-1368.
    18. 17
  18. McEllistrem, M. C., M. Pass, J. A. Elliott, C. G. Whitney, and L. H. Harrison. 2000. Clonal groups of penicillin-nonsusceptible Streptococcus pneumoniae in Baltimore, Maryland: a population-based, molecular epidemiologic study. J. Clin. Microbiol. 38:4367-4372.[Abstract/Free Full Text]
    19. 18
  19. McGee, L., L. McDougal, J. Zhou, B. G. Spratt, F. C. Tenover, R. George, R. Hakenbeck, W. Hryniewicz, J. C. Lefevre, A. Tomasz, and K. P. Klugman. 2001. Nomenclature of major antimicrobial-resistant clones of Streptococcus pneumoniae defined by the pneumococcal molecular epidemiology network. J. Clin. Microbiol. 39:2565-2571.[Abstract/Free Full Text]
    20. 19
  20. Morona, J. K., R. Morona, and J. C. Paton. 1997. Characterization of the locus encoding the Streptococcus pneumoniae type 19F capsular polysaccharide biosynthetic pathway. Mol. Microbiol. 23:751-763.[CrossRef][Medline]
    21. 20
  21. Morona, J. K., R. Morona, and J. C. Paton. 1999. Comparative genetics of capsular polysaccharide biosynthesis in Streptococcus pneumoniae types belonging to serogroup 19. J. Bacteriol. 181:5355-5364.[Abstract/Free Full Text]
    22. 21
  22. Munoz, R., T. J. Coffey, M. Daniels, C. G. Dowson, G. Laible, J. Casal, R. Hakenbeck, M. Jacobs, J. M. Musser, and B. G. Spratt. 1991. Intercontinental spread of a multiresistant clone of serotype 23F Streptococcus pneumoniae. J. Infect. Dis. 164:302-306.[Medline]
    23. 22
  23. Munoz, R., M. Mollerach, R. Lopez, and E. Garcia. 1997. Molecular organization of the genes required for the synthesis of type 1 capsular polysaccharide of Streptococcus pneumoniae: formation of binary encapsulated pneumococci and identification of cryptic dTDP-rhamnose biosynthesis genes. Mol. Microbiol. 25:79-92.[CrossRef][Medline]
    24. 23
  24. Munoz, R., M. Mollerach, R. Lopez, and E. Garcia. 1999. Characterization of the type 8 capsular gene cluster of Streptococcus pneumoniae. J. Bacteriol. 181:6214-6219.[Abstract/Free Full Text]
    25. 24
  25. Nesin, M., M. Ramirez, and A. Tomasz. 1998. Capsular transformation of a multidrug-resistant Streptococcus pneumoniae in vivo. J. Infect. Dis. 177:707-713.[Medline]
    26. 25
  26. Ramirez, M., and A. Tomasz. 1998. Molecular characterization of the complete 23F capsular polysaccharide locus of Streptococcus pneumoniae. J. Bacteriol. 180:5273-5278.[Abstract/Free Full Text]
    27. 26
  27. Richter, S. S., K. P. Heilmann, S. L. Coffman, H. K. Huynh, A. B. Brueggemann, M. A. Pfaller, and G. V. Doern. 2002. The molecular epidemiology of penicillin-resistant Streptococcus pneumoniae in the United States, 1994-2000. Clin. Infect. Dis. 34:330-339.[CrossRef][Medline]
    28. 27
  28. Swofford, D. L., G. J. Olsen, P. J. Waddell, and D. M. Hillis. 1996. Phylogenetic inference, p. 407-514. In D. M. Hillis, C. Moritz, and B. K. Mable (ed.), Molecular systematics, 2nd ed. Sinauer Associates, Sunderland, Mass.
    29. 28
  29. Tettelin, H., K. E. Nelson, I. T. Paulsen, J. A. Eisen, T. D. Read, S. Peterson, J. Heidelberg, R. T. DeBoy, D. H. Haft, R. J. Dodson, A. S. Durkin, M. Gwinn, J. F. Kolonay, W. C. Nelson, J. D. Peterson, L. A. Umayam, O. White, S. L. Salzberg, M. R. Lewis, D. Radune, E. Holtzapple, H. Khouri, A. M. Wolf, T. R. Utterback, C. L. Hansen, L. A. McDonald, T. V. Feldblyum, S. Angiuoli, T. Dickinson, E. K. Hickey, I. E. Holt, B. J. Loftus, F. Yang, H. O. Smith, J. C. Venter, B. A. Dougherty, D. A. Morrison, S. K. Hollingshead, and C. M. Fraser. 2001. Complete genome sequence of a virulent isolate of Streptococcus pneumoniae. Science 293:498-506.[Abstract/Free Full Text]
    30. 29
  30. van Selm, S., M. A. Kolkman, B. A. van der Zeijst, K. A. Zwaagstra, W. Gaastra, and J. P. van Putten. 2002. Organization and characterization of the capsule biosynthesis locus of Streptococcus pneumoniae serotype 9V. Microbiology 148:1747-1755.[Abstract/Free Full Text]

Journal of Clinical Microbiology, January 2004, p. 250-256, Vol. 42, No. 1
0095-1137/04/$08.00+0     DOI: 10.1128/JCM.42.1.250-256.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Albarracin Orio, A. G., Cortes, P. R., Tregnaghi, M., Pinas, G. E., Argentinean Network Pneumococcus Study Group, , Echenique, J. R. (2008). A new serotype 14 variant of the pneumococcal Spain9V-3 international clone detected in the central region of Argentina. J Med Microbiol 57: 992-999 [Abstract] [Full Text]  
  • Kong, F., Wang, W., Tao, J., Wang, L., Wang, Q., Sabananthan, A., Gilbert, G. L (2005). A molecular-capsular-type prediction system for 90 Streptococcus pneumoniae serotypes using partial cpsA-cpsB sequencing and wzy- or wzx-specific PCR. J Med Microbiol 54: 351-356 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McEllistrem, M. C.
Right arrow Articles by Harrison, L. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McEllistrem, M. C.
Right arrow Articles by Harrison, L. H.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»