Previous Article | Next Article 
Journal of Clinical Microbiology, March 2004, p. 1099-1108, Vol. 42, No. 3
0095-1137/04/$08.00+0 DOI: 10.1128/JCM.42.3.1099-1108.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Characterization of Shiga Toxin-Producing Escherichia coli Strains Isolated from Human Patients in Germany over a 3-Year Period
Lothar Beutin,* Gladys Krause, Sonja Zimmermann, Stefan Kaulfuss, and Kerstin Gleier
Division of Microbial Toxins, Department of Biological Safety, Robert Koch Institute, D-13353 Berlin, Germany
Received 22 September 2003/
Returned for modification 12 November 2003/
Accepted 15 November 2003

ABSTRACT
We have investigated 677 Shiga toxin-producing
Escherichia coli (STEC) strains from humans to determine their serotypes, virulence
genes, and clinical signs in patients. Six different Shiga toxin
types (1, 1c, 2, 2c, 2d, and 2e) were distributed in the STEC
strains. Intimin (
eae) genes were present in 62.6% of the strains
and subtyped into intimins

1, ß1,

1,

,

, and

. Shiga
toxin types 1c and 2d were present only in
eae-negative STEC
strains, and type 2 was significantly (
P < 0.001) more frequent
in
eae-positive STEC strains. Enterohemorrhagic
E. coli hemolysin
was associated with 96.2% of the
eae-positive strains and with
65.2% of the
eae-negative strains. Clinical signs in the patients
were abdominal pain (8.7%), nonbloody diarrhea (59.2%), bloody
diarrhea (14.3%), and hemolytic-uremic syndrome (HUS) (3.5%),
and 14.3% of the patients had no signs of gastrointestinal disease
or HUS. Infections with
eae-positive STEC were significantly
(
P < 0.001) more frequent in children under 6 years of age
than in other age groups, whereas
eae-negative STEC infections
dominated in adults. The STEC strains were grouped into 74 O:H
types by serotyping and by PCR typing of the flagellar (
fliC)
genes in 221 nonmotile STEC strains. Eleven serotypes (O157:[H7],
O26:[H11], O103:H2, O91:[H14], O111:[H8], O145:[H28], O128:H2,
O113:[H4], O146:H21, O118:H16, and O76:[H19]) accounted for
69% of all STEC strains. We identified 41 STEC strains belonging
to 31 serotypes which had not previously been described as human
STEC. Twenty-six of these were positive for intimins

1 (one
serotype), ß1 (eight serotypes),

(two serotypes),
and

(three serotypes). Our study indicates that different types
of STEC strains predominate in infant and adult patients and
that new types of STEC strains are present among human isolates.

INTRODUCTION
The association of Shiga (Vero) toxin production in
Escherichia coli with human pathogenicity was first described in 1979 (
82,
85). However, it was the investigation of an outbreak caused
by Shiga toxin-producing
E. coli (STEC) O157 which provided
the major impetus to study these pathogens (
65). In the following
years, STEC strains were increasingly isolated from humans with
diarrhea and hemolytic-uremic syndrome (HUS) and from farm animals,
which serve as a natural reservoir for STEC (
52,
86). Today,
more than 200 different
E. coli O:H serotypes are known to be
associated with the production of Shiga toxins (
86; K. A. Bettelheim's
VTEC table, May 2003 update,
www.sciencenet.com.au/vtectable.htm).
Certain STEC strains belonging to serogroups O26, O103, O111,
O145, and O157 were more frequently isolated from humans with
severe diseases such as hemorrhagic colitis and HUS. Accordingly,
these highly virulent STEC strains were also designated as enterohemorrhagic
E. coli (EHEC) (
42,
52). The search for additional virulence
markers in these pathogens revealed that most EHEC strains carry
a plasmid which encodes a hemolysin (EHEC hemolysin) and the
chromosomally located locus of enterocyte effacement (LEE) pathogenicity
island (
16,
43,
70,
84). The genes carried by the LEE enable
the bacteria to produce attaching and effacing lesions in the
host intestinal mucosa cells, which increases the virulence
of the bacteria for humans (
35,
44,
60). Intimate attachment
of bacteria to the host cell is mediated by the binding of intimin,
the product of the
eae gene, to the translocated intimin receptor
(
80). Nucleotide sequencing of the LEEs from STEC O157 and enteropathogenic
E. coli (EPEC) strains revealed differences in the genes coding
for intimate attachment of bacteria to the enterocytes (
48,
59,
89), and more than 10 genetic variants of the
eae gene have
been identified in STEC and EPEC strains (
32,
34,
55,
77,
88).
Some intimin types, such as intimin

, were found to be associated
with EPEC, whereas others, such as intimins

,

, and

, were found
in STEC strains (
1,
55,
77,
88). The association between infections
with intimin-positive STEC and severe disease in humans was
demonstrated previously (
13), but it was also shown that intimin
is not essential for the virulence of certain STEC strains for
humans. Other colonization mechanisms, such as adhesins and
pili, were identified in
eae-negative strains (
58,
75), and
certain LEE-negative strains and serotypes of STEC were associated
with bloody diarrhea (BD) and HUS (
13,
14,
36). These STEC strains
might possess other virulence factors which have not yet been
characterized.
The virulence of STEC for humans may also be related to the Stx type which is produced by the bacteria. The presence of the stx2 gene in the infecting strain was previously reported to correlate with severe disease in humans (13), and the administration of purified Stx2, but not of Stx1, was shown to cause HUS in experimentally treated primates (74). A variety of genetic variants of stx1 and stx2 were detected by nucleotide sequence analysis of stx genes (27, 30, 56, 61, 73). Some of the stx1 and stx2 variants were found to be associated with STEC from sheep (stx1ox3/stx1c and stx2d-ount) (15, 39, 64, 79), pigs (stx2e) (83), or pigeons (stx2f) (72). Some genetic variants of stx1 (stx1ox3/stx1c) and stx2 (stx2e and stx2d-ount) are not present in classical EHEC strains but are frequently found in eae-negative STEC strains from patients with uncomplicated diarrhea or asymptomatic infections (23, 24, 25, 39, 61). Other variants, such as stx2e, were rarely or not (stx2f) associated with STEC from humans (24).
E. coli strains belonging to serotypes O157:[H7], O145:[H28], O111:[H8], O103:H2, and O26:[H11] are recognized classical EHEC types which occur in different countries worldwide (86; www.sciencenet.com.au/vtectable.htm). Diagnostic tools such as indicator media, O-antigen-agglutinating antisera, and magnetic beads coated with O-antigen-specific capture antibodies were developed for the enrichment and isolation of EHEC strains from fecal, environmental, and food samples. These tools proved to be useful for the detection of some but not all human-pathogenic STEC types (68). New emerging EHEC clones formed by O118:H16 and O121:H19 strains were recently described and were associated with BD and HUS (4, 31, 46, 76). These findings show that the list of human pathogenic STEC types is far from being completed, and further work has to be done to characterize human STEC strains for their serotypes, their virulence markers, and their associations with disease. This was the aim of our study, where we have investigated 677 STEC isolates which were collected between 1997 and 1999 from human patients in Germany.

MATERIALS AND METHODS
Human patients.
STEC strains from 677 human patients living in rural and urban
areas in different parts of Germany were isolated between 6
January 1997 and 27 December 1999. Only one STEC isolate per
patient was taken into the study. The patients' ages were known
in 632 (93.5%) cases and were between 5 days and 91 years. The
gender was known for 638 (94.2%) of the patients; 296 (46.4%)
were male and 342 (53.6%) were female.
Isolation of STEC.
STEC isolates or patients' stools were sent to our laboratory at the Robert Koch Institute for isolation and confirmation of STEC infections. The specimens were obtained from 13 hospitals, 19 public health institutes, and 31 private diagnostic laboratories situated in different parts of Germany. The isolation of STEC from stool and characterization of STEC isolates were performed as previously described (8, 10).
Serotype identification.
The E. coli strains were serotyped for their O (lipopolysaccharide) and H (flagellar) antigens as previously described (54).
E. coli strains representing the new O groups O176 to O181 were kindly provided by Flemming Scheutz (International Escherichia Centre, Statens Serum Institut, Copenhagen, Denmark) and were used for the production of O-antigen-specific antisera (54). The H types of motile STEC strains were analyzed by serotyping using antisera specific for 53 different H antigens (H1 to H56). Nonmotile (NM) STEC strains were investigated for their H-type-specific (fliC) genes by PCR followed by HhaI digestion of fliC PCR products and evaluation of restriction fragment length polymorphism (RFLP) patterns as previously described (7, 45). Reference strains for H types H1 to H56 with characteristic fliC RFLP patterns (54) were used as standard controls for H serotyping and fliC PCR.
Nomenclature of Shiga toxin types.
The nomenclature proposed by Scheutz et al. (67) was used for the designation of Shiga toxin types. This nomenclature presents an updated version of the two currently accepted kinds of nomenclature for Shiga toxins. Accordingly, the indicated stx genotypes (in parentheses) were attributed to the following Shiga toxin types: type 1 (stx1), type 1c (stx1-ox3/stx1c), type 2 (stx2), type 2c (stx2c, stx2d-ount, and stx2d-OX3a), type 2d (stx2vha and stx2vhb), and type 2e (stx2e and stx2ev). The toxin types were established with regard to antigenic variations, differences in toxicities, the capacity to be activated, differences in affinities and receptors, and significant differences in DNA and amino acid sequences (67). According to this nomenclature, toxins of Shiga toxin type 2c include the genetically closely related toxins stx2d-ount (61), stx2c, (73), and stx2-OX3a (57). Shiga toxin type 2d is reserved for mucus-activatable toxins (stx2vha and stx2vhb) (49), and toxins of type 2e include the porcine edema disease-associated toxins stx2e and stx2ev (81). The term Shiga toxin type 1c was introduced for the stx1c (stx1-ox3) toxins (15, 87).
Detection of Shiga toxins and subtyping of stx genes.
All E. coli isolates were investigated for cytotoxicity in the Vero cell assay, and Vero cell assay-positive strains were examined with the verocytotoxin-producing E. coli (VTEC)-reverse passive latex agglutination (RPLA) test for the detection of Stx1 (VT1) and Stx2 (VT2) (Denka-Seiken, Tokyo, Japan) (9). The E. coli reference strains used for the detection of stx1, stx2, and their genetic variants were previously described (8). Primers KS7 and KS8 were used for the amplification of all genetic variants of the stx1 gene family (39, 87). Subtyping of the stx1ox3 (stx1c) gene variant was performed with primers Lin-up and 1ox3, which yield an stx1ox3 gene-specific product of 555 bp (39).
Primers LP43 and LP44 were used for the amplification of all members of the stx2 gene family (18). The subtyping of stx2 genes was performed by endonuclease digestion of a 900-bp DNA product, which is obtained by PCR with primers Lin-up and Lin-down, which amplify all variants of the stx family (2, 8). Further identification of genetic variants of stx2 was performed by PCR and by analysis of the restriction patterns after enzymatic digestion of PCR products as previously described (61). By this process, the following variants of the stx2 gene could be identified: stx2, stx2c, stx2vha, stx2vhb, stx2d-ount, stx2d-OX3a, stx2e, and stx2ev (2, 61).
Dot blot DNA hybridization.
The presence of virulence genes in the STEC isolates was analyzed by dot blot DNA hybridization at high stringency as previously described (7). Gene probes were labeled with digoxigenin-11-dUTP (Roche Diagnostics, Mannheim, Germany).
Detection and subtyping of eae (intimin) genes.
eae genes were detected by dot blot DNA hybridization. The 881-bp eae-specific DNA probe was derived from the STEC O157 strain E32511 (84) by using the universal eae primers SK1 (5' CCCGAATTCGGCACAAGCATAAGC 3') and SK2 (5' CCCGGATCCGTCTCGCCAGTATTCG 3') (55). The subtyping of eae genes into intimins
, ß,
, and
was performed by PCR with primer SK1 in combination with primers LP2 to LP5. Further subtyping of intimin genes was done by RFLP analysis of PstI-digested PCR products as previously described (55). PCRs for the detection of new intimin variants
,
,
,
, and
were performed as recently described (88). The reference strains used for the identification of different intimin variants are listed elsewhere (88).
Hemolytic phenotypes and detection of EHEC hemolysin (EHEC hlyA) sequences.
All STEC strains were grown on enterohemolysin agar (Oxoid, Wesel, Germany), which contains washed sheep blood (9). The plates were incubated at 37°C and were examined for hemolysis after 3 h of incubation (indicating alpha-hemolysin) and after overnight incubation (indicating EHEC hemolysin) (9). The reference strains for the different E. coli hemolysins were used as previously described (70). Primers EHA1 and EHA2 were used for the detection of the EHEC hlyA gene and for preparation of the 1,551-bp EHEC hlyA-specific gene probe (69). STEC strains showing an alpha-hemolytic phenotype were investigated for the presence of an alpha-hemolysin gene (
-hlyA) by PCR. The PCR for the detection of the
-hlyA gene was developed on the basis of published nucleotide sequences (GenBank accession number M10133) by using McVector software (Oxford Molecular Group). The oligonucleotides hlyA-F16 (5' CAGTCCTCATTACCCAGCAAC 3') and hlyA-B14 (5' ACAGACCCCTTGTCCTGAAC 3') were selected as common primers for the
-hlyA gene. The PCR was run for 30 cycles (94°C for 40 s, 52.6°C for 40 s, and 72°C for 40 s) and yielded a 355-bp amplification product from the
-hlyA gene.
EaggEC-specific gene sequences.
Enteroaggregative E. coli (EaggEC)-specific DNA sequences were detected by dot blot DNA hybridization. A 765-bp PCR product from the EaggEC plasmid pCVD432 (3) was obtained with primers pCVD432/Start and pCVD432/Stop (71) and used as a gene probe. E. coli strains 17-2 and HS were used as positive and negative controls, respectively (3).

RESULTS
Serological diversity of human STEC isolates.
The 677 human STEC strains were typed into 55
E. coli O groups
and 24 different H types. All together, 74 different O:H combinations
(O:H serotypes) were found among the 677 strains (Tables
1 and
2). Forty O groups were associated with only one H type, and
15 O groups (O1, O5, O68, O77, O88, O91, O113, O115, O118, O123,
O125, O146, O156, O174, and O177) were associated with multiple
H types (Table
3). A rough lipopolysaccharide (O rough) was
found in 86 (12.7%) of the STEC strains, and 12 (1.8%) strains
showed O antigens which were not typeable (Ont), with antisera
specific for O1 to O181 (Tables
1 and
2).
Forty-one (55.4%) of the 74 STEC-associated O:H serotypes were
each represented by only one STEC isolate. On the other hand,
11 serotypes (O157:[H7], O26:[H11], O103:H2, O91:[H14], O111:[H8],
O145:[H28], O128:H2, O113:[H4], O146:H21, O118:H16, and O76:[H19])
accounted for 468 (69%) of all STEC strains from this study
(Tables
1 and
2). The H type was put in brackets when NM strains
were present in a given O group, and NM strains were analyzed
for their H type by a
fliC-specific PCR (see above). Only six
(0.9%) of the STEC strains were NM and yielded no amplification
product with the
fliC-specific PCR; these strains were classified
as H antigen negative (H
-).
Characterization of Shiga toxins.
The 677 STEC isolates were shown to produce cytotoxins in the Vero cell toxicity test (9). The production of Stx1 and Stx2 was examined with the VTEC-RPLA assay, and the stx genotypes of the strains were determined by PCR as described above.
The production of Stx1 and the presence of stx1 or stx1c variant genes were found in 475 (70.1%) of the strains. Production of Stx2 was detected in 353 (52.1%) of the strains which were positive in a PCR directed to stx2 and stx2 variants (primers LP43 and LP44). In addition, stx2 genes were detected in 82 STEC strains which were negative for Stx2 production as determined by the VTEC-RPLA. These 82 strains harbored either stx2c, stx2d-ount, stx2d-OX3a, stx2e, or stx2ev genes. All together, 435 (64.3%) of the 677 STEC strains carried stx2 or stx2 variant gene sequences.
The subtyping of stx1 and stx2 genes resulted in the detection of two genotypes (stx1 and stx1c) among Stx1 strains and of eight genotypes (stx2, stx2c, stx2d-ount, stx2d-OX3a, stx2vha, stx2vhb, stx2e, and stx2ev) among Stx2 strains. According to the nomenclature, the STEC strains were grouped into Shiga toxin types (1, 1c, 2, 2c, 2d, and 2e), which were present alone or in different combinations in the STEC strains (Tables 1 and 2). Intimin-positive and intimin-negative STEC strains differed in their Shiga toxin types. Toxin types 1c and 2d were found only in eae-negative STEC strains. Toxin type 2 was associated with 85.5% of eae-positive and with 14.4% of eae-negative strains (Table 4). Toxin type 2c (genotype stx2c, stx2d-ount, or stx2d-OX3a) was present in both eae-positive (44.4%) and eae-negative (55.6%) strains, and the genetic variants stx2d-ount and stx2d-OX3a were found only in eae-negative strains. Toxin type 2d (stx2vha and stx2vhb) was detected in 14 STEC strains belonging to serotypes O91:[H21], O113:[H21], O148:H8, O163:[H19], O174:H21, and Ont:[H21]. Toxin type 2e (genotypes stx2e and stx2ev) was present only in six strains belonging to serotypes O43:[H30], O60:[H4], O91:H21, Ont:H10, and Ont:[H19] (Tables 2 and 4).
Characterization of intimin (eae) genes.
eae genes were detected in 424 (62.6%) of the STEC strains by
DNA hybridization and by PCR. The
eae-positive STEC strains
could be subtyped for their intimins by PCR with specific primers
as previously described (
55,
88). Six intimin types, namely,

1 (2 strains), ß1 (123 strains),

1 (197 strains),

(63 strains),

(31 strains), and

(8 strains), were detected
(Table
1). The intimin subtypes were found to be associated
with distinct O:H serotypes of STEC as well as with Ont (intimins

and

1) and O rough (intimins ß1,

1,

,

, and

) strains.
Intimin ß1 was the most widespread among STEC and
was found in strains belonging to 12 different serotypes. In
contrast, intimins

1,

1,

,

, and

were associated with fewer
serotypes (Table
1). However, these serotypes were isolated
most frequently and included O157:[H7] (

1), O103:H2 (

), and
O111:[H8] (

).
Hemolytic phenotype and association with EHEC hemolysin (EHEC hlyA).
Hemolytic activity was detectable in 576 (85.1%) of the 677 STEC strains. An alpha-hemolytic phenotype was found for two STEC strains (0.3%), and an enterohemolytic phenotype was found for 574 STEC strains (84.8%). The remaining 101 strains showed no hemolysis and were distributed over 30 different O:H types and Ont and O rough strains (data not shown).
The EHEC hlyA gene was present in 573 of the 574 STEC strains that had an enterohemolytic phenotype and in eight strains which showed no hemolytic activity. The EHEC hlyA gene was absent in both strains that had an alpha-hemolytic phenotype (Ont:H10 and Orough:H45), and these were positive for an
-hlyA gene. One of the hemolytic strains (Ont:H31) was negative for both
-hlyA and EHEC hlyA sequences and may produce a different type of hemolysin. An enterohemolytic phenotype and the presence of the EHEC hlyA gene were associated with 408 eae-positive (96.2%) and 165 (65.2%) eae-negative STEC strains.
EaggEC-specific DNA sequences.
None of the 677 VTEC strains from this study was positive for DNA hybridization with the EaggEC gene probe, which was previously reported to react with some STEC O111 strains (51).
Relationship between STEC type and clinical status of a patient.
Clinical data were provided for 608 patients (89.8%). The patients were divided into six groups according to their clinical status at the period of sampling (Table 5). A majority (59.2%) suffered from nonbloody diarrhea, 14.3% of patients had bloody diarrhea (BD), and HUS was present in 3.5% of the patients. Abdominal pain without diarrhea was reported for 8.7% of the patients. A group of asymptomatic excreters (11.0%) was formed from patients who had recovered from diarrhea or were sampled in control investigations. A few patients (3.3%) were reported to have diseases other than diarrhea or HUS.
Severe disease, such as BD and HUS, was significantly (
P value
of <0.001 by
2 test) associated with
eae-positive STEC. Classical
EHEC strains (O26:[H11], O103:H2, O111:[H8], O145:[H28], and
O157:[H7]) predominated in patients with HUS (81.0%) and BD
(78.0%). Strains belonging to the new EHEC types O118:[H16]
and O121:H19 were isolated from four cases of BD (4.6%) and
from one case of HUS (4.8%) (Table
5).
eae-positive STEC strains
were also found to predominate in patients with nonbloody diarrhea,
whereas
eae-negative STEC strains were frequent in patients
with abdominal pain, and classical EHEC serotypes were isolated
in only 13.0% of these cases.
A close relation was found between the patient's age and the presence of an eae gene in the STEC isolate (Table 6). The mean age of all 632 patients with known clinical history was 16 years 3 months. Patients infected with eae-positive STEC (n = 393) were younger (mean age, 8 years 3 months) than patients infected with eae-negative STEC (n = 239) (mean age, 29 years 4 months). STEC infections in children up to 6 years of age were significantly (P < 0.001) associated with eae-positive STEC isolates, which were found in 311 (88.1%) of the 353 STEC-infected children of this age group. In the group of patients older than 6 years, eae-negative STEC infections were significantly (P < 0.001) more frequent than in older age groups (Table 6). Thus, 197 (70.6%) of the 279 STEC strains isolated from patients older than 6 years did not carry an eae gene.

DISCUSSION
Studies from different countries have shown that humans can
be infected with a large spectrum of serologically different
STEC types (
86;
www.sciencenet.com.au/vtectable.htm). In an
earlier study, we analyzed 89 human non-O157 STEC strains which
were isolated in 1996 (
10). As a result,
eae-positive O118:H16
strains were identified as emerging EHEC strains in Germany,
and some
eae-negative STEC strains belonging to serogroups O91,
O128, and O146 were frequently found among human clinical isolates.
These findings encouraged us to examine larger numbers of human
STEC strains in order to characterize the STEC strains associated
with human infections in more detail and also to detect possible
new STEC types.
The characterization of clonal types in E. coli populations by multilocus enzyme electrophoresis and by multilocus nucleotide sequencing has shown that the O:H serotype is a good indicator for the identification of strains belonging to distinct clonal groups (17, 22). However, many EHEC and STEC isolates are phenotypically NM (www.sciencenet.com.au/vtectable.htm) and therefore cannot be grouped into distinct O:H serotypes. In order to detect the H types of NM STEC strains, we have characterized the fliC genes in these strains by PCR-RFLP typing. This method has previously been shown to be suitable for the grouping of STEC O91:NM and O128:NM strains into serotypes O91:[H14] and O128:[H2], respectively, and the close relationship between motile and NM strains belonging to the same serotype was confirmed by pulsed-field gel electrophoresis typing (79). The contribution of molecular H-antigen typing for the identification of STEC serotypes is emphasized by the facts that 221 (32.6%) of the strains from our study were phenotypically NM and that only 6 of these were negative in the fliC PCR and were classified as H antigen negative. High numbers of NM strains were also detected in other studies of EHEC O26, O111, O145, and O157 (13, 24) and STEC O91, O113, and O174 (old designation, OX3) strains (28, 62, 63). In our study, NM and motile strains belonging to the EHEC O-antigen groups O26, O103, O111, O118, O121, O145, and O157 could be assigned to single O:H types by fliC genotyping (Table 1). NM STEC strains belonging to O-antigen groups which were associated with more than one H-antigen type (O91, O113, O115, O125, and O177) could be typed accordingly (Table 2). Twenty-four of 53 known E. coli H types (54) were found in the STEC strains, and 15 H types were associated with strains belonging to more than one O-antigen group (Table 3). Only 10 H types (H2, H7, H8, H11, H16, H19, H25, H28, H30, and H33) were linked with the 424 eae-positive STEC strains from our study, and these were distributed over 21 O groups and Ont and O rough strains. These findings indicate that the determination of the fliC type may be a useful diagnostic approach for the detection and characterization of STEC strains.
In order to search for new STEC types which are not yet known to occur in humans, we used a reference list which summarizes published data on the serotypes and origins of non-O157 STEC strains (www.sciencenet.com.au/vtectable.htm). By this list, we could identify 41 STEC strains belonging to 31 different serotypes which were not previously described as human STEC (Tables 1 and 2). Some of these "new" O:H types were already reported to be STEC strains from animals, and it was shown that certain STEC serotypes are closely associated with some animal host species (12, 26, 29, 41, 53, 78, 79). Based on these reports, we made an estimate about the possible animal source of the STEC strains from our study. Most of the eae-positive human STEC strains listed in Table 1 belong to serotypes which are closely associated with cattle. The eae-negative STEC strains were more diverse in their relations to animal hosts. Serotypes O91:[H14], O128:H2, and O146:H21, which represent about 30% of the human eae-negative STEC strains (Table 2), were reported to be associated with sheep (5, 12, 20, 41, 78, 79), whereas others, such as O22:H8, O113:[H4], and O113:[H21], are common in cattle (29, 63). Animal and human STEC strains which belong to the same serotype were found to be similar in their virulence markers, and the transmission of STEC from animals to humans has been reported (86). According to these findings, cattle and sheep represent an important source of STEC types which were frequently isolated from humans in our study.
Previous studies have shown that the virulence of STEC for humans may be related to the type of Shiga toxin which is produced by the bacteria. Of the different Shiga toxins, Stx2 (stx2) was found to be related with high virulence and was significantly associated with STEC strains from BD and HUS patients (13, 24). Similar findings were made in our study, as toxin type 2 was present in 20 of 21 STEC strains from HUS patients (Table 5). Moreover, toxin type 2 (stx2) was found more frequently in eae-positive STEC strains than in eae-negative STEC strains (Tables 1, 2, and 4). The combination of the stx2 and eae genes was found to be significant in another study, which was performed on STEC strains of different origins and serotypes (13).
In contrast, toxin type 1c (genotype stx1ox3/stx1c) STEC strains were shown to be closely associated with sheep (15, 39, 78, 79). In our study, toxin type 1c was present in 41% of the eae-negative STEC strains and spread over 24 different serotypes. Toxin type 1c was often present in combination with toxin type 2c (stx2d-ount or stx2d-OX3a) but not with toxin type 2 (Table 2). STEC strains with toxin type 1c and/or 2c from our study were frequently isolated from patients with milder disease (abdominal pain or nonbloody diarrhea), corresponding to previously published results (24, 25, 61). The lower virulence of these STEC strains for humans may be explained by the lack of the attaching and effacing property and of Stx2; both factors were reported to be major virulence attributes of STEC strains causing severe disease in humans (13, 24).
A mucus elastase-activatable variant of Stx2 called stx2d (stx2vha and stx2vhb) was previously described for an STEC strain of serotype O91:H21 (40, 49). Toxin type 2d-positive STEC strains of serotypes O91:H10, O91:H21, O174:NM, and O174:H21 were isolated from patients with BD and HUS (30, 49, 62), and a linkage was found between severe gastrointestinal disease in patients and the presence of stx2d (31). In our study, we could identify two known (O91:[H21] and O174:H21) and four new (O113:[H21], O148:H8, O163:[H19], and Ont:[H21]) serotypes of toxin 2d strains (Table 2). Two of these serotypes (O148:H8 and O174:H21) were from patients with BD.
It was reported that toxin type 2e strains are rarely isolated from humans and cause milder disease (24). Similar findings were made in our study (Table 4). The production of Stx2e is characteristic for porcine STEC strains, which cause edema disease in pigs (26, 83). However, none of the strains from our study belonged to typical porcine serotypes, indicating that these are not as important as human pathogens.
Intimins
and
were previously not described as being associated with human STEC (55, 77). In this study, we have detected intimin
in eight STEC strains with flagellar type H25 (O109:H25, O156:H25, Ont:H25, and Orough:H25) which were positive for EHEC hlyA and, except in Ont:H25 (toxin type 2) strains, for toxin type 1 (Table 1). Intimin
was recently described to occur in bovine STEC strains which belonged to serotypes other than those of our human STEC isolates (33, 38). Intimin
was previously detected in EPEC but not in STEC strains (7, 32, 55) and was detected in our study in two strains representing a new STEC serotype, O177:[H7] (toxin type 1, EHEC hlyA negative).
Intimin ß is reported to be the most frequent type of intimin in EPEC and STEC strains from humans and animals, and its presence is associated with multiple E. coli serotypes (1, 7, 19, 55). In this study, intimin ß1 was detected in 123 STEC strains and 12 serotypes. Intimin ß1 was found as a characteristic trait of all STEC strains with flagellar type H11 (Tables 1 and 3). Fourteen intimin ß1-positive STEC strains belonging to eight serotypes (O5:H11, O43:[H30], O68:H11, O68:H25, O77:H11, O123:H11, O177:H11, and O177:[H25]) were identified as new groups of human STEC strains in this study.
Intimin
was first described for EHEC O103:H2 strains (55) and more recently for emerging EHEC O121:H19 strains (31, 76). Apart from EHEC O103 and O121 strains, we have detected intimin
in two new groups of STEC O123:H2 and Ont:H2 strains (Table 1). Intimin
was also found in many STEC strains which were O rough; 14 of these were positive for flagellar type H2, toxin type 1, and EHEC hlyA and resembled strains of the EHEC O103:H2 clone. Characteristic combinations between H types, toxin types, and EHEC hlyA and intimin types were found in other STEC O rough strains, which may indicate that these strains originated from classical EHEC O157:H7 and O111:H8 strains (Table 1).
EHEC hemolysin, which causes an enterohemolytic phenotype on blood agar, was detected in many STEC strains of different origins (12, 13, 28, 29, 69) and was found to be significantly associated with eae-positive STEC strains belonging to classical and emerging EHEC types (13, 28, 46, 69, 76). Similar findings were made in our study, where EHEC hemolysin was detected in 96.2% of the eae-positive STEC strains. In contrast, alpha-hemolysin, which is known as a characteristic trait of porcine STEC strains (26), was detected in only two (0.3%) of the human STEC strains. The presence of toxin type 2e in the two alpha-hemolytic human STEC strains indicates that these strains could have originated from pigs.
It was previously reported that aggregative adherence and EaggEC-specific DNA sequences were found in STEC O111:H2 strains from HUS patients in France (51). EaggEC-specific DNA sequences were not found in any of the 677 STEC strains from our study, indicating that this pathotype is not common among STEC strains from Germany.
Ninety-four (87.0%) of 108 STEC strains which were isolated from patients with BD or HUS belonged to EHEC-related O groups and/or carried virulence markers (intimin, EHEC hlyA, and Stx2) which were previously associated with severe disease in humans (Table 5). Thirteen strains from patients with BD and one strain from a patient with HUS did not belong to classical EHEC serotypes and were negative for intimin (Table 5). These 14 strains were distributed over 13 serotypes, and some of these (O22:H8, O105:H18, O174:H2, and O174:H21) were already described as isolates from patients with BD or HUS (11, 23, 66). Our findings support previous studies indicating that certain serotypes of eae-negative STEC strains may cause severe disease (14, 23, 37, 63). The pathomechanism by which these atypical EHEC strains cause disease is not well known. Toxin types 2 and 2d may contribute to the virulence of atypical EHEC strains. In our study, toxin type 2 was found in 7 of 14 eae-negative strains (50%) from patients with BD and HUS but only in 19 (9.4%) of 202 eae-negative strains from all other patients, and two patients with BD were infected with toxin type 2d strains.
The search for new STEC types in a large group of human patients resulted in the detection of 41 strains and 31 serotypes which have not been described before as human STEC. Nineteen strains distributed over 11 serotypes represented new types of eae-positive STEC, and 16 of these expressed EHEC hemolysin; both properties are virulence attributes of classical EHEC strains (52). None of these strains were from patients with BD or HUS. Toxin type 2, which is associated with increased virulence of STEC, was found in only five of these strains belonging to serotypes O77:H11 and O177:[H25] (Table 1). The small number of cases which involved infection with the new types of eae-positive STEC strains does not permit an estimate of the virulence potential of these strains.
We had previously reported that infections with eae-positive STEC are associated with young age but that eae-negative isolates are more frequently isolated from adult patients (5). These findings were confirmed (P < 0.001) in the present study, which was performed on a larger number of isolates. Protective immunity to intimin may be acquired in early childhood due to infections with eae-positive EPEC and STEC strains (7, 21, 47), and this may explain why these strains are less frequently isolated from adults. On the other hand, adults are principally more exposed to STEC strains from nonhuman sources due to occupational contact with animals, food, and the environment, and the majority of STEC strains from these sources are negative for intimin (6, 20, 29, 50). This may explain the high frequency of infections with eae-negative STEC strains in adults. Severe disease such as BD or HUS was more frequent in young patients, which corresponds to the virulence attributes of their STEC isolates.
Our study shows that different types of STEC strains predominate in infant and adult patients and that new types of STEC strains can be identified by subtyping of virulence genes and by serotyping of new O-antigen groups, including O175 to O181. The fliC PCR allowed the determination of H-antigen types in 221 (32.6%) STEC strains which were phenotypically NM. The finding of Ont strains in this study (Tables 1 and 2) suggests that further O types need to be designated.

ACKNOWLEDGMENTS
We thank Flemming Scheutz, The International Escherichia &
Klebsiella Centre (WHO), Statens Seruminstitut, Copenhagen,
Denmark, for providing
E. coli reference strains representing
new O groups O176 to O181 and Karl A. Bettelheim for advice,
encouragement, and critical reading of the manuscript.
This study was supported by funds from the European Commission project Attaching and Effacing Escherichia coli Infections (reference QLK2-CT-2000-00600).

FOOTNOTES
* Corresponding author. Mailing address: Division of Microbial Toxins, Department of Biological Safety, Robert Koch Institut, Nordufer 20, D-13353 Berlin, Germany. Phone: 49 30 45 47 2484. Fax: 49 30 45 47 2673. E-mail:
BeutinL{at}rki.de.


REFERENCES
1 - Adu-Bobie, J., G. Frankel, C. Bain, A. G. Goncalves, L. R. Trabulsi, G. Douce, S. Knutton, and G. Dougan. 1998. Detection of intimins
, ß,
, and
, four intimin derivatives expressed by attaching and effacing microbial pathogens. J. Clin. Microbiol. 36:662-668.[Abstract/Free Full Text]
2 - Bastian, S. N., I. Carle, and F. Grimont. 1998. Comparison of 14 PCR systems for the detection and subtyping of stx genes in Shiga-toxin-producing Escherichia coli. Res. Microbiol. 149:457-472.[Medline]
3 - Baudry, B., S. J. Savarino, P. Vial, J. B. Kaper, and M. M. Levine. 1990. A sensitive and specific DNA probe to identify enteroaggregative Escherichia coli, a recently discovered diarrheal pathogen. J. Infect. Dis. 161:1249-1251.[Medline]
4 - Beutin, L., M. Bulte, A. Weber, S. Zimmermann, and K. Gleier. 2000. Investigation of human infections with verocytotoxin-producing strains of Escherichia coli (VTEC) belonging to serogroup O118 with evidence for zoonotic transmission. Epidemiol. Infect. 125:47-54.[CrossRef][Medline]
5 - Beutin, L., D. Geier, S. Zimmermann, S. Aleksic, H. A. Gillespie, and T. S. Whittam. 1997. Epidemiological relatedness and clonal types of natural populations of Escherichia coli strains producing Shiga toxins in separate populations of cattle and sheep. Appl. Environ. Microbiol. 63:2175-2180.[Abstract]
6 - Beutin, L., D. Geier, S. Zimmermann, and H. Karch. 1995. Virulence markers of Shiga-like toxin-producing Escherichia coli strains originating from healthy domestic animals of different species. J. Clin. Microbiol. 33:631-635.[Abstract]
7 - Beutin, L., O. Marchés, K. A. Bettelheim, K. Gleier, S. Zimmermann, H. Schmidt, and E. Oswald. 2003. HEp-2 cell adherence, actin aggregation, and intimin types of attaching and effacing Escherichia coli strains isolated from healthy infants in Germany and Australia. Infect. Immun. 71:3995-4002.[Abstract/Free Full Text]
8 - Beutin, L., S. Zimmermann, and K. Gleier. 2002. Evaluation of the VTEC-Screen "Seiken" test for detection of different types of Shiga toxin (verotoxin)-producing Escherichia coli (STEC) in human stool samples. Diagn. Microbiol. Infect. Dis. 42:1-8.[CrossRef][Medline]
9 - Beutin, L., S. Zimmermann, and K. Gleier. 1996. Rapid detection and isolation of Shiga-like toxin (verocytotoxin)-producing Escherichia coli by direct testing of individual enterohemolytic colonies from washed sheep blood agar plates in the VTEC-RPLA assay. J. Clin. Microbiol. 34:2812-2814.[Abstract]
10 - Beutin, L., S. Zimmermann, and K. Gleier. 1998. Human infections with Shiga toxin-producing Escherichia coli other than serogroup O157 in Germany. Emerg. Infect. Dis. 4:635-639.[Medline]
11 - Blanco, J., M. Blanco, J. E. Blanco, A. Mora, E. A. Gonzalez, M. I. Bernardez, M. P. Alonso, A. Coira, A. Rodriguez, J. Rey, J. M. Alonso, and M. A. Usera. 2003. Verotoxin-producing Escherichia coli in Spain: prevalence, serotypes, and virulence genes of O157:H7 and non-O157 VTEC in ruminants, raw beef products, and humans. Exp. Biol. Med. (Maywood) 228:345-351.[Abstract/Free Full Text]
12 - Blanco, M., J. E. Blanco, A. Mora, J. Rey, J. M. Alonso, M. Hermoso, J. Hermoso, M. P. Alonso, G. Dahbi, E. A. González, M. I. Bernárdez, and J. Blanco. 2003. Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from healthy sheep in Spain. J. Clin. Microbiol. 41:1351-1356.[Abstract/Free Full Text]
13 - Boerlin, P., S. A. McEwen, F. Boerlin-Petzold, J. B. Wilson, R. P. Johnson, and C. L. Gyles. 1999. Associations between virulence factors of Shiga toxin-producing Escherichia coli and disease in humans. J. Clin. Microbiol. 37:497-503.[Abstract/Free Full Text]
14 - Bonnet, R., B. Souweine, G. Gauthier, C. Rich, V. Livrelli, J. Sirot, B. Joly, and C. Forestier. 1998. Non-O157:H7 Stx2-producing Escherichia coli strains associated with sporadic cases of hemolytic-uremic syndrome in adults. J. Clin. Microbiol. 36:1777-1780.[Abstract/Free Full Text]
15 - Brett, K. N., V. Ramachandran, M. A. Hornitzky, K. A. Bettelheim, M. J. Walker, and S. P. Djordjevic. 2003. stx1c is the most common Shiga toxin 1 subtype among Shiga toxin-producing Escherichia coli isolates from sheep but not among isolates from cattle. J. Clin. Microbiol. 41:926-936.[Abstract/Free Full Text]
16 - Brunder, W., H. Schmidt, M. Frosch, and H. Karch. 1999. The large plasmids of Shiga-toxin-producing Escherichia coli (STEC) are highly variable genetic elements. Microbiology 145:1005-1014.[Abstract/Free Full Text]
17 - Caugant, D. A., B. R. Levin, I. Ørskov, F. Ørskov, C. S. Eden, and R. K. Selander. 1985. Genetic diversity in relation to serotype in Escherichia coli. Infect. Immun. 49:407-413.[Abstract/Free Full Text]
18 - Cebula, T. A., W. L. Payne, and P. Feng. 1995. Simultaneous identification of strains of Escherichia coli serotype O157:H7 and their Shiga-like toxin type by mismatch amplification mutation assay-multiplex PCR. J. Clin. Microbiol. 33:248-250.[Abstract]
19 - Cid, D., S. Q. J. Ruiz, I. Marin, R. Sanz, J. A. Orden, R. Amils, and R. de la Fuente. 2001. Association between intimin (eae) and EspB gene subtypes in attaching and effacing Escherichia coli strains isolated from diarrhoeic lambs and goat kids. Microbiology 147:2341-2353.[Abstract/Free Full Text]
20 - Djordjevic, S. P., M. A. Hornitzky, G. Bailey, P. Gill, B. Vanselow, K. Walker, and K. A. Bettelheim. 2001. Virulence properties and serotypes of Shiga toxin-producing Escherichia coli from healthy Australian slaughter-age sheep. J. Clin. Microbiol. 39:2017-2021.[Abstract/Free Full Text]
21 - Donnenberg, M. S., C. O. Tacket, G. Losonsky, G. Frankel, J. P. Nataro, G. Dougan, and M. M. Levine. 1998. Effect of prior experimental human enteropathogenic Escherichia coli infection on illness following homologous and heterologous rechallenge. Infect. Immun. 66:52-58.[Abstract/Free Full Text]
22 - Donnenberg, M. S., and T. S. Whittam. 2001. Pathogenesis and evolution of virulence in enteropathogenic and enterohemorrhagic Escherichia coli. J. Clin. Investig. 107:539-548.[Medline]
23 - Eklund, M., K. Leino, and A. Siitonen. 2002. Clinical Escherichia coli strains carrying stx genes: stx variants and stx-positive virulence profiles. J. Clin. Microbiol. 40:4585-4593.[Abstract/Free Full Text]
24 - Friedrich, A. W., M. Bielaszewska, W. L. Zhang, M. Pulz, T. Kuczius, A. Ammon, and H. Karch. 2002. Escherichia coli harboring Shiga toxin 2 gene variants: frequency and association with clinical symptoms. J. Infect. Dis. 185:74-84.[CrossRef][Medline]
25 - Friedrich, A. W., J. Borell, M. Bielaszewska, A. Fruth, H. Tschäpe, and H. Karch. 2003. Shiga toxin 1c-producing Escherichia coli strains: phenotypic and genetic characterization and association with human disease. J. Clin. Microbiol. 41:2448-2453.[Abstract/Free Full Text]
26 - Frydendahl, K. 2002. Prevalence of serogroups and virulence genes in Escherichia coli associated with postweaning diarrhoea and edema disease in pigs and a comparison of diagnostic approaches. Vet. Microbiol. 85:169-182.[CrossRef][Medline]
27 - Gannon, V. P., C. Teerling, S. A. Masri, and C. L. Gyles. 1990. Molecular cloning and nucleotide sequence of another variant of the Escherichia coli Shiga-like toxin II family. J. Gen. Microbiol. 136:1125-1135.[Abstract/Free Full Text]
28 - Gyles, C., R. Johnson, A. Gao, K. Ziebell, D. Pierard, S. Aleksic, and P. Boerlin. 1998. Association of enterohemorrhagic Escherichia coli hemolysin with serotypes of Shiga-like-toxin-producing Escherichia coli of human and bovine origins. Appl. Environ. Microbiol. 64:4134-4141.[Abstract/Free Full Text]
29 - Hornitzky, M. A., B. A. Vanselow, K. Walker, K. A. Bettelheim, B. Corney, P. Gill, G. Bailey, and S. P. Djordjevic. 2002. Virulence properties and serotypes of Shiga toxin-producing Escherichia coli from healthy Australian cattle. Appl. Environ. Microbiol. 68:6439-6445.[Abstract/Free Full Text]
30 - Ito, H., A. Terai, H. Kurazono, Y. Takeda, and M. Nishibuchi. 1990. Cloning and nucleotide sequencing of Vero toxin 2 variant genes from Escherichia coli O91:H21 isolated from a patient with the hemolytic uremic syndrome. Microb. Pathog. 8:47-60.[CrossRef][Medline]
31 - Jelacic, J. K., T. Damrow, G. S. Chen, S. Jelacic, M. Bielaszewska, M. Ciol, H. M. Carvalho, A. R. Melton-Celsa, A. D. O'Brien, and P. I. Tarr. 2003. Shiga toxin-producing Escherichia coli in Montana: bacterial genotypes and clinical profiles. J. Infect. Dis. 188:719-729.[CrossRef][Medline]
32 - Jenkins, C., A. J. Lawson, T. Cheasty, G. A. Willshaw, P. Wright, G. Dougan, G. Frankel, and H. R. Smith. 2003. Subtyping intimin genes from enteropathogenic Escherichia coli associated with outbreaks and sporadic cases in the United Kingdom and Eire. Mol. Cell. Probes 17:149-156.[CrossRef][Medline]
33 - Jenkins, C., M. C. Pearce, H. Chart, T. Cheasty, G. A. Willshaw, G. J. Gunn, G. Dougan, H. R. Smith, B. A. Synge, and G. Frankel. 2002. An eight-month study of a population of verocytotoxigenic Escherichia coli (VTEC) in a Scottish cattle herd. J. Appl. Microbiol. 93:944-953.[CrossRef][Medline]
34 - Jores, J., K. Zehmke, J. Eichberg, L. Rumer, and L. H. Wieler. 2003. Description of a novel intimin variant (type zeta) in the bovine O84:NM verotoxin-producing Escherichia coli strain 537/89 and the diagnostic value of intimin typing. Exp. Biol. Med. (Maywood) 228:370-376.[Abstract/Free Full Text]
35 - Kaper, J. B., S. Elliott, V. Sperandino, N. T. Perna, G. F. Mayhew, and F. R. Blattner. 1998. Attaching-and-effacing intestinal histopathology and the locus of enterocyte effacement, p. 163-182. In J. B. Kaper and A. D. O'Brien (ed.), Escherichia coli O157:H7 and other Shiga toxin-producing E. coli strains. American Society for Microbiology, Washington, D.C.
36 - Keskimaki, M., R. Ikaheimo, P. Karkkainen, F. Scheutz, Y. Ratiner, R. Puohiniemi, and A. Siltonen. 1997. Shiga toxin-producing Escherichia coli serotype OX3:H21 as a cause of hemolytic-uremic syndrome. Clin. Infect. Dis. 24:1278-1279.[Medline]
37 - Keskimäki, M., M. Saari, T. Heiskanen, and A. Siitonen. 1998. Shiga toxin-producing Escherichia coli in Finland from 1990 through 1997: prevalence and characteristics of isolates. J. Clin. Microbiol. 36:3641-3646.[Abstract/Free Full Text]
38 - Kobayashi, H., A. Miura, H. Hayashi, T. Ogawa, T. Endô, E. Hata, M. Eguchi, and K. Yamamoto. 2003. Prevalence and characteristics of eae-positive Escherichia coli from healthy cattle in Japan. Appl. Environ. Microbiol. 69:5690-5692.[Abstract/Free Full Text]
39 - Koch, C., S. Hertwig, R. Lurz, B. Appel, and L. Beutin. 2001. Isolation of a lysogenic bacteriophage carrying the stx1OX3 gene, which is closely associated with Shiga toxin-producing Escherichia coli strains from sheep and humans. J. Clin. Microbiol. 39:3992-3998.[Abstract/Free Full Text]
40 - Kokai-Kun, J. F., A. R. Melton-Celsa, and A. D. O'Brien. 2000. Elastase in intestinal mucus enhances the cytotoxicity of Shiga toxin type 2d. J. Biol. Chem. 275:3713-3721.[Abstract/Free Full Text]
41 - Kudva, I. T., P. G. Hatfield, and C. J. Hovde. 1997. Characterization of Escherichia coli O157:H7 and other Shiga toxin-producing E. coli serotypes isolated from sheep. J. Clin. Microbiol. 35:892-899.[Abstract]
42 - Levine, M. M. 1987. Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J. Infect. Dis. 155:377-389.[Medline]
43 - Levine, M. M., J. G. Xu, J. B. Kaper, H. Lior, V. Prado, B. Tall, J. Nataro, H. Karch, and K. Wachsmuth. 1987. A DNA probe to identify enterohemorrhagic Escherichia coli of O157:H7 and other serotypes that cause hemorrhagic colitis and hemolytic uremic syndrome. J. Infect. Dis. 156:175-182.[Medline]
44 - Ludwig, K., and D. E. Muller-Wiefel. 1998. Pathomechanisms in the haemolytic-uraemic syndrome. Nephrol. Dial. Transplant. 13:23-27.[Free Full Text]
45 - Machado, J., F. Grimont, and P. A. Grimont. 2000. Identification of Escherichia coli flagellar types by restriction of the amplified fliC gene. Res. Microbiol. 151:535-546.[Medline]
46 - Maidhof, H., B. Guerra, S. Abbas, H. M. Elsheikha, T. S. Whittam, and L. Beutin. 2002. A multiresistant clone of Shiga toxin-producing Escherichia coli O118:[H16] is spread in cattle and humans over different European countries. Appl. Environ. Microbiol. 68:5834-5842.[Abstract/Free Full Text]
47 - Manjarrez-Hernandez, H. A., S. Gavilanes-Parra, E. Chavez-Berrocal, A. Navarro-Ocaña, and A. Cravioto. 2000. Antigen detection in enteropathogenic Escherichia coli using secretory immunoglobulin A antibodies isolated from human breast milk. Infect. Immun. 68:5030-5036.[Abstract/Free Full Text]
48 - McDaniel, T. K., K. G. Jarvis, M. S. Donnenberg, and J. B. Kaper. 1995. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc. Natl. Acad. Sci. USA 92:1664-1668.[Abstract/Free Full Text]
49 - Melton-Celsa, A. R., S. C. Darnell, and A. D. O'Brien. 1996. Activation of Shiga-like toxins by mouse and human intestinal mucus correlates with virulence of enterohemorrhagic Escherichia coli O91:H21 isolates in orally infected, streptomycin-treated mice. Infect. Immun. 64:1569-1576.[Abstract]
50 - Meng, J., S. Zhao, and M. P. Doyle. 1998. Virulence genes of Shiga toxin-producing Escherichia coli isolated from food, animals and humans. Int. J. Food Microbiol. 45:229-235.[CrossRef][Medline]
51 - Morabito, S., H. Karch, P. Mariani-Kurkdjian, H. Schmidt, F. Minelli, E. Bingen, and A. Caprioli. 1998. Enteroaggregative, Shiga toxin-producing Escherichia coli O111:H2 associated with an outbreak of hemolytic-uremic syndrome. J. Clin. Microbiol. 36:840-842.[Abstract/Free Full Text]
52 - Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11:142-201.[Abstract/Free Full Text]
53 - Orden, J. A., S. Q. J. Ruiz, M. Blanco, J. E. Blanco, A. Mora, D. Cid, E. A. Gonzalez, J. Blanco, and R. de la Fuente. 2003. Prevalence and characterization of Vero cytotoxin-producing Escherichia coli isolated from diarrhoeic and healthy sheep and goats. Epidemiol. Infect. 130:313-321.[CrossRef][Medline]
54 - Orskov, F., and I. Orskov. 1984. Serotyping of Escherichia coli. Methods Microbiol. 14:43-112.
55 - Oswald, E., H. Schmidt, S. Morabito, H. Karch, O. Marchès, and A. Caprioli. 2000. Typing of intimin genes in human and animal enterohemorrhagic and enteropathogenic Escherichia coli: characterization of a new intimin variant. Infect. Immun. 68:64-71.[Abstract/Free Full Text]
56 - Paton, A. W., L. Beutin, and J. C. Paton. 1995. Heterogeneity of the amino-acid sequences of Escherichia coli Shiga-like toxin type-I operons. Gene 153:71-74.[CrossRef][Medline]
57 - Paton, A. W., J. C. Paton, M. W. Heuzenroeder, P. N. Goldwater, and P. A. Manning. 1992. Cloning and nucleotide sequence of a variant Shiga-like toxin II gene from Escherichia coli OX3:H21 isolated from a case of sudden infant death syndrome. Microb. Pathog. 13:225-236.[CrossRef][Medline]
58 - Paton, A. W., P. Srimanote, M. C. Woodrow, and J. C. Paton. 2001. Characterization of Saa, a novel autoagglutinating adhesin produced by locus of enterocyte effacement-negative Shiga-toxigenic Escherichia coli strains that are virulent for humans. Infect. Immun. 69:6999-7009.[Abstract/Free Full Text]
59 - Perna, N. T., G. F. Mayhew, G. Pósfai, S. Elliott, M. S. Donnenberg, J. B. Kaper, and F. R. Blattner. 1998. Molecular evolution of a pathogenicity island from enterohemorrhagic Escherichia coli O157:H7. Infect. Immun. 66:3810-3817.[Abstract/Free Full Text]
60 - Phillips, A. D., S. Navabpour, S. Hicks, G. Dougan, T. Wallis, and G. Frankel. 2000. Enterohaemorrhagic Escherichia coli O157:H7 target Peyer's patches in humans and cause attaching/effacing lesions in both human and bovine intestine. Gut 47:377-381.[Abstract/Free Full Text]
61 - Piérard, D., G. Muyldermans, L. Moriau, D. Stevens, and S. Lauwers. 1998. Identification of new verocytotoxin type 2 variant B-subunit genes in human and animal Escherichia coli isolates. J. Clin. Microbiol. 36:3317-3322.[Abstract/Free Full Text]
62 - Pradel, N., K. Boukhors, Y. Bertin, C. Forestier, C. Martin, and V. Livrelli. 2001. Heterogeneity of Shiga toxin-producing Escherichia coli strains isolated from hemolytic-uremic syndrome patients, cattle, and food samples in central France. Appl. Environ. Microbiol. 67:2460-2468.[Abstract/Free Full Text]
63 - Pradel, N., V. Livrelli, C. De Champs, J.-B. Palcoux, A. Reynaud, F. Scheutz, J. Sirot, B. Joly, and C. Forestier. 2000. Prevalence and characterization of Shiga toxin-producing Escherichia coli isolated from cattle, food, and children during a one-year prospective study in France. J. Clin. Microbiol. 38:1023-1031.[Abstract/Free Full Text]
64 - Ramachandran, V., M. A. Hornitzky, K. A. Bettelheim, M. J. Walker, and S. P. Djordjevic. 2001. The common ovine Shiga toxin 2-containing Escherichia coli serotypes and human isolates of the same serotypes possess a Stx2d toxin type. J. Clin. Microbiol. 39:1932-1937.[Abstract/Free Full Text]
65 - Riley, L. W., R. S. Remis, S. D. Helgerson, H. B. McGee, J. G. Wells, B. R. Davis, R. J. Hebert, E. S. Olcott, L. M. Johnson, N. T. Hargrett, P. A. Blake, and M. L. Cohen. 1983. Hemorrhagic colitis associated with a rare Escherichia coli serotype. N. Engl. J. Med. 308:681-685.[Abstract]
66 - Russmann, H., E. Kothe, H. Schmidt, S. Franke, D. Harmsen, A. Caprioli, and H. Karch. 1995. Genotyping of Shiga-like toxin genes in non-O157 Escherichia coli strains associated with haemolytic uraemic syndrome. J. Med. Microbiol. 42:404-410.[Abstract/Free Full Text]
67 - Scheutz, F., L. Beutin, D. Pierard, and H. R. Smith. 2001. Nomenclature of verocytotoxins, p. 447-452. In G. Duffy, P. Garvey, and D. A. McDowell (ed.), Verocytotoxigenic E. coli. Food & Nutrition Press, Trumbull, Conn.
68 - Scheutz, F., L. Beutin, and H. R. Smith. 2001. Clinical detection of verocytotoxin-producing E. coli (VTEC), p. 25-56. In G. Duffy, P. Garvey, and D. A. McDowell (ed.), Verocytotoxigenic E. coli. Food & Nutrition Press, Inc., Trumbull, Conn.
69 - Schmidt, H., L. Beutin, and H. Karch. 1995. Molecular analysis of the plasmid-encoded hemolysin of Escherichia coli O157:H7 strain EDL 933. Infect. Immun. 63:1055-1061.[Abstract]
70 - Schmidt, H., H. Karch, and L. Beutin. 1994. The large-sized plasmids of enterohemorrhagic Escherichia coli O157 strains encode hemolysins which are presumably members of the E. coli alpha-hemolysin family. FEMS Microbiol. Lett. 117:189-196.[Medline]
71 - Schmidt, H., C. Knop, S. Franke, S. Aleksic, J. Heesemann, and H. Karch. 1995. Development of PCR for screening of enteroaggregative Escherichia coli. J. Clin. Microbiol. 33:701-705.[Abstract]
72 - Schmidt, H., J. Scheef, S. Morabito, A. Caprioli, L. H. Wieler, and H. Karch. 2000. A new Shiga toxin 2 variant (Stx2f) from Escherichia coli isolated from pigeons. Appl. Environ. Microbiol. 66:1205-1208.[Abstract/Free Full Text]
73 - Schmitt, C. K., M. L. McKee, and A. D. O'Brien. 1991. Two copies of Shiga-like toxin II-related genes common in enterohemorrhagic Escherichia coli strains are responsible for the antigenic heterogeneity of the O157:H- strain E32511. Infect. Immun. 59:1065-1073.[Abstract/Free Full Text]
74 - Siegler, R. L., T. G. Obrig, T. J. Pysher, V. L. Tesh, N. D. Denkers, and F. B. Taylor. 2003. Response to Shiga toxin 1 and 2 in a baboon model of hemolytic uremic syndrome. Pediatr. Nephrol. 18:92-96.[Medline]
75 - Srimanote, P., A. W. Paton, and J. C. Paton. 2002. Characterization of a novel type IV pilus locus encoded on the large plasmid of locus of enterocyte effacement-negative Shiga-toxigenic Escherichia coli strains that are virulent for humans. Infect. Immun. 70:3094-3100.[Abstract/Free Full Text]
76 - Tarr, C. L., T. M. Large, C. L. Moeller, D. W. Lacher, P. I. Tarr, D. W. Acheson, and T. S. Whittam. 2002. Molecular characterization of a serotype O121:H19 clone, a distinct Shiga toxin-producing clone of pathogenic Escherichia coli. Infect. Immun. 70:6853-6859.[Abstract/Free Full Text]
77 - Tarr, C. L., and T. S. Whittam. 2002. Molecular evolution of the intimin gene in O111 clones of pathogenic Escherichia coli. J. Bacteriol. 184:479-487.[Abstract/Free Full Text]
78 - Urdahl, A. M., L. Beutin, E. Skjerve, and Y. Wasteson. 2002. Serotypes and virulence factors of Shiga toxin-producing Escherichia coli isolated from healthy Norwegian sheep. J. Appl. Microbiol. 93:1026-1033.[CrossRef][Medline]
79 - Urdahl, A. M., L. Beutin, E. Skjerve, S. Zimmermann, and Y. Wasteson. 2003. Animal host associated differences in Shiga toxin-producing Escherichia coli isolated from sheep and cattle on the same farm. J. Appl. Microbiol. 95:92-101.[CrossRef][Medline]
80 - Vallance, B. A., and B. B. Finlay. 2000. Exploitation of host cells by enteropathogenic Escherichia coli. Proc. Natl. Acad. Sci. USA 97:8799-8806.[Abstract/Free Full Text]
81 - Waddell, T. E., C. A. Lingwood, and C. L. Gyles. 1996. Interaction of verotoxin 2e with pig intestine. Infect. Immun. 64:1714-1719.[Abstract]
82 - Wade, W. G., B. T. Thom, and N. Evans. 1979. Cytotoxic enteropathogenic Escherichia coli. Lancet 2:1235-1236.
83 - Weinstein, D. L., M. P. Jackson, J. E. Samuel, R. K. Holmes, and A. D. O'Brien. 1988. Cloning and sequencing of a Shiga-like toxin type II variant from an Escherichia coli strain responsible for edema disease of swine. J. Bacteriol. 170:4223-4230.[Abstract/Free Full Text]
84 - Willshaw, G. A., H. R. Smith, S. M. Scotland, and B. Rowe. 1985. Cloning of genes determining the production of Vero cytotoxin by Escherichia coli. J. Gen. Microbiol. 131:3047-3053.[Abstract/Free Full Text]
85 - Wilson, M. W., and K. A. Bettelheim. 1980. Cytotoxic Escherichia coli serotypes. Lancet i:201.
86 - World Health Organization Scientific Working Group. 1998. Zoonotic non-O157 Shiga toxin-producing Escherichia coli (STEC), 23-26 June 1998, Berlin, Germany, p. 1-30. W.H.O./CSR/APH/98.8. World Health Organization, Geneva, Switzerland.
87 - Zhang, W., M. Bielaszewska, T. Kuczius, and H. Karch. 2002. Identification, characterization, and distribution of a Shiga toxin 1 gene variant (stx1c) in Escherichia coli strains isolated from humans. J. Clin. Microbiol. 40:1441-1446.[Abstract/Free Full Text]
88 - Zhang, W. L., B. Köhler, E. Oswald, L. Beutin, H. Karch, S. Morabito, A. Caprioli, S. Suerbaum, and H. Schmidt. 2002. Genetic diversity of intimin genes of attaching and effacing Escherichia coli strains. J. Clin. Microbiol. 40:4486-4492.[Abstract/Free Full Text]
89 - Zhu, C., T. S. Agin, S. J. Elliott, L. A. Johnson, T. E. Thate, J. B. Kaper, and E. C. Boedeker. 2001. Complete nucleotide sequence and analysis of the locus of enterocyte effacement from rabbit diarrheagenic Escherichia coli RDEC-1. Infect. Immun. 69:2107-2115.[Abstract/Free Full Text]
Journal of Clinical Microbiology, March 2004, p. 1099-1108, Vol. 42, No. 3
0095-1137/04/$08.00+0 DOI: 10.1128/JCM.42.3.1099-1108.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Haack, S. K., Duris, J. W., Fogarty, L. R., Kolpin, D. W., Focazio, M. J., Furlong, E. T., Meyer, M. T.
(2009). Comparing Wastewater Chemicals, Indicator Bacteria Concentrations, and Bacterial Pathogen Genes as Fecal Pollution Indicators. J. Environ. Qual.
38: 248-258
[Abstract]
[Full Text]
-
Karama, M., Johnson, R. P., Holtslander, R., Gyles, C. L.
(2008). Phenotypic and Genotypic Characterization of Verotoxin-Producing Escherichia coli O103:H2 Isolates from Cattle and Humans. J. Clin. Microbiol.
46: 3569-3575
[Abstract]
[Full Text]
-
Islam, M. A., Mondol, A. S., de Boer, E., Beumer, R. R., Zwietering, M. H., Talukder, K. A., Heuvelink, A. E.
(2008). Prevalence and Genetic Characterization of Shiga Toxin-Producing Escherichia coli Isolates from Slaughtered Animals in Bangladesh. Appl. Environ. Microbiol.
74: 5414-5421
[Abstract]
[Full Text]
-
Beutin, L., Kruger, U., Krause, G., Miko, A., Martin, A., Strauch, E.
(2008). Evaluation of Major Types of Shiga Toxin 2e-Producing Escherichia coli Bacteria Present in Food, Pigs, and the Environment as Potential Pathogens for Humans. Appl. Environ. Microbiol.
74: 4806-4816
[Abstract]
[Full Text]
-
Stephan, R., Schumacher, S., Corti, S., Krause, G., Danuser, J., Beutin, L.
(2008). Prevalence and Characteristics of Shiga Toxin-Producing Escherichia coli in Swiss Raw Milk Cheeses Collected at Producer Level. J DAIRY SCI
91: 2561-2565
[Abstract]
[Full Text]
-
King, J. D., Mulrooney, E. F., Vinogradov, E., Kneidinger, B., Mead, K., Lam, J. S.
(2008). lfnA from Pseudomonas aeruginosa O12 and wbuX from Escherichia coli O145 Encode Membrane-Associated Proteins and Are Required for Expression of 2,6-Dideoxy-2-Acetamidino-L-Galactose in Lipopolysaccharide O Antigen. J. Bacteriol.
190: 1671-1679
[Abstract]
[Full Text]
-
Tarr, C. L., Nelson, A. M., Beutin, L., Olsen, K. E. P., Whittam, T. S.
(2008). Molecular Characterization Reveals Similar Virulence Gene Content in Unrelated Clonal Groups of Escherichia coli of Serogroup O174 (OX3). J. Bacteriol.
190: 1344-1349
[Abstract]
[Full Text]
-
Uhlich, G. A., Sinclair, J. R., Warren, N. G., Chmielecki, W. A., Fratamico, P.
(2008). Characterization of Shiga Toxin-Producing Escherichia coli Isolates Associated with Two Multistate Food-Borne Outbreaks That Occurred in 2006. Appl. Environ. Microbiol.
74: 1268-1272
[Abstract]
[Full Text]
-
Griener, T. P., Mulvey, G. L., Marcato, P., Armstrong, G. D.
(2007). Differential binding of Shiga toxin 2 to human and murine neutrophils. J Med Microbiol
56: 1423-1430
[Abstract]
[Full Text]
-
Brockmeyer, J., Bielaszewska, M., Fruth, A., Bonn, M. L., Mellmann, A., Humpf, H.-U., Karch, H.
(2007). Subtypes of the Plasmid-Encoded Serine Protease EspP in Shiga Toxin-Producing Escherichia coli: Distribution, Secretion, and Proteolytic Activity. Appl. Environ. Microbiol.
73: 6351-6359
[Abstract]
[Full Text]
-
Beutin, L., Miko, A., Krause, G., Pries, K., Haby, S., Steege, K., Albrecht, N.
(2007). Identification of Human-Pathogenic Strains of Shiga Toxin-Producing Escherichia coli from Food by a Combination of Serotyping and Molecular Typing of Shiga Toxin Genes. Appl. Environ. Microbiol.
73: 4769-4775
[Abstract]
[Full Text]
-
dos Santos, L. F., Goncalves, E. M., Vaz, T. M. I., Irino, K., Guth, B. E. C.
(2007). Distinct Pathotypes of O113 Escherichia coli Strains Isolated from Humans and Animals in Brazil. J. Clin. Microbiol.
45: 2028-2030
[Abstract]
[Full Text]
-
Vali, L., Hamouda, A., Hoyle, D. V., Pearce, M. C., Whitaker, L. H. R., Jenkins, C., Knight, H. I., Smith, A. W., Amyes, S. G. B.
(2007). Antibiotic resistance and molecular epidemiology of Escherichia coli O26, O103 and O145 shed by two cohorts of Scottish beef cattle. J Antimicrob Chemother
59: 403-410
[Abstract]
[Full Text]
-
Ito, K., Iida, M., Yamazaki, M., Moriya, K., Moroishi, S., Yatsuyanagi, J., Kurazono, T., Hiruta, N., Ratchtrachenchai, O.-A.
(2007). Intimin Types Determined by Heteroduplex Mobility Assay of Intimin Gene (eae)-Positive Escherichia coli Strains. J. Clin. Microbiol.
45: 1038-1041
[Abstract]
[Full Text]
-
Gyles, C. L.
(2007). Shiga toxin-producing Escherichia coli: An overview. J ANIM SCI
85: E45-E62
[Abstract]
[Full Text]
-
Werber, D., Behnke, S. C., Fruth, A., Merle, R., Menzler, S., Glaser, S., Kreienbrock, L., Prager, R., Tschape, H., Roggentin, P., Bockemuhl, J., Ammon, A.
(2007). Shiga Toxin-producing Escherichia coli Infection in Germany--Different Risk Factors for Different Age Groups. Am J Epidemiol
165: 425-434
[Abstract]
[Full Text]
-
Beutin, L., Strauch, E.
(2007). Identification of Sequence Diversity in the Escherichia coli fliC Genes Encoding Flagellar Types H8 and H40 and Its Use in Typing of Shiga Toxin-Producing E. coli O8, O22, O111, O174, and O179 Strains. J. Clin. Microbiol.
45: 333-339
[Abstract]
[Full Text]
-
Beutin, L., Wang, Q., Naumann, D., Han, W., Krause, G., Leomil, L., Wang, L., Feng, L.
(2007). Relationship between O-antigen subtypes, bacterial surface structures and O-antigen gene clusters in Escherichia coli O123 strains carrying genes for Shiga toxins and intimin. J Med Microbiol
56: 177-184
[Abstract]
[Full Text]
-
Guerra, B., Junker, E., Schroeter, A., Helmuth, R., Guth, B. E. C., Beutin, L.
(2006). Phenotypic and genotypic characterization of antimicrobial resistance in Escherichia coli O111 isolates. J Antimicrob Chemother
57: 1210-1214
[Abstract]
[Full Text]
-
Loukiadis, E., Kerouredan, M., Beutin, L., Oswald, E., Brugere, H.
(2006). Characterization of Shiga Toxin Gene (stx)-Positive and Intimin Gene (eae)-Positive Escherichia coli Isolates from Wastewater of Slaughterhouses in France.. Appl. Environ. Microbiol.
72: 3245-3251
[Abstract]
[Full Text]
-
Vaz, T. M. I., Irino, K., Nishimura, L. S., Cergole-Novella, M. C., Guth, B. E. C.
(2006). Genetic Heterogeneity of Shiga Toxin-Producing Escherichia coli Strains Isolated in Sao Paulo, Brazil, from 1976 through 2003, as Revealed by Pulsed-Field Gel Electrophoresis.. J. Clin. Microbiol.
44: 798-804
[Abstract]
[Full Text]
-
Sonntag, A.-K., Bielaszewska, M., Mellmann, A., Dierksen, N., Schierack, P., Wieler, L. H., Schmidt, M. A., Karch, H.
(2005). Shiga Toxin 2e-Producing Escherichia coli Isolates from Humans and Pigs Differ in Their Virulence Profiles and Interactions with Intestinal Epithelial Cells. Appl. Environ. Microbiol.
71: 8855-8863
[Abstract]
[Full Text]
-
Beutin, L., Kong, Q., Feng, L., Wang, Q., Krause, G., Leomil, L., Jin, Q., Wang, L.
(2005). Development of PCR Assays Targeting the Genes Involved in Synthesis and Assembly of the New Escherichia coli O174 and O177 O Antigens. J. Clin. Microbiol.
43: 5143-5149
[Abstract]
[Full Text]
-
Tozzoli, R., Caprioli, A., Morabito, S.
(2005). Detection of toxB, a Plasmid Virulence Gene of Escherichia coli O157, in Enterohemorrhagic and Enteropathogenic E. coli. J. Clin. Microbiol.
43: 4052-4056
[Abstract]
[Full Text]
-
Hornitzky, M. A., Mercieca, K., Bettelheim, K. A., Djordjevic, S. P.
(2005). Bovine Feces from Animals with Gastrointestinal Infections Are a Source of Serologically Diverse Atypical Enteropathogenic Escherichia coli and Shiga Toxin-Producing E. coli Strains That Commonly Possess Intimin. Appl. Environ. Microbiol.
71: 3405-3412
[Abstract]
[Full Text]
-
Sheng, H., Davis, M. A., Knecht, H. J., Hancock, D. D., Van Donkersgoed, J., Hovde, C. J.
(2005). Characterization of a Shiga Toxin-, Intimin-, and Enterotoxin Hemolysin-Producing Escherichia coli ONT:H25 Strain Commonly Isolated from Healthy Cattle. J. Clin. Microbiol.
43: 3213-3220
[Abstract]
[Full Text]
-
McLean, C., Bettelheim, K. A, Kuzevski, A., Falconer, L., Djordjevic, S. P
(2005). Isolation of Escherichia coli O5 : H-, possessing genes for Shiga toxin 1, intimin-{beta} and enterohaemolysin, from an intestinal biopsy from an adult case of bloody diarrhoea: evidence for two distinct O5 : H- pathotypes. J Med Microbiol
54: 605-607
[Abstract]
[Full Text]
-
Ishii, Y., Kimura, S., Alba, J., Shiroto, K., Otsuka, M., Hashizume, N., Tamura, K., Yamaguchi, K.
(2005). Extended-Spectrum {beta}-Lactamase-Producing Shiga Toxin Gene (stx1)-Positive Escherichia coli O26:H11: a New Concern. J. Clin. Microbiol.
43: 1072-1075
[Abstract]
[Full Text]
-
Creuzburg, K., Kohler, B., Hempel, H., Schreier, P., Jacobs, E., Schmidt, H.
(2005). Genetic structure and chromosomal integration site of the cryptic prophage CP-1639 encoding Shiga toxin 1. Microbiology
151: 941-950
[Abstract]
[Full Text]
-
Beutin, L., Tao, J., Feng, L., Krause, G., Zimmermann, S., Gleier, K., Xia, Q., Wang, L.
(2005). Sequence Analysis of the Escherichia coli O15 Antigen Gene Cluster and Development of a PCR Assay for Rapid Detection of Intestinal and Extraintestinal Pathogenic E. coli O15 Strains. J. Clin. Microbiol.
43: 703-710
[Abstract]
[Full Text]
-
Feng, L., Senchenkova, S. N., Tao, J., Shashkov, A. S., Liu, B., Shevelev, S. D., Reeves, P. R., Xu, J., Knirel, Y. A., Wang, L.
(2005). Structural and Genetic Characterization of Enterohemorrhagic Escherichia coli O145 O Antigen and Development of an O145 Serogroup-Specific PCR Assay. J. Bacteriol.
187: 758-764
[Abstract]
[Full Text]
-
Strauch, E., Schaudinn, C., Beutin, L.
(2004). First-Time Isolation and Characterization of a Bacteriophage Encoding the Shiga Toxin 2c Variant, Which Is Globally Spread in Strains of Escherichia coli O157. Infect. Immun.
72: 7030-7039
[Abstract]
[Full Text]
-
Mora, A., Blanco, M., Blanco, J. E., Alonso, M. P., Dhabi, G., Thomson-Carter, F., Usera, M. A., Bartolome, R., Prats, G., Blanco, J.
(2004). Phage Types and Genotypes of Shiga Toxin-Producing Escherichia coli O157:H7 Isolates from Humans and Animals in Spain: Identification and Characterization of Two Predominating Phage Types (PT2 and PT8). J. Clin. Microbiol.
42: 4007-4015
[Abstract]
[Full Text]
-
Djordjevic, S. P., Ramachandran, V., Bettelheim, K. A., Vanselow, B. A., Holst, P., Bailey, G., Hornitzky, M. A.
(2004). Serotypes and Virulence Gene Profiles of Shiga Toxin-Producing Escherichia coli Strains Isolated from Feces of Pasture-Fed and Lot-Fed Sheep. Appl. Environ. Microbiol.
70: 3910-3917
[Abstract]
[Full Text]