Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Han, X. Y. Articles by Fainstein, V. Search for Related Content PubMed PubMed Citation Articles by Han, X. Y. Articles by Fainstein, V.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, April 2004, p. 1590-1595, Vol. 42, No. 4
0095-1137/04/$08.00+0     DOI: 10.1128/JCM.42.4.1590-1595.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Endocarditis with Ruptured Cerebral Aneurysm Caused by Cardiobacterium valvarum sp. nov.

Xiang Y. Han,^1* Michelle C. Meltzer,¹ Joan T. Woods,¹ and Victor Fainstein²

Section of Clinical Microbiology, The University of Texas M. D. Anderson Cancer Center,¹ Section of Infectious Diseases, The Methodist Hospital, Houston, Texas 77030²

Received 6 August 2003/ Returned for modification 10 September 2003/ Accepted 21 December 2003

Top Abstract Introduction Case reports Materials and Methods Results Discussion Addendum in proof References

 
A fastidious gram-negative bacterium was isolated from the blood of a 37-year-old man who had insidious endocarditis with a sudden rupture of a cerebral aneurysm. Characterization of the organism through phylogenetic and phenotypic analyses revealed a novel species of Cardiobacterium, for which the name Cardiobacterium valvarum sp. nov. is proposed. C. valvarum will supplement the current sole species Cardiobacterium hominis, a known cause of endocarditis. Surgeries and antibiotic treatment cured the patient's infection and associated complications. During cardiac surgery, a congenital bicuspid aortic valve was found to be the predisposing factor for his endocarditis.

Top Abstract Introduction Case reports Materials and Methods Results Discussion Addendum in proof References

 
The genus Cardiobacterium, with its sole species Cardiobacterium hominis, was established in 1964 for a group of fastidious, pleomorphic, gram-negative bacteria that were isolated from patients with endocarditis (17). So far, additional species have not been reported, although they have been implied (M. Kilian, unpublished data). We report here the isolation of a Cardiobacterium species from a patient who suffered from endocarditis with a ruptured cerebral aneurysm. Characterization of the organism by phylogenetic and phenotypic methods led to our proposal of a novel species, Cardiobacterium valvarum sp. nov.

Top Abstract Introduction Case reports Materials and Methods Results Discussion Addendum in proof References

 
A 37-year-old previously healthy man was brought by coworkers to the emergency department due to severe headache, nausea, vomiting, and worsening disorientation for 2 h. On physical examination, the patient was alert and oriented to person but was aphasic. His temperature was normal and his blood pressure was 133/46 mm Hg. Auscultation revealed a grade 3 of 6 diastolic heart murmur radiating to the carotid arteries without S3 sound or signs of heart failure. A mild left-sided facial droop was also noted; otherwise, the neurological examination was normal. An echocardiography revealed severe aortic valve regurgitation with a 1.1- by 1.3-cm vegetation on the valve. A magnetic resonance imaging study of the brain revealed subarachnoid hemorrhage, likely due to a ruptured aneurysm. The laboratory examination showed anemia (hemoglobin, 12.9 g/dl) and leukocytosis (14,000 leukocytes/µl) with a left shift (84% neutrophils). These findings led to a presumptive diagnosis of endocarditis with ruptured cerebral aneurysm. Blood was drawn for cultures. The patient was transferred to another nearby hospital for surgical interventions and further care.

Empirical therapy with vancomycin, ceftazidime, and gentamicin was initiated, along with other medications for the neurological and cardiovascular manifestations. The next day, a craniotomy was performed to clip the aneurysm that was located at the M2 branch of the left middle cerebral artery. The patient's aphasia improved, and he related a 2-week-earlier history of a tooth cleaning and the correction of an irregular bicuspid molar without antibiotic prophylaxis. Two weeks after the craniotomy, however, an arteriography revealed the recurrence of the aneurysm and thrombosis of the vessel, which necessitated repeated clip ligation and trapping of the lesion. Another arteriography 1 week later showed complete obliteration of the aneurysm.

In the meantime, a gram-negative bacterium (strain MDA3079) was isolated from the two bottles of aerobic blood culture that were drawn in the emergency department after an incubation of 3 days (there was no growth from Isolator tubes for 4 days, and no anaerobic cultures were performed). The organism was shown by Etest to be susceptible to amikacin (MIC, 1.5 µg/ml), cefepime (MIC, 0.38 µg/ml), ceftazidime (MIC, 0.064 µg/ml), ciprofloxacin (MIC, 0.016 µg/ml), imipenem (MIC, 0.032 µg/ml), ticarcillin-clavulanate (MIC, 0.03 µg/ml), and trimethoprim-sulfamethoxazole (MIC, 0.03 µg/ml). Fastidious growth of the organism prompted a sequencing analysis of the 16S rDNA for identification, along with the usual phenotypic studies, which were more time-consuming. A species of Cardiobacterium resembling C. hominis was suggested by the sequencing analysis. Thus, antibiotic therapy was switched to piperacillin and tazobactam, which were generally considered to be the drugs of choice (18), and was continued for 6 weeks intravenously.

After the aneurysm and infection had been treated (23 days after the onset), the patient underwent aortic valve replacement surgery. During the surgery, a congenital bicuspid aortic valve (CBAV), which had been severely damaged, was noted. An exploration of the mitral valve revealed mild prolapse, of which the patient had a history. Histological examination of the aortic valve and root showed acute and chronic inflammation, granulation tissue, fibrous thickening, calcification, and a thrombus. Forty-one days after onset, the patient was discharged from the hospital. At a 7-month follow-up, a cerebral arteriography revealed no evidence of aneurysm. His blood pressure was 104/58 mm Hg, and his pulse rate was 79 beats/min. His speech essentially returned to normal. The patient returned to work at 1 year postinfection. In view of his CBAV, his family was encouraged to undergo cardiac screening.

Top Abstract Introduction Case reports Materials and Methods Results Discussion Addendum in proof References

 
Bacterial cultures and strains. Blood cultures were performed with a set of Isolator tubes (Wampole, Cranbury, N.J.) and Bactec 9240 Plus Aerobic/F bottles with resin (BD Diagnostic Systems, Sparks, Md.). The Isolator tubes were incubated for 4 days, and the Bactec bottles were incubated for 7 days under continuous automated monitoring for bacterial growth in the medium. Anaerobic cultures were not routinely set up in our laboratory at The University of Texas M. D. Anderson Cancer Center, a 500-bed tertiary care cancer hospital, where approximately 30,000 blood cultures were performed. All subcultures were plated on blood agar and chocolate agar (BBL, Becton Dickinson Microbiology Systems, Cockeysville, Md.) and incubated aerobically at 35°C with 5% CO₂. The strain isolated from our patient, MDA3079, and the C. hominis type strain ATCC 15826 were used for side-by-side studies. In addition, seven other C. hominis strains, including clinical strain NYU-L48789 (13) and American Type Culture Collection (ATCC) strains 14900, 15827, and 29308 to 29311, were also sequenced and examined for morphology. Of all nine strains studied, ATCC 15827 was the only strain isolated from a throat culture; all others were isolated from blood (1, 13).

Sequencing of the 16S rDNA and phylogenetic analysis. The amplification of 16S ribosomal DNA (rDNA) by PCR and subsequent sequencing of the amplicon were performed as described previously (7). Briefly, extracted genomic DNA was amplified by a set of highly conserved (universal) bacterial primers: 5' TGCCAGCAGCCGCGGTAATAC 3' and 5' CGCTCGTTGCGGGACTTAACC 3' (positions 515 to 1,107 of Escherichia coli J01859). Sequencing of the 593-bp amplicon was performed by the dye terminator method in an ABI 377 sequencer (Applied Biosystems, Foster City, Calif.). All strains were sequenced to this length. In addition, strain MDA3079 was further amplified to 1,490 bp (nearly full length) with two primers: 5' GCGTGCTTAACACATGCAAGTC 3' and 5' AGGAGGTGATCCAACCGCA 3' (positions 42 to 1,539 of E. coli J01859). The strain was sequenced with these and a few sets of internal primers.

The phylogenetic analysis was performed by using the Drawtree program of PHYLIP (http://www.molgen.mpg.de) and Clustal W multiple alignments (http://www.ebi.ac.uk/clustalw) (6).

Phenotypic characterization. Biochemical tests were performed in conventional tube media (BBL, Becton Dickinson Microbiology Systems) and miniaturized API 20NE (BioMerieux, Marcy-l'Etoile, France). The tube media were oxidative-fermentative base media, and the choice of substrates is shown in Table 1. Cell wall fatty acids were analyzed in a commercial laboratory by gas liquid chromatography and Sherlock version 4.0 software (Microbial ID, Inc., Newark, Del.). The antibiotic susceptibility tests were performed with Etest (Biodisk, Solna, Sweden) on nonstandardized blood Mueller-Hinton agar with 48 h of incubation and were interpreted according to the breakpoints set for Pseudomonas aeruginosa and non-Enterobacteriaceae by the National Committee for Clinical Laboratory Standards (14).

View this table: [in this window] [in a new window]

TABLE 1. Phenotypic characteristics of C. hominis and MDA3079a

Nucleotide sequence accession number. The 16S rDNA sequence of MDA3079 is deposited under GenBank accession number AF506987.

Top Abstract Introduction Case reports Materials and Methods Results Discussion Addendum in proof References

 
16S rDNA sequencing and phylogenetic analysis. The 16S rDNA of strain MDA3079 was further sequenced to 1,493 bp. A query to the GenBank database revealed a 96.4% (1,379 of 1,430 bp) match with the 16S rDNA of C. hominis ATCC 15826^T (GenBank accession number M35014) (2), suggesting that MDA3079 is closely related to but different from C. hominis. MDA3079 matched best (99.3%, or 1,429 of 1,439 bp) with a previously unnamed Cardiobacterium sp., strain B (AF144696), that was isolated from a dental plaque in Denmark in the late 1980s, but the strain was unfortunately lost (M. Kilian and B. Pastor, personal communication). The matches with two other genera of the family Cardiobacteriaceae (2), Suttonella indologenes (M35015) and Dichelobacter nodosus (M35016), were at 92%. A phylogenetic analysis of these organisms is shown in Fig. 1. Evidently, MDA3079 shares a common root with C. hominis; however, significant sequence variations suggest the probability of a new species. For the seven other C. hominis strains (six ATCC strains and NYU-L48789) analyzed, the sequences (to 593 bp) were all identical to the type strain, thus confirming species identification of these organisms at the 16S rDNA level and demonstrating intraspecies sequence homogeneity.

View larger version (17K): [in this window] [in a new window]

FIG. 1. (A) Phylogenetic tree of the family Cardiobacteriaceae, with P. aeruginosa as the out-group organism; (B) representative significant mismatches among the Cardiobacterium spp., with listed positions referring to those for C. hominis.

Phenotypic characterization. The phenotypic features of MDA3079 were compared with those of C. hominis (Table 1). Both organisms were fastidious and showed better growth on sheep blood agar than on chocolate agar. MDA3079 grew more slowly, and the colonies were pinpoint (0.2 mm) at 48 h and became visible (0.6 mm) at 72 h but hardly reached 1 mm after extended incubation. In contrast, the colonies of C. hominis were readily visible (0.8 mm) at 48 h and reached 2.2 mm at 96 h. Under a dissecting microscope, the colonies of both organisms were observed to be round, elevated, opaque, smooth, and glistening. MDA3079 was nonhemolytic on sheep blood agar, whereas C. hominis had a tint of alpha-hemolysis, better shown after 3 to 4 days of incubation. This feature was consistent among all eight strains of C. hominis examined. Both organisms pit chocolate agar but not blood agar. They were gram-negative rods readily decolorized by acetone-alcohol. When first isolated from our patient, MDA3079 exhibited readily noticeable swollen ends (teardrops); however, this feature became occasional to rare after it was subcultured and stored at –80°C. The swollen ends were rarely observed for the C. hominis strains. The size and shape of both organisms varied considerably depending on the culture medium (Fig. 2; Table 1). On blood agar, the favored growth medium for both organisms, MDA3079 was a fairly large, regular bacillus (1 by 2 to 4 mm), while C. hominis was a short rod (1 by 1.5 to 3 µm). On chocolate agar, however, MDA3079 became a short rod (1 by 1.5 to 3 µm), whereas C. hominis was long and thin (0.7 by 2 to 4 µm).

View larger version (85K): [in this window] [in a new window]

FIG. 2. Gram stain morphology (magnification, x1000). MDA3079 was grown on blood agar (organism sizes, 1 by 2 to 4 µm) (A) and chocolate agar (organism sizes, 1 by 1.5 to 3 µm) (B). C. hominis was grown on blood agar (organism sizes, 1 by 1.5 to 3 µm) (C) and chocolate agar (organism sizes, 0.7 by 2 to 4 µm) (D).

Conventional biochemical tests (Table 1) revealed that MDA3079, like C. hominis, was positive for indole, cytochrome oxidase, and hydrogen sulfite production but negative for catalase production, urea hydrolysis, esculin hydrolysis, and nitrate reduction. Of note was that the spot indole reaction for MDA3079 was strong and immediate (bright green), in contrast to the weaker and slower reaction for C. hominis (dull blue to green for all eight strains examined). Both organisms utilized dextrose, fructose, sorbitol, and mannose. However, unlike C. hominis, MDA3079 did not utilize sucrose, maltose, or mannitol. On a miniaturized API 20NE test, neither organism reacted as described above (code 2000004), resulting in misidentifications as Pasteurella multocida (95.7% confidence). Thus, API 20NE was unsuitable as a test for these fastidious organisms.

Analysis of cell wall fatty acids showed that MDA3079 had an overall similarity index of 0.742 (of 1.00) with C. hominis (Table 1), suggesting a good match. However, MDA3079 exhibited some noticeable differences in the major peaks, such as with carbons with 16:0 and 18:17c chain lengths. Therefore, while MDA3079 was qualitatively and quantitatively consistent with members of the genus Cardiobacterium, novel species status could not be confidently established by this method. Future analysis of additional strains may be needed in this regard.

Together, the above phenotypic characteristics suggest that MDA3079 differs considerably from C. hominis despite many similarities. These different features should separate the two organisms at the phenotype level. The validity of these results was supported by the fact that the phenotype and biochemical reaction of the C. hominis strains were essentially identical to those that were described in the literature (9, 20).

Top Abstract Introduction Case reports Materials and Methods Results Discussion Addendum in proof References

 
In view of the phylogenetic distance and phenotypic differences between MDA3079 and C. hominis (the sole species in the genus), the previous isolation of a similar Cardiobacterium sp., strain B, and the medical significance of this strain, we propose species status for MDA3079, C. valvarum sp. nov. Despite efforts to obtain or identify additional C. valvarum strains, including 16S rDNA sequencing analysis of the seven other C. hominis strains, no additional C. valvarum strains have so far been found; hopefully, this study will raise awareness of this rare but dangerous organism. This novel species will also add to the diversity of the genus Cardiobacterium.

Description of C. valvarum sp. nov. C. valvarum (val.va'rum. M.L. fem. n. valvarum, folding doors, referring to the heart valve) is a fastidious gram-negative bacillus. Its preferred culture medium is sheep blood agar, and visible colonies appear after an incubation period of 3 days. The colonies, observed under a dissecting microscope, are round, elevated, opaque, smooth, and glistening. However, the colonies hardly reach 1 mm after extended incubation. Thus, C. valvarum is more fastidious than C. hominis, whose colonies appear after a 2-day incubation and reach a diameter of 2.2 mm after 4 days. Microscopically, C. valvarum appears readily decolorized by acetone alcohol, and the cellular morphology varies depending on culture medium. When grown on blood agar, it is a fairly large regular bacillus, measuring 1 by 2 to 4 µm. On chocolate agar, it is smaller and pleomorphic. C. valvarum is positive for the production of indole (strong spot indole reaction), cytochrome oxidase, and hydrogen sulfite but negative for catalase production, urea hydrolysis, esculin hydrolysis, and nitrate reduction. It utilizes dextrose, fructose, sorbitol, and mannose, like C. hominis, but unlike C. hominis does not utilize maltose, sucrose, or mannitol. The type strain is MDA3079, which is deposited as ATCC BAA-694, NCTC 13294, or CCUG 48245. It was isolated in 2001 from the blood of a 37-year-old man with endocarditis. C. valvarum is probably an oral organism, like C. hominis, in view of (i) the origin of Cardiobacterium sp. strain B from a dental plaque, (ii) the recent detection of strain B in an oral lesion (15), and (iii) the history of dental work of our patient.

The clinical features of the patient's case illustrate a few interesting points. The endocarditis was afebrile and insidious, so that the patient did not seek early medical attention until the rupture of a cerebral aneurysm. Among all the 50 or so patients reported to have C. hominis endocarditis, approximately one-third were also afebrile (18, 20). In view of the previously sole species status of C. hominis and the many overlapping phenotypic features of C. hominis and C. valvarum, we think some of those afebrile cases might have been caused by C. valvarum. However, the lack of early recognition of C. valvarum attests to its rarity (more rare than C. hominis). Cerebral aneurysm occurs as a rare complication of bacterial endocarditis, and to our knowledge, there have been only four reported cases of cerebral aneurysm with C. hominis endocarditis (10, 12, 13, 16). In one of the cases (13; J. Lynfield, personal communication), the eventual diagnosis of indolent endocarditis was initially unsuspected for the 47-year-old man who presented with headache and aphasia and had a 30-year history of aortic valvotomy due to CBAV. His mild leukocytosis prompted a blood culture, which revealed C. hominis (strain NYU-L48789), which was identified initially by biochemical tests and later by our 16S rDNA sequencing analysis.

CBAV was a probable predisposing factor for our patient to contract the endocarditis. Occurring in 1 to 2% of the general population, CBAV is one of the most frequent congenital cardiac anomalies (19). Serious complications, such as aortic stenosis, regurgitation, and infection, develop in approximately one-third of patients with CBAV (19). In two recent studies of infective endocarditis of native valves, patients with CBAV accounted for 12.3 and 16.7% of all patients (3, 11). Therefore, we estimate that the presence of this congenital anomaly incurs at least a 10- to 20-fold-higher relative risk for endocarditis. In addition, in the Lamas and Eykyn study (11), all of the 50 patients with CBAV endocarditis were men with a mean age of 39 years. Our patient, being a 37-year-old man, fits these general characteristics well. The clinical and pathophysiological implications of CBAV have been reviewed previously (5). The majority of CBAVs are nonobstructive at birth; however, with time, wear and tear cause fibrosis, stiffness, obstruction, and calcification in a few of these valves (15). Sooner or later depending on the initial severity of the deformity, but usually by age 39, as suggested by the mean age of these patients, the damage becomes severe enough to be an infection-prone niche. It is unexplained, however, why such endocarditis affects men far more frequently than women. The occurrence of CBAV has a high rate of familial clustering, with some evidence suggestive of inheritance through autosomal dominance with reduced penetrance (1a, 4, 8). Men and women are equally affected in the familial cases, whereas the male-to-female ratio is 1.8:1 in nonfamilial cases (8).

Top Abstract Introduction Case reports Materials and Methods Results Discussion Addendum in proof References

 
We have identified three oral strains of C. valvarum in the CCUG collection, all of which are being characterized.

 
This work was supported in part by a University Cancer Foundation grant to X.Y.H. from The University of Texas M. D. Anderson Cancer Center and by National Institutes of Health grant CA16672 for the Sequencing Core Facility.

We thank the medical and surgical teams for taking care of the patient, Hans G. Trueper for assistance with the Latin language, Jeff Tarrand for helpful discussion, Kenneth Inglima and Joshua Lynfield for providing clinical strain NYU-L48789, and Jane Tang for providing six ATCC C. hominis strains.

 
* Corresponding author. Mailing address: Section of Clinical Microbiology, The University of Texas M. D. Anderson Cancer Center, Unit 84, 1515 Holcombe Blvd., Houston, TX 77030. Phone: (713) 792-3515. Fax: (713) 792-0936. E-mail: xhan{at}mdanderson.org.

Top Abstract Introduction Case reports Materials and Methods Results Discussion Addendum in proof References

 

1
1. American Type Culture Collection. 2004. Catalog. [Online.] American Type Culture Collection, Manassas, Va. http://www.atcc.org/SearchCatalogs.
1
2. Clementi, M., L. Notari, A. Borghi, and R. Tenconi. 1996. Familial congenital bicuspid aortic valve: a disorder of uncertain inheritance. Am. J. Med. Genet. 62:336-338.[CrossRef][Medline]
2
3. Dewhirst, F. E., B. J. Paster, S. La Fontaine, and J. I. Rood. 1990. Transfer of Kingella indologenes (Snell and Lapage 1976) to the genus Suttonella gen. nov. as Suttonella indologenes comb. nov.; transfer of Bacteroides nodosus (Beveridge 1941) to the genus Dichelobacter gen. nov. as Dichelobacter nodosus comb. nov.; and assignment of the genera Cardiobacterium, Dichelobacter, and Suttonella to Cardiobacteriaceae fam. nov. in the gamma division of Proteobacteria on the basis of 16S rRNA sequence comparisons. Int. J. Syst. Bacteriol. 40:426-433.[Abstract/Free Full Text]
3
4. Dyson, C., R. A. Barnes, and G. A. Harrison. 1999. Infective endocarditis: an epidemiological review of 128 episodes. J. Infect. 38:87-93.[CrossRef][Medline]
4
5. Emanuel, R., R. O. Withers, K. O'Brien, P. Ross, and O. Feizi. 1978. Congenital bicuspid aortic valves. Clinicogenetic study of 41 families. Br. Heart J. 40:1402-1407.[Abstract/Free Full Text]
5
6. Fedak, P. W., S. Verma, T. E. David, R. L. Leask, R. D. Weisel, and J. Butany. 2002. Clinical and pathophysiological implications of a bicuspid aortic vavle. Circulation 106:900-904.[Free Full Text]
6
7. Felsenstein, J. 1993. PHYLIP (Phylogeny Inference Package) version 3.5c. Department of Genetics, University of Washington, Seattle.
7
8. Han, X. Y., A. S. Pham, J. J. Tarrand, P. K. Sood, and R. Luthra. 2002. Rapid and accurate identification of mycobacteria by sequencing hypervariable regions of the 16S ribosomal RNA gene. Am. J. Clin. Pathol. 118:796-801.[Abstract/Free Full Text]
8
9. Huntington, K., A. G. Hunter, and K. L. Chan. 1997. A prospective study to assess the frequency of familial clustering of congenital bicuspid aortic valve. J. Am. Coll. Cardiol. 30:1809-1812.[Abstract]
9
10. Koneman, E. W., S. D. Allen, W. M. Janda, P. C. Schreckenberger, and W. C. Winn, Jr. 1997. Color atlas and textbook of diagnostic microbiology, 5th ed., p. 395-472. J. B. Lippincott Co., Philadelphia, Pa.
10
11. Laguna, J., B. M. Derby, and R. Chase. 1975. Cardiobacterium hominis endocarditis with cerebral mycotic aneurysm. Arch. Neurol. 32:438-439.[Medline]
11
12. Lamas, C. C., and S. J. Eykyn. 2000. Bicuspid aortic valve—a silent danger: analysis of 50 cases of infective endocarditis. Clin. Infect. Dis. 30:336-341.[CrossRef][Medline]
12
13. Lin, B. H., and P. T. Vieco. 1995. Intracranial mycotic aneurysm in a patient with endocarditis caused by Cardiobacterium hominis. Can. Assoc. Radiol. J. 46:40-42.[Medline]
13
14. Lynfield, J., and P. K. Nelson. 2002. Mycotic aneurysm. N. Engl. J. Med. 347:2030.[Free Full Text]
14
15. National Committee for Clinical Laboratory Standards. 2000. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard M7-A5, 5th ed. MIC testing supplemental tables. National Committee for Clinical Laboratory Standards, Wayne, Pa.
15
16. Paster, B. J., W. A. Falkler, Jr., C. O. Enwonwu, E. O. Idigbe, K. O. Savage, V. A. Levanos, M. A. Tamer, R. L. Ericson, C. N. Lau, and F. E. Dewhirst. 2002. Prevalent bacterial species and novel phylotypes in advanced noma lesions. J. Clin. Microbiol. 40:2187-2191.[Abstract/Free Full Text]
16
17. Perdue, G. D., E. F. Dorney, and F. Ferrier. 1968. Embolomycotic aneurysm associated with bacterial endocarditis due to Cardiobacterium hominis. Am. Surg. 34:901-904.[Medline]
17
18. Slotnick, I. J., and M. Dougherty. 1964. Further characterization of an unclassified group of bacteria causing endocarditis in man: Cardiobacterium hominis gen. et sp. n. Antonie Leeuwenhoek 30:261-272.
18
19. Steinberg, J. P., and C. Del Rio. 2000. Other gram-negative bacilli, p. 2459-2474. In G. L. Mandell, J. E. Bennett, and R. Dolin (ed.), Principles and practice of infectious diseases, 5th ed. Churchill Livingstone, Inc., Philadelphia, Pa.
19
20. Ward, C. 2000. Clinical significance of the bicuspid aortic valve. Heart 83:81-85.[Free Full Text]
20
21. Wormser, G. P., and E. J. Bottone. 1983. Cardiobacterium hominis: review of microbiologic and clinical features. Rev. Infect. Dis. 5:680-691.[Medline]

---

Journal of Clinical Microbiology, April 2004, p. 1590-1595, Vol. 42, No. 4
0095-1137/04/$08.00+0     DOI: 10.1128/JCM.42.4.1590-1595.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Geissdorfer, W., Tandler, R., Schlundt, C., Weyand, M., Daniel, W. G., Schoerner, C. (2007). Fatal Bioprosthetic Aortic Valve Endocarditis Due to Cardiobacterium valvarum. J. Clin. Microbiol. 45: 2324-2326 [Abstract] [Full Text]  
• Gatselis, N., Malli, E., Papadamou, G., Petinaki, E., Dalekos, G. N. (2006). Direct Detection of Cardiobacterium hominis in Serum from a Patient with Infective Endocarditis by Broad-Range Bacterial PCR. J. Clin. Microbiol. 44: 669-672 [Abstract] [Full Text]  
• Foster, G., Malnick, H., Lawson, P. A., Kirkwood, J., MacGregor, S. K., Collins, M. D. (2005). Suttonella ornithocola sp. nov., from birds of the tit families, and emended description of the genus Suttonella. Int. J. Syst. Evol. Microbiol. 55: 2269-2272 [Abstract] [Full Text]  
• Han, X. (2005). Cardiobacterium valvarum Endocarditis. ANN INTERN MED 143: 614-614 [Full Text]  
• Han, X. Y., Falsen, E. (2005). Characterization of Oral Strains of Cardiobacterium valvarum and Emended Description of the Organism. J. Clin. Microbiol. 43: 2370-2374 [Abstract] [Full Text]  
• (2004). Validation of publication of new names and new combinations previously effectively published outside the IJSEM. Int. J. Syst. Evol. Microbiol. 54: 1425-1426 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Han, X. Y. Articles by Fainstein, V. Search for Related Content PubMed PubMed Citation Articles by Han, X. Y. Articles by Fainstein, V.