This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gee, J. E.
Right arrow Articles by Popovic, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gee, J. E.
Right arrow Articles by Popovic, T.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, August 2004, p. 3649-3654, Vol. 42, No. 8
0095-1137/04/$08.00+0     DOI: 10.1128/JCM.42.8.3649-3654.2004

Use of 16S rRNA Gene Sequencing for Rapid Confirmatory Identification of Brucella Isolates

Jay E. Gee,* Barun K. De, Paul N. Levett,{dagger} Anne M. Whitney, Ryan T. Novak, and Tanja Popovic

Meningitis and Special Pathogens Branch, Division of Bacterial and Mycotic Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia 30333

Received 2 January 2004/ Returned for modification 22 February 2004/ Accepted 24 April 2004


arrow
ABSTRACT
 
Members of the genus Brucella are categorized as biothreat agents and pose a hazard for both humans and animals. Current identification methods rely on biochemical tests that may require up to 7 days for results. We sequenced the 16S rRNA genes of 65 Brucella strains along with 17 related strains likely to present a differential diagnostic challenge. All Brucella 16S rRNA gene sequences were determined to be identical and were clearly different from the 17 related strains, suggesting that 16S rRNA gene sequencing is a reliable tool for rapid genus-level identification of Brucella spp. and their differentiation from closely related organisms.


arrow
INTRODUCTION
 
Brucella spp., the causative agents of brucellosis, are pathogenic to a variety of domesticated and wild animals. The genus Brucella is comprised of gram-negative, facultative, intracellular pathogens (1). Phenotypic characteristics, antigenic variation, and prevalence of infection in different animal hosts have resulted in the initial recognition of six species: B. abortus (cattle), B. melitensis (goats/sheep), B. suis (swine), B. canis (dogs), B. ovis (rams), and B. neotomae (desert rats) (13, 27). Recently two Brucella strains from different marine mammals have been reported (7, 11, 22), and the names B. pinnipediae (seal/otter) and B. cetaceae (porpoise/whale) have been proposed (12). DNA hybridization analyses indicate a high level of homology among the brucellae, suggesting that the genus Brucella may comprise only one species with several biovars (40).

Brucellosis impacts public health and agricultural economies worldwide because of its high infectivity rate (13). Brucella spp. have also long been considered a potential biological weapon (20), and currently, with the renewed threat of biological warfare and agricultural terrorism, B. melitensis, B. suis, and B. abortus are listed as category B biothreat agents by the Centers for Disease Control and Prevention Strategic Planning Group (34).

Infections in humans generally result from (i) transmission via the gastrointestinal route by the consumption of unpasteurized diary products (18, 32) and contaminated meat (25), (ii) airborne transmission in animal husbandry by inhaling dust contaminated by aborted tissues (23), and (iii) transmission caused by laboratory-associated exposure to aerosols (26). In the event of a bioterror attack, the preferred method of dissemination would most likely be via aerosol (3, 20, 34).

Because of the limited availability of animal vaccines, cost of animal inoculations, a lack of vaccines for human use (13, 37), and its low infectious dose for humans, human brucellosis is endemic in many parts of the world, including the Mediterranean region, Latin America, Asia, and Africa. The reported incidence varies from <0.01 to >200 per 100,000 population (13). Human brucellosis is rare in the United States, with approximately 100 human cases reported per year, mostly caused by consumption of unpasteurized diary products and, to a lesser degree, occupational exposure (10, 38).

The rapidity with which a laboratory diagnosis can be obtained is an important component of every outbreak investigation, because knowledge about the causative agent plays a pivotal role in implementing appropriate public health decisions in a timely manner (21, 34). At present, diagnosis of human brucellosis depends primarily on isolation of Brucella spp. from blood (43), followed by performing a set of bacteriological tests that allows for reliable identification to the subspecies (biotype) level but that requires up to 7 days for completion (1, 42). Another diagnostic option is the use of serologic assays; however, the specificity of these tests is inconsistent because of cross-reactivity with bacteria closely related to the genus Brucella (29).

Extensive efforts have been expended on the development of molecular diagnostic assays based on amplification of different genomic targets by the PCR for the identification of Brucella spp., as recently reviewed by Bricker (6). Although these molecular approaches appeared to be faster and more sensitive than traditional bacteriological tests, they are not considered to be confirmatory tests due to limited specificity (8, 9, 14). Recently a multiplex system has been developed that is sensitive for Brucella spp. and is able to differentiate between B. melitensis and B. abortus (33). However, discrepant results were observed with some B. abortus isolates. So far, none of these assays has been accepted for common use in diagnostic laboratories.

In collaboration with the Association of Public Health Laboratories, the Centers for Disease Control and Prevention Laboratory Response Network has developed standard algorithms based on traditional bacteriological tests (1) for the identification of Brucella spp. by Laboratory Response Network laboratories. Our current efforts are aimed at developing and validating more rapid methods that will allow confirmatory identification of Brucella spp. from cultures and, subsequently, directly in clinical specimen samples.

We chose to evaluate 16S rRNA gene sequencing to determine its utility for confirmatory identification of Brucella spp. The advantage of this method is that results can be obtained within 1 day as compared to 7 days by traditional microbiological testing. Previous work on other bacteria has indicated that differences in 16S rRNA gene sequences may be useful for subtyping or for the differentiation of virulent subtypes from nonvirulent subtypes (30, 36). Low variability in the 16S rRNA locus has been noted as an impediment in using 16S rRNA gene sequencing to discriminate at the species level (41); recent studies of other biothreat select agents have indicated that even subtle differences in the 16S rRNA gene sequence may be used for differentiating and identifying closely related species, which are often cross-reactive in biochemical identification systems commonly used in diagnostic laboratories (19, 35). In this study, we have primarily focused on the applicability of 16S rRNA gene sequencing as a rapid confirmatory identification tool and consequently have sequenced the near-full-length 16S rRNA genes of a reference set of Brucella isolates that represent the species commonly encountered in animal and human infections. In addition, we sequenced 17 closely related diagnostically challenging strains.


arrow
MATERIALS AND METHODS
 
Bacterial strains. In this study, 65 Brucella strains (representing six species) from a collection of over 600 were selected to represent temporal, geographic, and source diversity (Table 1). A panel of 17 related strains likely to present a differential diagnostic challenge was also selected for comparison (Table 2). All strains were stored at –70°C in defibrinated rabbit blood until testing. Identification of all strains was carried out by standard microbiological procedures as described previously (42).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Designations of 65 Brucella isolates analyzed in this study


View this table:
[in this window]
[in a new window]
 
TABLE 2. Designations of strains closely related to Brucella species

Amplification of 16S rRNA genes. Bacteria were grown by plating one loop (1 µl) of stock cell suspension on Trypticase soy agar with 5% defibrinated sheep blood agar (BBL Microbiology Systems, Cockeysville, Md.) and incubating the bacteria aerobically for 1 to 2 days at 37°C with 5% CO2. To yield a DNA template, a single colony was suspended in 200 µl of 10 mM Tris (pH 8.0) in a 1.5-ml Millipore 0.22-µm-pore-diameter filter unit (Millipore, Bedford, Mass.) and heated at 95°C for 30 min. The filter unit was then centrifuged at 6,000 x g for 5 min to recover the filtrate containing the DNA template. Each final PCR (100 µl) contained 5 U of Expand DNA polymerase (Roche, Indianapolis, Ind.), 2 µl of DNA template, 10 mM Tris-HCl (pH 8.0), 50 mM KCl, 1.5 mM MgCl2, 200 µM (each) dATP, dCTP, dGTP, and dTTP, and 0.4 µM each of eubacterial primers F8 (5' AGTTTGATCCTGGCTCAG 3') and R1492 (5' ACCTTGTTACGACTT 3') (17). Reaction mixtures were first incubated for 5 min at 95°C. Then 35 cycles were performed as follows: 15 s at 94°C, 15 s at 50°C, and 1 min 30 s at 72°C. Reaction mixtures were then incubated at 72°C for an additional 5 min. PCR products were purified with a Qiaquick PCR purification kit (Qiagen, Valencia, Calif.).

16S rRNA gene sequencing. Sequencing primers were chosen from a panel of eubacterial primers: F8, R1492 (described above), F357 (5' TACGGGAGGCAGCAG 3'), R357 (5' CTGCTGCCTCCCGTA 3'), F530 (5' CAGCAGCCGCGGTAATAC 3'), R530 (5' GTATTACCGCGGCTGCTG 3'), F790 (5' ATTAGATACCCTGGTAG 3'), R790 (5' CTACCAGGGTATCTAAT 3'), F1068 (5' GTCGTCAGCTCGTGTCGTGAG 3'), F1083 (5' CGTGACATGTTGGGTTAAGTC 3'), F981 (5' CCCGCAACGAGCGCAACCC 3'), and R981 (5' GGGTTGCGCTCGTTGCGGG 3') (17, 28, 35). For non-Brucella strains sequenced for comparison, four additional eubacterial primers were used: R1333 (5' CTAGCGATTCCGACTTCATGC 3'), R180 (5' TCTCTCAAGACGTATGCGGTA 3'), R591 (5' CATCCTGCTTAAGTAACCGTC 3'), and F1127 (5' ATTAGTTGCCATCATTCAGTT 3'). Sequencing was performed with an Applied Biosystems (ABI, Foster City, Calif.) BigDye terminator cycle sequencing kit (version 2.0, 1.1, or 1.0) per the manufacturer's instructions, with the exception of using 6 µl of BigDye instead of 8 µl. Sequencing products were purified by using Centri-Sep spin columns (Princeton Separations, Adelphia, N.J.), and these sequencing products were resolved with an ABI model 3100 automated DNA sequencing system (ABI).

Computer analysis of 16S rRNA gene sequences. (i) Evaluation of the 16S rRNA gene sequences of Brucella spp. The 16S rRNA gene sequencing of the amplified products obtained with PCR primers F8 and R1492 generated 1,412-bp-long sequences that closely matched the size of previously published Brucella 16S rRNA gene sequences. The length of these sequences was close to the full length of the gene, which is 1,485 bp (5, 7, 16), and thus allowed direct comparisons.

The software package used for all data analysis was the Accelrys, Inc. (San Diego, Calif.), GCG Wisconsin package, version 10.2. The raw trace files from the ABI 3100 sequencer were visually examined, aligned, and edited (SEQMERGE).

We compared the Brucella sequences by using DISTANCES to determine the level of similarity among them. The sequences generated in this study were compared with previously published Brucella spp. sequences by using BESTFIT to determine levels of similarity between sequences.

(ii) Comparisons of 16S rRNA gene sequences of Brucella spp. to sequences of closely related strains. The eubacterial primers F8 and R1492 were also used for the panel of related strains likely to present a differential diagnostic challenge. The 16S rRNA gene sequences from the amplification products that resulted from F8 and R1492 varied in length (1,377 to 1,491 bp). For the Agrobacterium, Ochrobactrum anthropi, Oligella urethralis, and Vibrio cholerae strains, the sequences were organized into sets by genus (Table 2) and aligned (PILEUP). A core segment of 1.4 to 1.5 kb was selected for each that was common to all the sequences in a given set by trimming sequences at the 5' and 3' ends. The level of similarity of the sequences in a set was then determined by using Jukes-Cantor correction (DISTANCES). The sequences within the Agrobacterium set matched each other 100%, as did the sequences within the O. anthropi and V. cholerae sets (Table 2). The most divergent sequences within the O. urethralis set matched at 99.9% (Table 2). A representative sequence from each set, as well as the 16S rRNA gene sequences from Escherichia coli O157:H7, Bartonella henselae, Afipia broomeae, and Afipia felis, were then compared to the Brucella consensus sequence to determine the level of similarity by BESTFIT (Table 3).


View this table:
[in this window]
[in a new window]
 
TABLE 3. Similarities of Brucella 16S rRNA consensus gene sequence to 16S rRNA gene sequences of strains related to Brucella spp. and species important for diagnostic differentiation

Nucleotide sequence accession number. A total of 82 16S rRNA gene sequences were determined in this study (Tables 1 and 2). They have been deposited in GenBank under accession no. AY513489 for Agrobacterium tumefaciens; AY513490 to AY513492 for Agrobacterium radiobacter; AY513493 to AY513495 for O. anthropi 5D; AY513496 to AY513499 for O. urethralis; AY513500 to AY5135501 for V. cholerae; AY513502 for E. coli; AY513503 for A. felis; AY513504 for B. henselae; AY513505 for A. broomeae; and AY513506 to AY513568, AY594215, and AY594216 for Brucella spp.


arrow
RESULTS
 
Near-full-length 1,412-bp nucleotide sequences of the 16S rRNA genes from 65 Brucella strains (Table 1) comprising six Brucella spp. were generated. Upon alignment and comparison, all 16S rRNA gene sequences were determined to be identical. This result yielded a Brucella consensus sequence that was used for all comparisons.

A BLAST search (10 October 2003) on GenBank indicated that there were only 17 Brucella 16S rRNA gene sequences (from 10 strains) near 1.4 kb available in this public database (2). Eleven of these gene sequences were a 100% match to our Brucella consensus sequence. Six of these 11 sequences were from B. melitensis strain 16 M and B. suis strain 1330, for which full genome sequences were published in 2002 (15, 31). Both strains have two chromosomes, and each strain has three copies of the 16S rRNA gene with two copies on chromosome I and one copy on chromosome II (15, 31). A BLAST analysis (8 October 2003) of both genome sequences on The Institute for Genomic Research website (http://tigrblast.tigr.org/cmr-BLAST/) (2) revealed that all three copies from each strain were a 100% match to our Brucella 16S rRNA gene consensus sequence. Two additional 16S rRNA sequences that were a 100% match to our Brucella consensus sequence are those of the recently published marine Brucella strain M2357/93 and B. abortus strain 544 (GenBank accession no. AF091353 and AF091354) (7). Finally, the last three 16S rRNA gene sequences of the 11 are from a study published in 2000 that also used the B. melitensis strain 16 M (accession no. AF220149, AF220148, and AF220147) (5).

There were six near-full-length Brucella 16S rRNA gene sequences that were not 100% matches to the consensus sequence. These sequences were entered into GenBank between 1989 and 1995. The first one is that of B. ovis strain ATCC 25840 (accession no. L26168) (K. H. Wilson, unpublished data), which differs from the consensus sequence by 3 bp. Compared to the consensus sequence, this B. ovis sequence has an A instead of a G at position 600, as well as Ns at positions 426 and 700. We sequenced three B. ovis isolates, including the ATCC 25840 strain, and all three sequences were a 100% match to the Brucella consensus sequence. The Brucella consensus sequence also differs substantially from the 16S rRNA gene sequence generated in 1989 for B. abortus strain 11/19 (accession no. X13695) (16). A BESTFIT analysis indicates that there is a 19-bp difference, including an N as well as a 3-bp deletion compared to our Brucella consensus sequence. A BLAST query on GenBank indicates that the sequence of accession no. X13695 is unique and does not perfectly match any other 16S rRNA gene sequence in the public database. The remaining four Brucella 16S rRNA gene sequences in GenBank are from B. suis strain ATCC 23444, B. melitensis strain ATCC 23456, B. neotomae strain ATCC 23459 (accession no. L26169, L26166, and L26167, respectively) (Wilson, unpublished), and B. canis strain ATCC 23365 (accession no. L37584) (K. H. Wilson and H. G. Hills, unpublished data), which differed from the consensus sequence by 1 to 6 bp. Three of these four sequences had Ns in the sequences, indicating an inability to identify bases.

B. abortus strain 11/19 was not available for resequencing: however, this strain is the same as U.S. strain 19 (E. Moreno, personal communication). We sequenced the 16S rRNA genes from B. abortus U.S. strain 19, B. melitensis strain ATCC 23456, B. neotomae strain ATCC 23459, and B. canis strain ATCC 23365. All four sequences were a 100% match to the Brucella consensus sequence.

Comparisons with the panel of 17 related strains likely to present a differential diagnostic challenge indicated that the sequence most similar to the Brucella consensus sequence was that from an O. anthropi strain at 98.8% similarity (Table 3), which is consistent with the relationship seen in previous phylogenetic studies (39). There is a difference of 16 bp, as well as a deletion and an insertion, which easily differentiates the Brucella consensus sequence from this sequence. The other 16S rRNA gene sequences from this panel of strains had even more pronounced differences (Table 3).


arrow
DISCUSSION
 
Current confirmatory identification of Brucella isolates relies upon a set of traditional microbiological tests that requires up to 7 days for completion. At the same time, safety concerns have limited the wide application of automated identification systems, which could potentially shorten the time from collection of an unknown specimen to obtaining the laboratory diagnosis. Few evaluations of such systems for Brucella identification have been made, but all suggest that the performance of automated systems has generally been poor (D. E. Roe, J. M. Janda, D. Lindquist, N. Caton, C. Crandall, J. Wong, and B. Zimmer, Abstr. 101st Gen. Meet. Am. Soc. Microbiol., abstr. C-340, 2001; J. C. David, W. L. Thomas, R. J. Burgess, and T. L. Hadfield, Abstr. 101st Gen. Meet. Am. Soc. Microbiol., abstr. C-335, 2001). Consequently, because Brucella spp. typically require several days of incubation before attaining a level of growth sufficient for the interpretation of various phenotypic tests (1), a more rapid approach for identification is needed, especially for a timely response to a potential biothreat event.

The critical advantage of 16S rRNA gene sequencing is based on its ability to be used for identification of unknown isolates. By using the broad-range eubacterial primers, as demonstrated in this study, a 16S rRNA gene sequence can be readily obtained, allowing for rapid confirmatory identification of an unknown isolate as a Brucella species by simple comparison to the consensus sequence. Confirmatory identification can then serve as a guide to continue all subsequent work with biosafety level 3 practices, while the rapidity with which it is obtained may be the critical factor needed for quickly implementing control and preventative measures in an emergency biothreat situation (6, 34). The PCR tests previously proposed limit the laboratorian to either positively identifying gene regions associated with a Brucella species or ruling out Brucella spp., which would then require subsequent diagnostic tests to identify the etiologic agent. Sequencing the 16S rRNA gene enables querying a database such as GenBank to yield an alternative identification without the need for any additional laboratory work. Consequently, given that the clinical presentation of brucellosis can resemble diseases caused by other select agents, this global diagnostic approach will be invaluable in a potential biothreat setting. We have added to the robustness of this approach by submitting to GenBank 82 high-quality 16S rRNA gene sequences from Brucella spp. and close relatives, which allows for a more accurate comparison of sequences.

One additional advantage of using 16S rRNA gene sequencing is that this method may be able to identify the causative organism from clinical specimens of patients who have received antimicrobial agents prior to the collection of specimens, as has been demonstrated recently during the 2001 bioterrorism-associated anthrax investigation (35). Because antimicrobial and other supportive treatment will not differ regardless of the Brucella species causing the illness (4), detection of the Brucella-specific 16S rRNA gene sequence will be advantageous for timely treatment of patients even without species identification.

Our result of 100% identity of the 16S rRNA gene sequence among the large number of Brucella strains tested is consistent with previous studies using a limited number of strains (5, 7) and could also be used to support proposals that Brucella may be a monospecific genus, based on the DNA hybridization studies that indicate a >77% level of homogeneity for the Brucella spp. (40). Vizcaíno et al. observed that there was some variability in the 16S rRNA locus, but not enough to separate the Brucella species (41). Similarly, there are some Brucella 16S rRNA gene sequences in GenBank that differ from the consensus sequence. We resequenced all but one of these discrepant GenBank submissions. Each was a 100% match to the Brucella consensus sequence. We do not believe the differences in the sequences from the original GenBank entries represent microheterogeneity in the 16S rRNA genes of these Brucella strains. Rather, these discrepant sequences were submitted from 1989 to 1995 before the advent of automated sequencing technologies with higher fidelity. This is supported by the presence of unresolved bases in some of these discrepant sequences.

A comparison of the Brucella 16S rRNA consensus sequence with those of close relatives indicates that sequencing of the first 500 bp is sufficient to differentiate them. The closest match, O. anthropi, was different by 2 bp in this segment, which is a sufficient level of divergence to be detected by current automated sequencing technology. For laboratories that may wish to conserve resources, this may be a viable option compared to sequencing 1.4 kb.

This work demonstrates that 16S rRNA gene sequencing can provide rapid confirmatory identification of an isolate as a Brucella species, allowing prompt and appropriate public health responses to be implemented. This approach will be of even greater value if shown to be effective when used directly on clinical specimens; studies are under way in our laboratory to evaluate its sensitivity and specificity on clinical specimens of patients with culture-confirmed brucellosis.


arrow
ACKNOWLEDGMENTS
 
We thank Timothy Barrett for supplying some of the strains used in this study.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Meningitis and Special Pathogens Branch, Division of Bacterial and Mycotic Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, MS-D11, 1600 Clifton Rd., N.E., Atlanta, GA 30333. Phone: (404) 639-4936. Fax: (404) 639-4421. E-mail: JGee1{at}cdc.gov. Back

{dagger} Present address: Saskatchewan Health, Provincial Laboratory, 3211 Albert St., Regina, Saskatchewan, Canada S4S 5W6. Back


arrow
REFERENCES
 
    1
  1. Alton, G. G., L. M. Jones, and D. E. Pietz. 1975. Laboratory techniques in brucellosis, 2nd ed. World Health Organization, Geneva, Switzerland.
  2. 2
  3. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410.[CrossRef][Medline]
  4. 3
  5. Anonymous. 2004. Public health response to biological and chemical weapons, 2nd ed. World Health Organization, Geneva, Switzerland.
  6. 4
  7. Bodur, H., N. Balaban, S. Aksaray, V. Yetener, E. Akinci, A. Colpan, and A. Erbay. 2003. Biotypes and antimicrobial susceptibilities of Brucella isolates. Scand. J. Infect. Dis. 35:337-338.[CrossRef][Medline]
  8. 5
  9. Bricker, B. J. 2000. Characterization of the three ribosomal RNA operons rrnA, rrnB, and rrnC, from Brucella melitensis. Gene 255:117-126.[CrossRef][Medline]
  10. 6
  11. Bricker, B. J. 2002. PCR as a diagnostic tool for brucellosis. Vet. Microbiol. 90:435-446.[CrossRef][Medline]
  12. 7
  13. Bricker, B. J., D. R. Ewalt, A. P. MacMillan, G. Foster, and S. Brew. 2000. Molecular characterization of Brucella strains isolated from marine mammals. J. Clin. Microbiol. 38:1258-1262.[Abstract/Free Full Text]
  14. 8
  15. Bricker, B. J., and S. M. Halling. 1995. Enhancement of the Brucella AMOS PCR assay for differentiation of Brucella abortus vaccine strains S19 and RB51. J. Clin. Microbiol. 33:1640-1642.[Abstract]
  16. 9
  17. Casanas, M. C., M. I. Queipo-Ortuno, A. Rodriguez-Torres, A. Orduna, J. D. Colmenero, and P. Morata. 2001. Specificity of a polymerase chain reaction assay of a target sequence on the 31-kilodalton Brucella antigen DNA used to diagnose human brucellosis. Eur. J. Clin. Microbiol. Infect. Dis. 20:127-131.[CrossRef][Medline]
  18. 10
  19. Chang, M. H., M. K. Glynn, and S. L. Groseclose. 2003. Endemic, notifiable bioterrorism-related diseases, United States, 1992-1999. Emerg. Infect. Dis. 9:556-564.[Medline]
  20. 11
  21. Cloeckaert, A., M. Grayon, and O. Grepinet. 2000. An IS711 element downstream of the bp26 gene is a specific marker of Brucella spp. isolated from marine mammals. Clin. Diagn. Lab. Immunol. 7:835-839.[Abstract/Free Full Text]
  22. 12
  23. Cloeckaert, A., M. Grayon, O. Grepinet, and K. S. Boumedine. 2003. Classification of Brucella strains isolated from marine mammals by infrequent restriction site-PCR and development of specific PCR identification tests. Microbes Infect. 5:593-602.[CrossRef][Medline]
  24. 13
  25. Corbel, M. J. 1997. Brucellosis: an overview. Emerg. Infect. Dis. 3:213-221.[Medline]
  26. 14
  27. Da Costa, M., J. P. Guillou, B. Garin-Bastuji, M. Thiebaud, and G. Dubray. 1996. Specificity of six gene sequences for the detection of the genus Brucella by DNA amplification. J. Appl. Bacteriol. 81:267-275.[Medline]
  28. 15
  29. DelVecchio, V. G., V. Kapatral, R. J. Redkar, G. Patra, C. Mujer, T. Los, N. Ivanova, I. Anderson, A. Bhattacharyya, A. Lykidis, G. Reznik, L. Jablonski, N. Larsen, M. D'Souza, A. Bernal, M. Mazur, E. Goltsman, E. Selkov, P. H. Elzer, S. Hagius, D. O'Callaghan, J. J. Letesson, R. Haselkorn, N. Kyrpides, and R. Overbeek. 2002. The genome sequence of the facultative intracellular pathogen Brucella melitensis. Proc. Natl. Acad. Sci. USA 99:443-448.[Abstract/Free Full Text]
  30. 16
  31. Dorsch, M., E. Moreno, and E. Stackebrandt. 1989. Nucleotide sequence of the 16S rRNA from Brucella abortus. Nucleic Acids Res. 17:1765.[Free Full Text]
  32. 17
  33. Eden, P. A., T. M. Schmidt, R. P. Blakemore, and N. R. Pace. 1991. Phylogenetic analysis of Aquaspirillum magnetotacticum using polymerase chain reaction-amplified 16S rRNA-specific DNA. Int. J. Syst. Bacteriol. 41:324-325.[Abstract/Free Full Text]
  34. 18
  35. Fosgate, G. T., T. E. Carpenter, B. B. Chomel, J. T. Case, E. E. DeBess, and K. F. Reilly. 2002. Time-space clustering of human brucellosis, California, 1973-1992. Emerg. Infect. Dis. 8:672-678.[Medline]
  36. 19
  37. Gee, J. E., C. T. Sacchi, M. B. Glass, B. K. De, R. S. Weyant, P. N. Levett, A. M. Whitney, A. R. Hoffmaster, and T. Popovic. 2003. Use of 16S rRNA gene sequencing for rapid identification and differentiation of Burkholderia pseudomallei and B. mallei. J. Clin. Microbiol. 41:4647-4654.[Abstract/Free Full Text]
  38. 20
  39. Greenfield, R. A., D. A. Drevets, L. J. Machado, G. W. Voskuhl, P. Cornea, and M. S. Bronze. 2002. Bacterial pathogens as biological weapons and agents of bioterrorism. Am. J. Med. Sci. 323:299-315.[CrossRef][Medline]
  40. 21
  41. Iqbal, S. S., M. W. Mayo, J. G. Bruno, B. V. Bronk, C. A. Batt, and J. P. Chambers. 2000. A review of molecular recognition technologies for detection of biological threat agents. Biosens. Bioelectron. 15:549-578.[CrossRef][Medline]
  42. 22
  43. Jahans, K. L., G. Foster, and E. S. Broughton. 1997. The characterisation of Brucella strains isolated from marine mammals. Vet. Microbiol. 57:373-382.[CrossRef][Medline]
  44. 23
  45. Kaufmann, A. F., M. D. Fox, J. M. Boyce, D. C. Anderson, M. E. Potter, W. J. Martone, and C. M. Patton. 1980. Airborne spread of brucellosis. Ann. N. Y. Acad. Sci. 353:105-114.[CrossRef][Medline]
  46. 24
  47. Lee, A. K., and S. Falkow. 1998. Constitutive and inducible green fluorescent protein expression in Bartonella henselae. Infect. Immun. 66:3964-3967.[Abstract/Free Full Text]
  48. 25
  49. Malik, G. M. 1997. A clinical study of brucellosis in adults in the Asir region of southern Saudi Arabia. Am. J. Trop. Med. Hyg. 56:375-377.
  50. 26
  51. Miller, C. D., J. R. Songer, and J. F. Sullivan. 1987. A twenty-five year review of laboratory-acquired human infections at the National Animal Disease Center. Am. Ind. Hyg. Assoc. J. 48:271-275.[Medline]
  52. 27
  53. Moreno, E., A. Cloeckaert, and I. Moriyon. 2002. Brucella evolution and taxonomy. Vet. Microbiol. 90:209-227.[CrossRef][Medline]
  54. 28
  55. Moreno, E., E. Stackebrandt, M. Dorsch, J. Wolters, M. Busch, and H. Mayer. 1990. Brucella abortus 16S rRNA and lipid A reveal a phylogenetic relationship with members of the alpha-2 subdivision of the class Proteobacteria. J. Bacteriol. 172:3569-3576.[Abstract/Free Full Text]
  56. 29
  57. Nielsen, K. 2002. Diagnosis of brucellosis by serology. Vet. Microbiol. 90:447-459.[CrossRef][Medline]
  58. 30
  59. Nilsson, W. B., R. N. Paranjype, A. DePaola, and M. S. Strom. 2003. Sequence polymorphism of the 16S rRNA gene of Vibrio vulnificus is a possible indicator of strain virulence. J. Clin. Microbiol. 41:442-446.[Abstract/Free Full Text]
  60. 31
  61. Paulsen, I. T., R. Seshadri, K. E. Nelson, J. A. Eisen, J. F. Heidelberg, T. D. Read, R. J. Dodson, L. Umayam, L. M. Brinkac, M. J. Beanan, S. C. Daugherty, R. T. Deboy, A. S. Durkin, J. F. Kolonay, R. Madupu, W. C. Nelson, B. Ayodeji, M. Kraul, J. Shetty, J. Malek, S. E. Van Aken, S. Riedmuller, H. Tettelin, S. R. Gill, O. White, S. L. Salzberg, D. L. Hoover, L. E. Lindler, S. M. Halling, S. M. Boyle, and C. M. Fraser. 2002. The Brucella suis genome reveals fundamental similarities between animal and plant pathogens and symbionts. Proc. Natl. Acad. Sci. USA 99:13148-13153.[Abstract/Free Full Text]
  62. 32
  63. Porter, A. M., and E. L. Smith. 1971. Brucellosis and goat's cheese? Br. Med. J. 3:580.[Free Full Text]
  64. 33
  65. Probert, W. S., K. N. Schrader, N. Y. Khuong, S. L. Bystrom, and M. H. Graves. 2004. Real-time multiplex PCR assay for detection of Brucella spp., B. abortus, and B. melitensis. J. Clin. Microbiol. 42:1290-1293.[Abstract/Free Full Text]
  66. 34
  67. Rotz, L. D., A. S. Khan, S. R. Lillibridge, S. M. Ostroff, and J. M. Hughes. 2002. Public health assessment of potential biological terrorism agents. Emerg. Infect. Dis. 8:225-230.[Medline]
  68. 35
  69. Sacchi, C. T., A. M. Whitney, L. W. Mayer, R. Morey, A. Steigerwalt, A. Boras, R. S. Weyant, and T. Popovic. 2002. Sequencing of 16S rRNA gene: a rapid tool for identification of Bacillus anthracis. Emerg. Infect. Dis. 8:1117-1123.[Medline]
  70. 36
  71. Sacchi, C. T., A. M. Whitney, M. W. Reeves, L. W. Mayer, and T. Popovic. 2002. Sequence diversity of Neisseria meningitidis 16S rRNA genes and use of 16S rRNA gene sequencing as a molecular subtyping tool. J. Clin. Microbiol. 40:4520-4527.[Abstract/Free Full Text]
  72. 37
  73. Schurig, G. G., N. Sriranganathan, and M. J. Corbel. 2002. Brucellosis vaccines: past, present and future. Vet. Microbiol. 90:479-496.[CrossRef][Medline]
  74. 38
  75. Trout, D., T. M. Gomez, B. P. Bernard, C. A. Mueller, C. G. Smith, L. Hunter, and M. Kiefer. 1995. Outbreak of brucellosis at a United States pork packing plant. J. Occup. Environ. Med. 37:697-703.[CrossRef][Medline]
  76. 39
  77. Velasco, J., C. Romero, I. Lopez-Goni, J. Leiva, R. Diaz, and I. Moriyon. 1998. Evaluation of the relatedness of Brucella spp. and Ochrobactrum anthropi and description of Ochrobactrum intermedium sp. nov., a new species with a closer relationship to Brucella spp. Int. J. Syst. Bacteriol. 48:759-768.[Abstract/Free Full Text]
  78. 40
  79. Verger, J. M., M. Grayon, A. Cloeckaert, M. Lefevre, E. Ageron, and F. Grimont. 2000. Classification of Brucella strains isolated from marine mammals using DNA-DNA hybridization and ribotyping. Res. Microbiol. 151:797-799.[Medline]
  80. 41
  81. Vizcaino, N., A. Cloeckaert, J. Verger, M. Grayon, and L. Fernandez-Lago. 2000. DNA polymorphism in the genus Brucella. Microbes Infect. 2:1089-1100.[CrossRef][Medline]
  82. 42
  83. Weyant, R. S., C. W. Moss, R. E. Weaver, D. G. Hollis, J. G. Jordan, E. C. Cook, and M. I. Daneshvar. 1995. Identification of unusual pathogenic gram-negative aerobic and facultatively anaerobic bacteria, 2nd ed. Williams & Wilkins, Baltimore, Md.
  84. 43
  85. Yagupsky, P. 1999. Detection of Brucellae in blood cultures. J. Clin. Microbiol. 37:3437-3442.[Free Full Text]


Journal of Clinical Microbiology, August 2004, p. 3649-3654, Vol. 42, No. 8
0095-1137/04/$08.00+0     DOI: 10.1128/JCM.42.8.3649-3654.2004




This article has been cited by other articles:

  • Tiller, R. V., De, B. K., Boshra, M., Huynh, L. Y., Van Ert, M. N., Wagner, D. M., Klena, J., Mohsen, T. S., El-Shafie, S. S., Keim, P., Hoffmaster, A. R., Wilkins, P. P., Pimentel, G. (2009). Comparison of Two Multiple-Locus Variable-Number Tandem-Repeat Analysis Methods for Molecular Strain Typing of Human Brucella melitensis Isolates from the Middle East. J. Clin. Microbiol. 47: 2226-2231 [Abstract] [Full Text]  
  • Foster, J. T., Beckstrom-Sternberg, S. M., Pearson, T., Beckstrom-Sternberg, J. S., Chain, P. S. G., Roberto, F. F., Hnath, J., Brettin, T., Keim, P. (2009). Whole-Genome-Based Phylogeny and Divergence of the Genus Brucella. J. Bacteriol. 191: 2864-2870 [Abstract] [Full Text]  
  • Kattar, M. M., Jaafar, R. F., Araj, G. F., Le Fleche, P., Matar, G. M., Abi Rached, R., Khalife, S., Vergnaud, G. (2008). Evaluation of a Multilocus Variable-Number Tandem-Repeat Analysis Scheme for Typing Human Brucella Isolates in a Region of Brucellosis Endemicity. J. Clin. Microbiol. 46: 3935-3940 [Abstract] [Full Text]  
  • De, B. K., Stauffer, L., Koylass, M. S., Sharp, S. E., Gee, J. E., Helsel, L. O., Steigerwalt, A. G., Vega, R., Clark, T. A., Daneshvar, M. I., Wilkins, P. P., Whatmore, A. M. (2008). Novel Brucella Strain (BO1) Associated with a Prosthetic Breast Implant Infection. J. Clin. Microbiol. 46: 43-49 [Abstract] [Full Text]  
  • Foster, J. T., Okinaka, R. T., Svensson, R., Shaw, K., De, B. K., Robison, R. A., Probert, W. S., Kenefic, L. J., Brown, W. D., Keim, P. (2008). Real-Time PCR Assays of Single-Nucleotide Polymorphisms Defining the Major Brucella Clades. J. Clin. Microbiol. 46: 296-301 [Abstract] [Full Text]  
  • Scott, J. C., Koylass, M. S., Stubberfield, M. R., Whatmore, A. M. (2007). Multiplex Assay Based on Single-Nucleotide Polymorphisms for Rapid Identification of Brucella Isolates at the Species Level. Appl. Environ. Microbiol. 73: 7331-7337 [Abstract] [Full Text]  
  • Groussaud, P., Shankster, S. J., Koylass, M. S., Whatmore, A. M. (2007). Molecular typing divides marine mammal strains of Brucella into at least three groups with distinct host preferences. J Med Microbiol 56: 1512-1518 [Abstract] [Full Text]  
  • Mukherjee, F., Jain, J., Patel, V., Nair, M. (2007). Multiple genus-specific markers in PCR assays improve the specificity and sensitivity of diagnosis of brucellosis in field animals. J Med Microbiol 56: 1309-1316 [Abstract] [Full Text]  
  • Helsel, L. O., Hollis, D. G., Steigerwalt, A. G., Levett, P. N. (2006). Reclassification of Roseomonas fauriae Rihs et al. 1998 as a later heterotypic synonym of Azospirillum brasilense Tarrand et al. 1979. Int. J. Syst. Evol. Microbiol. 56: 2753-2755 [Abstract] [Full Text]  
  • Whatmore, A. M., Shankster, S. J., Perrett, L. L., Murphy, T. J., Brew, S. D., Thirlwall, R. E., Cutler, S. J., MacMillan, A. P. (2006). Identification and Characterization of Variable-Number Tandem-Repeat Markers for Typing of Brucella spp.. J. Clin. Microbiol. 44: 1982-1993 [Abstract] [Full Text]  
  • Wellinghausen, N., Nockler, K., Sigge, A., Bartel, M., Essig, A., Poppert, S. (2006). Rapid Detection of Brucella spp. in Blood Cultures by Fluorescence In Situ Hybridization.. J. Clin. Microbiol. 44: 1828-1830 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gee, J. E.
Right arrow Articles by Popovic, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gee, J. E.
Right arrow Articles by Popovic, T.