JCM Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zsak, L.
Right arrow Articles by Rock, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zsak, L.
Right arrow Articles by Rock, D. L.
Journal of Clinical Microbiology, January 2005, p. 112-119, Vol. 43, No. 1
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.1.112-119.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Preclinical Diagnosis of African Swine Fever in Contact-Exposed Swine by a Real-Time PCR Assay

L. Zsak,1* M. V. Borca,1 G. R. Risatti,1 A. Zsak,1 R. A. French,2 Z. Lu,1 G. F. Kutish,1 J. G. Neilan,1 J. D. Callahan,3 W. M. Nelson,3 and D. L. Rock1

Plum Island Animal Disease Center, Agricultural Research Service, U.S. Department of Agriculture, Greenport, New York,1 Department of Pathobiology, University of Connecticut, Storrs, Connecticut,2 Tetracore Inc., Gaithersburg, Maryland3

Received 2 March 2004/ Returned for modification 26 July 2004/ Accepted 6 September 2004


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
A fluorogenic probe hydrolysis (TaqMan) PCR assay for African swine fever virus (ASFV) was developed and evaluated in experimentally infected swine. This sensitive and specific one-step single-tube assay, which can be performed in 2 h or less, detected viral DNA in tonsil scraping samples 2 to 4 days prior to onset of clinical disease. Thus, the assay would have application for preclinical diagnosis of African swine fever and surveillance and/or emergency management of a disease outbreak.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
African swine fever (ASF) is a highly lethal hemorrhagic disease of domestic swine, with mortality rates approaching 100% (15, 34). ASF occurs in several disease forms, ranging from highly lethal to subclinical infections depending on contributing viral and host factors (7, 9, 14, 15, 20). Hemostatic and hemodynamic changes (hemorrhage, edema, ascites, and shock) resulting from intravascular activation of coagulation are observed in pigs following infection with highly virulent strains of the ASF virus (ASFV) (31-33). ASFV infects cells of the mononuclear-phagocytic system, including fixed tissue macrophages and specific lineages of reticular cells; affected tissues show extensive necrosis following infection with highly virulent viral strains (20, 24). Moderately virulent ASFV strains also appear to infect these cell types, but the degree of tissue involvement and the resulting tissue damage are much less severe.

The causative agent, ASFV, is a unique and genetically complex DNA virus. It is the sole member of the newly named Asfarviridae and the only known DNA arbovirus (10). ASFV is a large icosahedral virus which contains a linear double-stranded DNA genome (170 to 190 kbp) encoding approximately 165 viral proteins (8, 29).

In sub-Saharan Africa, cycling of ASFV between soft ticks of the genus Ornithodoros and wild pig populations (warthogs, bushpigs, and giant forest hogs) provides a natural reservoir of virus that poses a constant threat to domestic pig populations worldwide (4). ASF has been reported from most African countries south of the Sahara and more recently from Western and North African countries. In 1957 ASF spread to Portugal and eventually to Spain in 1960, where the disease was endemic until its eradication in 1996 (37). Sporadic outbreaks of ASF have also occurred in recent times elsewhere in Europe (France in 1964, 1976, and 1977, Italy in 1967 and 1980, Malta in 1978 to present, Sardinia in 1978, Belgium in 1985, and Holland in 1986), the Caribbean (Dominican Republic in 1978, Haiti in 1979, and Cuba in 1977 to 1980), and South America (Brazil in 1978) (37). These outbreaks were controlled by animal quarantine and slaughter, frequently at a very high cost. Rapid and accurate detection of infected herds would allow for more effective emergency disease management and a reduction in overall economic losses.

Clinical signs of ASF are inapparent at early stages of infection, and at later stages they resemble those of some other swine diseases (20). Rapid and precise detection of ASFV is critical for disease containment. Current diagnostic methods, including detection of infectious virus, viral antigens, and specific antibodies and detection of genomic DNA by PCR, are relatively rapid diagnostic tests (2, 12, 16). However, these techniques require centralized laboratory facilities and clinical specimen submissions that delay disease diagnosis, thus affecting the efficiency of emergency disease management measures.

A rapid, preclinical diagnosis at the site of the suspected disease outbreak would be extremely useful for controlling ASF. To address this need, a fluorogenic probe hydrolysis (TaqMan) PCR assay for ASFV was developed and evaluated in experimentally infected swine. This sensitive and specific one-step, single-tube assay, which can be performed in 2 h or less, detected viral DNA in tonsil scraping samples 2 to 4 days prior to onset of clinical disease. Thus, the assay would have application for preclinical diagnosis of ASF and surveillance and/or emergency management of a disease outbreak.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Cell culture and viruses. Primary porcine blood macrophage cell cultures were prepared from defibrinated swine blood as previously described (22). Briefly, heparin-treated swine blood was incubated at 37°C for 1 h to allow sedimentation of the erythrocyte fraction. Mononuclear leukocytes were separated by flotation over a Ficoll-Paque (Pharmacia, Piscataway, N.J.) density gradient (specific gravity, 1.079). The monocyte/macrophage cell fraction was cultured in plastic Primaria tissue culture flasks (Falcon; Becton Dickinson Labware, Franklin Lakes, N.J.) containing RPMI 1640 medium with 30% L929 supernatant and 20% fetal bovine serum for 48 h (37°C in 5% CO2). Adherent cells were detached from the plastic using 10 mM EDTA in phosphate-buffered saline and then reseeded into Primaria 96-well dishes at a density of 5 x 106 cells per ml for use in assays 24 h later.

Pathogenic ASFV strain Pretoriuskop/96/4 (Pr4) was isolated from Ornithodoros porcinus porcinus ticks collected from the Republic of South Africa in 1996 (17). Pathogenic and cell culture-adapted ASFV isolates, swinepox virus strain Nebraska 99, sheeppox virus strain TU, pseudorabies virus strain Becker, and classical swine fever virus (CSFV) isolate Haiti-96, used for assessment of analytical assay sensitivity and specificity, were obtained from the Plum Island Animal Disease Center reference collection (1, 13, 18, 26, 30, 35).

DNA extraction. DNA was extracted from 200 µl of tissue culture supernatant, transport media containing nasal swab samples or tonsil scrapings, and heparinized whole blood samples by using a DNeasy kit (QIAGEN, Stanford, Calif.) and eluted in 100 µl of Tris-EDTA buffer according to the manufacturer's instructions. Viral genomic DNAs were isolated from purified virions using proteinase K and sodium dodecyl sulfate (SDS) lysis followed by phenol extraction and ethanol precipitation (36). For evaluation of assay sensitivity, the p72 gene from the ASFV Pr4 isolate was cloned in the pCR 2.1 TA vector (Invitrogen, San Diego, Calif.) and purified essentially as described by Sambrook et al. (27).

One-step real-time PCR assay for ASFV. The one-step real-time PCR assay was designed as a single-tube PCR probe hydrolysis (TaqMan) assay to target a gene encoding a highly conserved ASFV structural protein, p72 (5, 38). Twenty-six available full-length p72 sequences (Table 1) were aligned using BioEdit sequence alignment software. Specific oligonucleotide primers and the fluorogenic probe were designed to target a highly conserved region within the p72 open reading frame. The location and sequence of the primers and probe were the following: forward primer, starting at base position 1466, 5' CCTCGGCGAGCGCTTTATCAC 3'; reverse primer, starting at base position 1528, 5' GGAAACTCATTCACCAAATCCTT 3'; probe, starting at base position 1486, 5' CGATGCAAGCTTTAT 3'. The TaqMan probe was labeled with a 5' reporter dye, 6-carboxyfluorescein, and a 3' minor grove binder nonfluorescent quencher (PE Biosystems, Foster City, Calif.).


View this table:
[in this window]
[in a new window]
 
TABLE 1. ASFV isolates used in testing specificity of the ASFV real-time PCR

 
Reagents from Perkin-Elmer (EZ-RT-PCR; PE Biosystems) were used to prepare master-mixture recipes according to the guidelines of the manufacturer for individual component concentrations. The final PCR mixture for a 25-µl-volume assay consisted of the 5x buffer solution supplied with the kit with the addition of 5 mM Mn2-acetate, a 0.3 M concentration of each primer, 0.1 mM dATP, dCTP, or dGTP, 0.2 mM dUTP, 0.1 U of recombinant Tth DNA polymerase per µl, 0.1 µg of bovine serum albumin per µl, and 0.5 M trehalose. The PCR mixture was then dried within the reaction tubes (Fisher Scientific, Atlanta, Ga.). For sample testing, dried reagents, which can be stored at room temperature for at least 1 year (J. D. Callahan, unpublished data), were rehydrated with 22.5 µl of 1x buffer (see above) and 2.5 µl of DNA sample material. Cycling consisted of 45 amplification cycles (95°C for 2 s and 60°C for 30 s). The assay was optimized for use on a SmartCycler (Cepheid, Inc., Sunnyvale, Calif.), a 22-lb portable instrument that is operated by a laptop computer. Positive and negative controls consisting of ASFV DNA and a nontemplate reaction mixture were included with each PCR run.

Animal infections. Commercial crossbred Yorkshire pigs (30 to 35 kg) were used. Two pigs were intramuscularly inoculated in the left rear leg with 104 50% hemadsorption doses (HAD50) of the pathogenic ASFV isolate, Pr4. Twenty-four hours postinoculation, the infected animals were placed in contact with six noninfected swine. Heparinized whole blood, nasal swabs, and tonsil scrapings were obtained daily from all animals until death. Nasal and tonsil samples were collected with a cotton swab and placed in 1 ml of transport medium (RPMI 1640 containing antibiotics). Clinical signs of ASF (fever [a rectal temperature greater than or equal to 104°F], anorexia, lethargy, shivering, cyanosis, and recumbency) were monitored daily. Animal experiments were conducted under federal guidelines and Plum Island Animal Disease Center policies on animal care and use.

Virus titration. ASFV titers in tissue culture supernatants, blood samples, nasal swabs, and tonsil scrapings were determined in swine macrophage cell cultures as previously described (23). Virus titers were calculated by the method of Spearman-Karber and expressed as HAD50 per milliliter (11).

Statistical analysis. Performances of the ASFV real-time PCR assay were compared with virus isolation and/or ASFV DNA detection in tonsil scrapings, nasal swabs, and blood samples collected from contact-exposed pigs. Sensitivity, specificity, predictive values, test accuracy, and 95% confidence intervals were estimated using disease-test relation calculators found at the University of Oklahoma Health Sciences Center website (http://www.fammed.ouhsc.edu/robhamm/cdmcalc.htm).


    RESULTS AND DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Assay analytical sensitivity and specificity. To assess assay sensitivity, viral DNA was extracted from ASFV-infected macrophage cell culture supernatants and blood samples from pigs infected with the ASFV Pr4 isolate. The samples were diluted in log 10 steps in RPMI 1640 medium and/or whole swine blood, and DNA was extracted and tested to determine the end point dilution at which a positive amplification signal could be obtained. Prior to DNA extraction the same samples were titrated in porcine macrophage cell cultures and the titers were expressed as the HAD50 per milliliter. The results demonstrated that, regardless of sample origin, the sensitivity of the PCR assay ranged between 1,000 and 10,000 HAD50 per ml of the sample. In six independent determinations, the assay range of linearity was at least 4 log dilutions of extracted ASFV DNA (Fig. 1). After the sample volume used was adjusted for the DNA extraction volume (200 µl), elution volume (100 µl), and the volume tested (2.5 µl), assay sensitivity was estimated to be between 5 and 50 HAD50.



View larger version (9K):
[in this window]
[in a new window]
 
FIG. 1. Sensitivity of the ASFV real-time PCR assay was calculated by using ASFV samples obtained from infected cell culture supernatants or blood samples from infected pigs. An inverse linear relationship (r = 0.9237) exists between cycle threshold and the logarithm of HAD50 per milliliter present in the sample.

 
To further assess sensitivity, purified ASFV genomic DNA and plasmid constructs containing the cloned p72 gene were used to determine genomic equivalents necessary to yield a positive fluorogenic signal. One microgram of DNA was serially diluted in log 10 steps, and real-time PCR amplifications were performed to determine the end point dilution at which positive signal could be observed. The assay detected 1.4 to 8.4 viral genomic equivalents and 2.6 to 4.5 cloned p72 DNA molecules (data not shown). It should be emphasized that this is an estimate based on DNA extraction, ratios of the optical densities at 260 and 280 nm, and PCR efficiencies that are less than 100%.

Viral DNAs from 48 ASFV isolates were extracted from infected macrophage cell culture supernatants and tested in the real-time PCR assay. All ASFVs were detected with cycle threshold (Ct) values ranging from 15 to 28 (data not shown). Positive fluorogenic signals were observed for all 48 ASFV isolates (26 strains with known p72 sequences and 22 isolates with no available p72 sequence information) (Table 1). Importantly, the assay detected geographically and temporally distinct viruses isolated from different hosts (pig, warthog, bushpig, and tick). No fluorogenic signal was detected in the ASFV assay with samples containing DNAs from swinepox virus, sheeppox virus, and pseudorabies virus, or viral RNA extracted from CSFV-infected cell culture supernatants. Additionally, no false-positive results were observed for DNA samples extracted from pig macrophage cell cultures or lymphoid tissues (spleen, tonsil, or lymph nodes) from uninfected swine (data not shown).

Assay diagnostic sensitivity and specificity. The ability of the assay to detect ASFV during acute infection was assessed in experimentally infected pigs. Two pigs (30 to 40 kg) were inoculated intramuscularly with 104 HAD50 of the pathogenic ASFV isolate, Pr4, and placed in contact with six uninfected animals 24 h postinfection. Results of this experiment are shown in Table 2. Infected donor pigs presented with clinical disease (febrile response for 4 to 5 days and high blood viremia titers of 7.3 log10 HAD50/ml) and died within 9 days postinoculation. Contact animals presented with clinical signs of acute ASF 9 to 12 days postexposure and died within 18 days. No significant differences in disease course (number of days of fever, mean temperature, days of viremia, and maximum viremia titers) were noted for the two groups (Table 2).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Swine survival, fever response, and viremia following infection with ASFV Pr4a

 
Nasal swabs, tonsil scrapings, and blood samples were obtained daily from all animals after contact and examined by real-time PCR and virus isolation and titration. Contact pigs developed fever 9 to 12 days postexposure. DNA samples from tonsils were positive by PCR for all but one contact-exposed pig at 8 to 9 days postinoculation (Fig. 2). Virus was detectable both by PCR and virus isolation from nasal swabs only at later time points, generally after the appearance of clinical symptoms (Fig. 3). Viremia was first detected at 9 to 11 days postexposure, indicating a 1- to 2-day delay between virus replication in tonsils and generalization of infection (Fig. 4). Interestingly, pig 0080 revealed a high viremia both by PCR and virus isolation prior to appearance of virus in tonsil or nasal swab samples, suggesting that infection likely occurred parenterally by virus-containing blood (20).



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 2. Detection of ASFV in tonsil scraping samples. Six pigs (animals 0079, 0080, 0081, 0082, 0083, and 0084) were contact exposed to experimentally infected pigs. The bars represent virus titers expressed as HAD50 per milliliter. PCR results are expressed as positive (+) or negative (–). Asterisks indicate the time of appearance of ASF clinical symptoms.

 


View larger version (27K):
[in this window]
[in a new window]
 
FIG. 3. Detection of ASFV in nasal swab samples of contact-exposed pigs. Six pigs (animals 0079, 0080, 0081, 0082, 0083, and 0084) were contact exposed to experimentally infected pigs. The bars represent virus titers expressed as HAD50 per milliliter. PCR results are expressed as positive (+) or negative (–). Asterisks indicate the time of appearance of ASF clinical symptoms.

 


View larger version (33K):
[in this window]
[in a new window]
 
FIG. 4. Detection of ASFV in blood samples of contact-exposed pigs. Six pigs (animals 0079, 0080, 0081, 0082, 0083, and 0084) were contact exposed to experimentally infected pigs. The bars represent virus titers expressed as HAD50 per milliliter. PCR results are expressed as positive (+) or negative (–). Asterisks indicate the time of appearance of ASF clinical symptoms.

 
The PCR assay performed with 100% specificity and 92.8 to 96.4% accuracy for the 168 clinical samples evaluated during the experiment (Table 3). Four samples from tonsil scrapings and nasal swabs positive by real-time PCR but negative by virus isolation (Fig. 2 and 3) were examined in greater detail by PCR amplification of two additional ASFV genes (a CD2-like gene, 8-DR [6] and a structural protein, p22 [38]), followed by sequencing of the amplified products. All four samples contained ASFV genomic DNA, indicating that these represented true-positive samples (data not shown).


View this table:
[in this window]
[in a new window]
 
TABLE 3. Comparison of performances of ASFV real-time PCR assay with virus isolation and/or ASFV DNA detection in tonsil scrapings, nasal swabs, and blooda

 
The real-time PCR assay showed somewhat less sensitivity (89.7%) for blood samples compared to other clinical samples (95.4% for tonsil scrapings and 92.8% for nasal swabs), especially when viremia titers were low (2 to 3 log10 HAD50/ml) (Table 3 and Fig. 4). While virus isolation-titration methods detect infectious particles, sensitivity of PCR correlates with the number of viral DNA molecules. Since ASFV viremia is red blood cell associated and the virus does not replicate in these cells, it is reasonable to speculate that the lower sensitivity of the PCR was due to the reduced amounts of viral DNA present in these samples. It is also possible that PCR amplification of ASFV DNA from blood was reduced or blocked by the presence of PCR-inhibitory substances. PCR inhibitors in blood have been identified and include natural blood components, mainly heme (3) and leukocyte DNA (21), or added anticoagulants, such as heparin (28).

Although the hemadsorption test is a highly sensitive and routinely used method to detect ASFV in cell culture, there are ASFV isolates that do not hemadsorb (19, 20). Nonhemadsorbing isolates are identified by cytopathic effect and then confirmed by detecting the presence of ASFV antigen by indirect immunofluorescence test or peroxidase-based immunoassays using monospecific anti-ASFV antibodies (25). Depending on viral titers, detection of nonhemadsorbing ASFV can take several days (2 to 7 days), and the sensitivity of detection is approximately 10-fold lower compared with the HAD50 method (25). Since the real-time PCR assay for ASFV targets a highly conserved structural protein, p72, it would perform consistently with both hemadsorbing and nonhemadsorbing viruses, making the assay extremely useful for detecting ASFV in samples of unknown origin.

Notably, ASFV was detected in tonsil scrapings 2 to 4 days before the appearance of clinical symptoms (Fig. 2). Tonsil scrapings are also the sample of choice during the early stages of CSFV infection (26). Thus, a tonsil sample would not only be useful for preclinical diagnosis of ASF but for differential diagnosis of these two highly significant swine diseases.

In summary, the assay described here, a fluorogenic probe hydrolysis (TaqMan) PCR assay for rapid detection of ASFV, is performed in a single tube that contains all PCR reagents dried, and test results are obtained by using a portable detection instrument in real time, thus simplifying all pre- and post-PCR operating procedures. The simplicity, speed, and portability of the assay allow for its use as a pen-side assay for rapid preclinical detection of ASFV. This should facilitate surveillance and/or emergency management of a disease outbreak.


    ACKNOWLEDGMENTS
 
We thank the PIADC animal care staff for excellent technical assistance.


    FOOTNOTES
 
* Corresponding author. Mailing address: Plum Island Animal Disease Center, P.O. Box 848, Greenport, NY 11944-0848. Phone: (631) 323-3023. Fax: (631) 323-2507. E-mail: lzsak{at}piadc.ars.usda.gov. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Afonso, C. L., E. R. Tulman, Z. Lu, L. Zsak, F. A. Osorio, C. Balinsky, G. F. Kutish, and D. L. Rock. 2002. The genome of swinepox virus. J. Virol. 76:783-790.[Abstract/Free Full Text]
  2. Agüero, M., J. Fernandez, L. Romero, C. Sanchez Mascaraque, M. Arias, and J. M. Sanchez-Vizcaino. 2003. Highly sensitive PCR assay for routine diagnosis of African swine fever virus in clinical samples. J. Clin. Microbiol. 41:4431-4434.[Abstract/Free Full Text]
  3. Akane, A., K. Matsubara, H. Nakamura, S. Takahashi, and K. Kimura. 1994. Identification of the heme compound copurified with deoxyribonucleic acid (DNA) from bloodstains, a major inhibitor of polymerase chain reaction (PCR) amplification. J. Forensic Sci. 39:362-372.[Medline]
  4. Anderson, E. C., G. H. Hutchings, N. Mukarati, and P. J. Wilkinson. 1998. African swine fever virus infection of the bushpig (Potamochoerus porcus) and its significance in the epidemiology of the disease. Vet. Microbiol. 62:1-15.[CrossRef][Medline]
  5. Bastos, A. D., M. L. Penrith, C. Cruciere, J. L. Edrich, G. Hutchings, F. Roger, E. Couacy-Hymann, and R. G. Thomson. 2003. Genotyping field strains of African swine fever virus by partial p72 gene characterisation. Arch. Virol. 148:693-706.[CrossRef][Medline]
  6. Borca, M. V., G. F. Kutish, C. L. Afonso, P. Irusta, C. Carrillo, A. Brun, M. Sussman, and D. L. Rock. 1994. An African swine fever virus gene with similarity to the T-lymphocyte surface antigen CD2 mediates hemadsorption. Virology 199:463-468.[CrossRef][Medline]
  7. Coggins, L. 1974. African swine fever virus: pathogenesis. Prog. Med. Virol. 18:48-63.[Medline]
  8. Costa, J. V. 1990. African swine fever virus, p. 247-270. In G. Darai (ed.), Molecular biology of iridoviruses. Kluwer Academic Publishers, Norwell, Mass.
  9. DeTray, D. E. 1963. African swine fever. Adv. Vet. Sci. Comp. Med. 8:299-333.
  10. Dixon, L. K., J. V. Costa, J. M. Escribano, D. L. Rock, E. Vinuela, and P. J. Wilkinson. 2000. Family Asfarviridae, p. 159-165. In M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, and S. M. Wickner (ed.), Virus taxonomy: classification and nomenclature of viruses. Seventh report of the International Committee on Taxonomy of Viruses. Academic Press, San Diego, Calif.
  11. Finney, D. J. 1984. Statistical methods in biological assays, 2nd ed., p. 524-533. Hafner Publishing Co., New York, N.Y.
  12. Gonzague, M., C. Plin, L. Bakkali-Kassimi, A. Boutrouille, and C. Cruciere. 2002. Development of an internal control for the detection of the African swine fever virus by PCR. Mol. Cell. Probes 16:237-242.[CrossRef][Medline]
  13. Hamdy, F. M., and A. H. Dardiri. 1984. Clinical and immunologic responses of pigs to African swine fever virus isolated from the Western hemisphere. Am. J. Vet. Res. 45:711-714.[Medline]
  14. Hess, W. R. 1971. African swine fever virus. Virol. Monogr. 9:1-33.[Medline]
  15. Hess, W. R. 1982. African swine fever: a reassessment. Adv. Vet. Sci. Comp. Med. 25:39-69.
  16. King, D. P., S. M. Reid, G. H. Hutchings, S. S. Grierson, P. J. Wilkinson, L. K. Dixon, A. D. Bastos, and T. W. Drew. 2003. Development of a TaqMan PCR assay with internal amplification control for the detection of African swine fever virus. J. Virol. Methods 107:53-61.[CrossRef][Medline]
  17. Kleiboeker, S. B., G. F. Kutish, J. G. Neilan, Z. Lu, L. Zsak, and D. L. Rock. 1998. A conserved African swine fever virus right variable region gene, l11L, is nonessential for growth in vitro and virulence in domestic swine. J. Gen. Virol. 79:1189-1195.[Abstract]
  18. Knudsen, R. C., E. V. Genovesi, and T. C. Whyard. 1987. In vitro immune serum-mediated protection of pig monocytes against African swine fever virus. Am. J. Vet. Res. 48:1067-1071.[Medline]
  19. Malmquist, W. A., and D. Hay. 1960. Hemadsorption and cytopathic effect produced by African swine fever virus in swine bone marrow and buffy coat cultures. Am. J. Vet. Res. 21:104-108.[Medline]
  20. Mebus, C. A. 1988. African swine fever. Adv. Virus Res. 35:251-269.[Medline]
  21. Morata, P., M. I. Queipo-Ortuno, and J. de Dios Colmenero. 1998. Strategy for optimizing DNA amplification in a peripheral blood PCR assay used for diagnosis of human brucellosis. J. Clin. Microbiol. 36:2443-2446.[Abstract/Free Full Text]
  22. Neilan, J. G., Z. Lu, G. F. Kutish, L. Zsak, T. G. Burrage, M. V. Borca, C. Carrillo, and D. L. Rock. 1997. A BIR motif containing gene of African swine fever virus, 4CL, is nonessential for growth in vitro and viral virulence. Virology 230:252-264.[CrossRef][Medline]
  23. Onisk, D. V., M. V. Borca, G. Kutish, E. Kramer, P. Irusta, and D. L. Rock. 1994. Passively transferred African swine fever virus antibodies protect swine against lethal infection. Virology 198:350-354.[CrossRef][Medline]
  24. Pan, I. C., and W. R. Hess. 1984. Virulence in African swine fever: its measurement and implications. Am. J. Vet. Res. 45:361-366.[Medline]
  25. Plowright, W., G. R. Thomson, and J. A. Neser. 1994. African swine fever, p. 568-599. In J. A. W. Coetzer, G. R. Thomson, and R. C. Tustin (ed.), Infectious diseases in livestock with special reference to South Africa, vol. 1. Oxford University Press, Goodwood, South Africa.
  26. Risatti, G. R., J. D. Callahan, W. M. Nelson, and M. V. Borca. 2003. Rapid detection of classical swine fever virus by a portable real-time reverse transcriptase PCR assay. J. Clin. Microbiol. 41:500-505.[Abstract/Free Full Text]
  27. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  28. Satsangi, J., D. P. Jewell, K. Welsh, M. Bunce, and J. I. Bell. 1994. Effect of heparin on polymerase chain reaction. Lancet 343:1509-1510.[Medline]
  29. Tabarés, E., I. Olivares, G. Santurde, M. J. Garcia, E. Martin, and M. E. Carnero. 1987. African swine fever virus DNA: deletions and additions during adaptation to growth in monkey kidney cells. Arch. Virol. 97:333-346.[CrossRef][Medline]
  30. Tulman, E. R., C. L. Afonso, Z. Lu, L. Zsak, J. H. Sur, N. T. Sandybaev, U. Z. Kerembekova, V. L. Zaitsev, G. F. Kutish, and D. L. Rock. 2002. The genomes of sheeppox and goatpox viruses. J. Virol. 76:6054-6061.[Abstract/Free Full Text]
  31. Villeda, C. J., C. Gomez-Villamandos, S. M. Williams, J. Hervas, P. J. Wilkinson, and E. Viñuela. 1995. The role of fibrinolysis in the pathogenesis of the haemorrhagic syndrome produced by virulent isolates of ASFV. Thromb. Haemostasis 73:112-117.[Medline]
  32. Villeda, C. J., S. M. Williams, P. J. Wilkinson, and E. Viñuela. 1993. Consumption coagulopathy associated with shock in acute ASF. Arch. Virol. 133:467-475.[CrossRef][Medline]
  33. Villeda, C. J., S. M. Williams, P. J. Wilkinson, and E. Viñuela. 1993. Haemostatic abnormalities in ASF: a comparison of two virus strains of different virulence (Dominican Republic '78 and Malta '78). Arch. Virol. 130:71-83.[CrossRef][Medline]
  34. Viñuela, E. 1985. African swine fever. Curr. Top. Microbiol. Immunol. 116:151-170.[Medline]
  35. Wesley, R. D., and I. C. Pan. 1982. African swine fever DNA: restriction endonuclease cleavage patterns of wild-type, Vero cell-adapted and plaque-purified virus. J. Gen. Virol. 63:383-391.[Abstract/Free Full Text]
  36. Wesley, R. D., and A. E. Tuthill. 1984. Genome relatedness among African swine fever virus field isolates by restriction endonuclease analysis. Prev. Vet. Med. 2:53-62.
  37. Wilkinson, P. J. 1989. African swine fever virus, p. 17-35. In M. B. Pensaert (ed.), Virus infections of porcines. Elsevier Science Publishers, Amsterdam, The Netherlands.
  38. Yáñez, R. J., J. M. Rodríguez, M. L. Nogal, L. Yuste, C. Enríquez, J. F. Rodriguez, and E. Viñuela. 1995. Analysis of the complete nucleotide sequence of African swine fever virus. Virology 208:249-278.[CrossRef][Medline]


Journal of Clinical Microbiology, January 2005, p. 112-119, Vol. 43, No. 1
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.1.112-119.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zsak, L.
Right arrow Articles by Rock, D. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zsak, L.
Right arrow Articles by Rock, D. L.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Antimicrob. Agents Chemother. Clin. Microbiol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS