JCM Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eigner, U.
Right arrow Articles by Witte, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eigner, U.
Right arrow Articles by Witte, W.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, October 2005, p. 5256-5262, Vol. 43, No. 10
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.10.5256-5262.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Evaluation of a Rapid Direct Assay for Identification of Bacteria and the mecA and van Genes from Positive-Testing Blood Cultures

U. Eigner,1 M. Weizenegger,1 A.-M. Fahr,1* and W. Witte2

Department of Microbiology and Hygiene, Limbach Laboratory, Heidelberg,1 Robert Koch Institute, Wernigerode Branch, Wernigerode, Germany2

Received 2 May 2005/ Returned for modification 3 June 2005/ Accepted 26 July 2005


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We performed the first evaluation of a DNA strip assay (GenoType blood culture; Hain Lifescience, Nehren, Germany) for the detection of the most relevant bacterial sepsis pathogens directly from positive BACTEC blood culture bottles (Becton Dickinson, Heidelberg, Germany). The test comprises two panels, one for the direct species identification of important gram-positive cocci and the other for gram-negative rods. Additionally, detection of the mecA and the van genes are implemented. The GenoType assay was validated regarding its analytical sensitivity with blood cultures spiked with reference strains. Approximately 104 CFU per ml were detected. Analytical specificity was calculated with a test panel of 212 reference strains. Of the strains tested, 99% were correctly identified. Additionally, 279 consecutive blood cultures signaled positive by BACTEC were processed directly, in comparison to conventional methods. The GenoType assays were performed according to Gram stain morphology. A total of 243 (87.1%) of the 279 organisms isolated were covered by specific probes. A total of 152 organisms were gram-positive cocci, of which 148 (97.4%) were correctly identified by the GenoType assay. Ninety-one organisms were gram-negative rods, of which 89 (97.8%) were correctly identified. Concerning mecA gene detection, GenoType assay correctly detected 12 of 13 methicillin-resistant Staphylococcus aureus isolates. One Enterococcus faecium isolate with a positive vanA gene isolated was correctly differentiated by the assay. All results were available 4 h after the results of microscopic analysis. The evaluated GenoType blood culture assay showed fast and reliable results in detecting the most important sepsis pathogens and the mecA and van genes directly from positive blood culture bottles.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Detection of bacterial isolates in blood cultures of septicemic patients plays an important role in diagnostic microbiology, due to high rates of patient morbidity and mortality (18). The positive impact of rapid reporting of bacterial pathogens on patient outcomes and hospital costs have been previously stated (3, 4, 21). Automated, continuous monitoring blood culture systems marked a significant advance in reducing detection time (11, 16, 22, 23). But rapid identification (ID) of the bacterial pathogen also facilitates earlier and appropriate therapy (15). Several nucleic acid-based methods for detection of various bacteria have been published, including direct in situ testing with a fluorescence in situ hybridization technique using fluorescent peptides and oligonucleotides and chemiluminescent RNA-DNA hybrid tests or AccuProbe (8, 9, 13). PCR-based techniques have been published that use membranes of blotted hybridization probes or real-time PCR assays (1, 7, 26). Recently, a new DNA strip assay was developed (the GenoType blood culture), designed for detection of the most relevant bacterial sepsis pathogens from positive blood cultures. The GenoType assay consists of two different panels, one designed for the ID of gram-positive cocci and one designed to ID gram-negative rods. Therefore, a Gram stain result is required. The first panel comprises DNA probes for the direct species ID of gram-positive cocci, including Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus simulans, Staphylococcus warneri, Enterococcus faecium, Enterococcus faecalis, Enterococcus gallinarum, and Enterococcus casseliflavus. Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus agalactiae, and Streptococcus dysgalactiae can be differentiated to the species level; several other streptococci can be differentiated as groups. Due to the impact of methicillin-resistant S. aureus (MRSA) and vancomycin-resistant enterococci on therapeutic regimes, the detection of mecA and the van genes are also part of the assay (2, 5). The second panel comprises gram-negative rods including Escherichia coli, Enterobacter species (E. aerogenes, E. cloacae, and E. sakazakii), Proteus mirabilis, Klebsiella oxytoca, Klebsiella pneumoniae, Serratia marcescens, important Salmonella serovars, Citrobacter species (C. braakii, C. freundii, and C. koseri), Haemophilus influenzae, Pseudomonas aeruginosa, Acinetobacter baumannii, and Stenotrophomonas maltophilia. The main objective of this study was to evaluate the accuracy of the assay to identify bacterial organisms directly from positive blood culture bottles. The results of the GenoType assay were compared to those obtained by conventional phenotypic methods.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bacterial isolates or blood cultures. For the evaluation of the analytical specificity of the designated probes, 212 strains from different culture collections (the American Type Culture Collection, Manassas, Va. [ATCC]; the National Collection of Type Cultures, London, United Kingdom [NCTC]; the Limbach Laboratory Department of Microbiology, Heidelberg, Germany (LIM); the Robert Koch Institute, Wernigerode, Germany (RKI); and the Deutsche Stammsammlung für Mikroorganismen und Zellkulturen [DSMZ]) were tested. For determination of analytical sensitivity of the test, the following strains were used: E. coli ATCC 25922, S. aureus ATCC 25923, S. pneumoniae ATCC 33400, and S. epidermidis ATCC 35547.

The GenoType test is designated for use with positive blood cultures bottles with a Gram stain positive for bacteria. A total of 279 positive BACTEC 9240 blood cultures containing 99 gram-negative rods and 180 gram-positive cocci were collected consecutively from samples of patients with bloodstream infections that were received from several hospitals for routine diagnostic evaluation. Only specimens from patients for which blood culture differentiation had been requested were considered. No extra blood samples from individuals were taken for evaluation purposes. All bottles with bacteria visible by Gram staining were used, and no preselection was done. The GenoType assay for the ID of gram-positive organisms and the assay for ID of gram-negative bacteria were performed according to the result of the Gram stain. Results of the DNA-based method were compared to routine conventional diagnostic procedures.

Phenotypic ID. Bacterial isolates from positive blood culture media were subcultured on Columbia blood agar, chocolate agar, and MacConkey agar (all from Oxoid, Wesel, Germany) prior to being tested and incubated at 35°C for 24 h under aerobic conditions or with a 5% CO2 atmosphere, respectively. For conventional gram-negative ID, the VITEK 2 GN card (bioMérieux, Marcy l'Étoile, France) and API systems (Api NH, Api 20 E, and Api 20 NE) (bioMérieux) were used. For gram-positive cocci, the VITEK 2 ID-GP card and Api systems (ID 32 Staph, Api 20 Strep, and Api Rapid ID 32 strep) were used. For S. aureus, the Slidex Staph Plus (bioMérieux) and coagulase test (bioMérieux) were also used. For S. pneumoniae, optochin, bile solubility, and latex agglutination (bioMérieux) tests were performed, and identification of beta-hemolytic streptococci was determined according to Lancefield's serology.

Antimicrobial susceptibility testing. S. aureus isolates were tested for oxacillin susceptibility with a VITEK 2 AST P 536 card and oxacillin screening agar (Becton Dickinson, Heidelberg, Germany). Final confirmation of the presence of the mecA gene and the ID of S. aureus and S. epidermidis were performed with the GenoType MRSA assay (Hain Lifescience). For other coagulase-negative staphylococci (CoNS), oxacillin resistance was tested by VITEK 2 and agar diffusion tests with a 1-µg oxacillin disk on Mueller-Hinton agar supplemented with 2% NaCl, according to CLSI (formerly NCCLS) guidelines (12). Vancomycin and teicoplanin susceptibility testing was performed with VITEK 2 and Etest (AB BIODISK, Solna, Sweden). All phenotypic results were interpreted as sensitive (S), intermediate (I), and resistant (R) by utilizing CLSI performance standards (12). Detection of van genes was performed with the GenoType Enterococcus assay (Hain Lifescience).

GenoType blood culture DNA extraction and amplification. To process the reference strains, five bacterial colonies grown after overnight incubation were picked and suspended in 150 µl of distilled water. Bacterial DNA was released by a 15-min heating step at 95°C in a dry incubator and a 15-min sonication. The assay was performed according to the manufacturer's instructions. For processing of positive-testing blood cultures, 20 µl of the blood culture medium was spotted onto a special membrane device (GenoCard; Hain Lifescience). After a drying step of 15 min at 37°C, a punch of 1 mm in diameter was transferred directly into the 40-µl PCR mixture containing 2.5 mM MgCl2 and 1 U Taq polymerase (Eppendorf, Hamburg, Germany). Amplification was done as follows: denaturing for 15 min at 95°C; 10 cycles, each consisting of 95°C for 30 s and 58°C for 120 s; an additional 20 cycles, each consisting of 95°C for 25 s, 53°C for 40 s, and 70°C for 40 s; and a final extension at 70°C for 8 min.

Hybridization protocol. The DNA strips contain a set of immobilized oligonucleotides, which are responsible for specific binding of the appropriate biotinylated amplicons derived from the PCR amplification. After a colorimetric staining procedure, the resulting band pattern can be evaluated by eye. Hybridization and detection were carried out with an automated washing and shaking device (Profiblot; Tecan, Männedorf, Switzerland). Twenty microliters of the amplification products was mixed with 20 µl of denaturing reagent (provided with the kit) for 5 min. After addition of 1 ml of prewarmed hybridization buffer, the membrane strips were added to every trough. Hybridization took place at 45°C for 0.5 h, followed by two washing steps. For colorimetric detection of hybridized amplicons, streptavidin-conjugated alkaline phosphatase and the appropriate substrate were added. After final washing, the strips were air dried and fixed on a data sheet. Evaluation was done according to the interpretation table provided.

Data analysis. The developed lines on the strip were evaluated by eye with a template provided with the kit. All individual steps (DNA isolation, DNA amplification, and hybridization) are monitored by a universal internal control to improve the reliability of the test. This internal control uses primers and a probe targeting a conservative part of the bacterial genome. When faint bands occurred, the intensity of the universal control band was used for evaluation of the strip. Only bands with a color intensity equal or greater than that of the control band were considered positive. Analytical sensitivity and specificity were calculated with defined reference strains obtained from different culture collections (i.e., ATCC, NCTC, RKI, LIM, and DSMZ). For the determination of analytical sensitivity, a suspension equivalent to a 0.5 McFarland standard from each of the strains tested was adjusted. Serial dilutions (10–1 to 10–9 in sterile saline) were pipetted. A total of 900 µl from a BACTEC 9240 blood culture bottle containing 5 ml of sheep blood was spiked with 100 µl of these bacterial suspensions. The GenoType assay was applied to a dilution series of every single blood culture sample spiked with the individual bacteria. The bacterial load (the number of CFU per milliliter) in each blood culture was calculated by the number of CFU counted on Columbia blood agar plates after overnight incubation.

To determine analytical specificity, the GenoType ID for the species was considered correct when the band pattern was in agreement with the interpretation chart. Gram-positive or -negative bacteria not belonging to species defined by the interpretation chart were considered correct in case of a positive universal control. Evaluation of the performance of the GenoType assay with positive blood cultures was performed in comparison to routine culture results and biochemical ID. The band patterns on the developed strips specific for each species and resistance GenoType were compared to conventional microbiology results. In case of discrepancies, the isolates were subjected to 16S rRNA sequencing. Amplicons derived from a PCR amplification with bacterial specific primers AGAGTTTGATCATGGCTCAGRWYGAACG (E. coli positions 8 to 28)and CGTATTACCGCGGCTGCTGGCACG (E. coli positions 515 to 528) were directly sequenced on an ABI PRISM 310 automated sequencer (Applera, Weiterstadt, Germany). For amplification, the same amplification conditions for the GenoType assay were used. 16S rRNA gene data were blasted to public databases of National Center for Biotechnology Information (Bethesda, Md.).


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Validation of the GenoType assay with reference strains. Analytical sensitivity was determined with dilution series of BACTEC 9240 media (including sheep blood) spiked with different bacterial reference strains. The detection limit of the GenoType assay was calculated for E. coli ATCC 25922 to be 1.2 x 104 CFU/ml, for S. aureus ATCC 25923 to be 1.4 x 104 CFU/ml, for S. pneumoniae ATCC 33400 to be 4.6 x 104 CFU/ml, and for S. epidermidis ATCC 35547 to be 3.2 x 104 CFU/ml.

The GenoType assay was evaluated with 212 defined reference strains of different culture collections (ATCC, DSMZ, and RKI) and from routine samples. A total of 143 of these strains were expected to give a positive result with specific hybridization probes available on the test stripe (Table 1). Sixty-nine strains tested were expected to give a negative result (Table 2). A universal bacterial probe was available for use with the assay in this case. PCR and subsequent hybridization of the isolates were performed with DNA isolated from bacterial cultures on agar plates. Of the strains expected to give a positive result, 91 were gram-positive bacteria, and 52 were gram-negative bacteria. Regarding gram-negative reference strains, 50 isolates tested were in agreement with the predicted hybridization profile, except for two H. influenzae isolates not being identified; the same result was obtained when the assay was repeated. One routine isolate with the result K. pneumoniae from the VITEK 2 GN card showed the typical band pattern of K. oxytoca seen with the GenoType assay. K. oxytoca was confirmed by 16S sequencing and also by VITEK 2 after being retested. All staphylococcal reference strains showed the correct species-specific hybridization pattern. For MRSA, the mecA gene was correctly detected in all strains tested. All 32 enterococcal species and the respective van-associated resistance genes were correctly differentiated. Thirty-four challenge strains of streptococci showed the correct hybridization profile, as predicted by the assay. Of the 69 strains expected to be negative by the GenoType assay, a positive signal was only produced with the universal bacterial control and was therefore considered to be correct.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Validation of GenoType assay with isolates expected to give positive results

 

View this table:
[in this window]
[in a new window]
 
TABLE 2. Validation of GenoType assay with isolates expected to give negative results

 
Direct hybridization of positive blood culture bottles. For 279 blood cultures positive by the BACTEC 9240 blood culture system, Gram staining and routine cultures were performed. All blood culture samples positive by Gram staining were subjected to direct DNA extraction, following PCR and hybridization by the GenoType assay. The ID results with the GenoType assay were compared to those obtained from conventional microbiological procedures. The 279 blood cultures included 99 (35.5%) gram-negative bacteria (57 [20.4%] were identified as E. coli isolates, 9 [3.2%] as E. cloacae, 6 [2.2%] as K. pneumoniae, 3 [1.1%] as K. oxytoca, 3 [1.1%] as P. aeruginosa, 3 [1.1%] as S. marcescens, and 18 [6.5%] as other gram-negative bacteria). A total of 180 (64.5%) of the 279 blood cultures contained gram-positive cocci (53 [19%] were identified as S. aureus, 50 [17.9%] as S. epidermidis, 25 [9.0%] as other CoNS, 12 [4.3%] as S. pneumonaie, 7 [2.5%] as E. faecealis, 5 [1.8%] as Enterococcus faecium, and 28 [10%] as other gram-positive organisms). The results of the GenoType assay for the gram-negative and gram-positive isolates tested are shown in Tables 3 and 4. Hybridization examples are shown in Fig. 1. For 243 (87.1%) of the 279 organisms isolated, specific hybridization probes were available with the assay. A total of 91 of these 244 isolates were gram-negative rods and 152 were gram-positive cocci. Of the gram-negative rods, 89 (97.8%) of 91 were correctly identified by the assay. One E. coli isolate produced no hybridization pattern with DNA extracted from blood culture. Retesting with DNA derived from bacterial agar culture material of this isolate revealed a positive result. One E. aerogenes isolate was reported to be K. pneumoniae by the GenoType assay. The result by conventional microbiological methods was confirmed by 16S rRNA gene sequencing. One isolate identified as E. coli by VITEK 2 was reported to be S. marcescens by the GenoType assay. 16S rRNA gene sequencing confirmed the S. marcescens result in this case. One isolate reported as K. oxytoca by VITEK 2 was negative by the GenoType assay, although a specific probe was available. The reference method 16S rRNA sequencing identified this isolate as Pantoea agglomerans. For this species, no specific probe with the GenoType assay was available.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Performance of GenoType assay with DNA of gram-negative organisms directly extracted from positive testing blood cultures

 

View this table:
[in this window]
[in a new window]
 
TABLE 4. Performance of GenoType assay with DNA of gram-positive organisms directly extracted from positive testing blood cultures

 


View larger version (21K):
[in this window]
[in a new window]
 
FIG. 1. Hybridization examples of gram-positive cocci (left) and gram-negative rods (right) with the GenoType blood culture assay. CC, conjugate control; UC, universal control.

 
Of the 152 gram-positive cocci, 148 (97.4%) were correctly detected by the GenoType assay and in close agreement with conventional microbiological methods. Detection of one S. aureus, one Streptococcus bovis, and two S. epidermidis cultures failed by PCR amplification and were negative by the internal control. All the four species negative in direct testing of blood cultures gave a positive signal when retested from pure agar culture.

When oxacillin resistance was evaluated, 13 S. aureus isolates were resistant by conventional susceptibility testing methods. With 12 of the S. aureus isolates, the GenoType assay correctly detected the mecA gene. For one isolate, no ID or mecA hybridization signal was visible. A total of 38 of the CoNS isolated showed oxacillin resistance by conventional methods. The GenoType assay showed a positive mecA gene in 37 of these cases; 1 isolate was missed and showed no band pattern. Of 37 CoNS isolates shown to be oxacillin susceptible by VITEK 2, 1 isolate showed a positive mecA gene by the GenoType assay. This result was confirmed by agar diffusion and the Etest and GenoType MRSA assay. One E. faecium isolate, identified as resistant for vancomycin and teicoplanin (by VITEK 2), gave a positive pattern on the strip for E. faecium and the vanA gene.

Thirty-six (12.9%) of the 279 organisms were not identifiable by the lack of specific probes on the strip. These isolates were CoNS (Staphylococcus capitis [7 isolates], Staphylococcus chromogenes [1 isolate], Staphylococcus caprae [2 isolates], and Staphylococcus xylosus [1 isolate]); Enterococcus avium (1 isolate); Streptococcus salivarius (1 isolate); Micrococcus luteus (4 isolates); Propionibacterium spp. (3 isolates); Candida species (6 isolates); Corynebacterium spp. (2 isolates); Neisseria species (1 isolate); Acinetobacter species (3 isolates); Alcaligenes faecalis (2 isolates); Pantoea agglomerans (1 isolate); and Pseudomonas putida (1 isolate). All gave a valid result with the universal bacterial control and were therefore considered to be correctly identified.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We performed the first evaluation of a new DNA-based assay, the GenoType blood culture, for the detection of the most important sepsis-relevant pathogens (24) directly from blood cultures. The test comprises two panels, which were performed according to Gram stain morphology, one for the differentiation of gram-positive bacteria and one for gram-negative bacteria. The analytical sensitivity of the blood culture assay of approximately 104 CFU per ml blood culture was proven to be high, considering that the number of organisms that can reliably be detected microscopically is about 105 CFU/ml (20). In terms of analytical specificity, when pure cultures of 212 defined reference strains were tested, 99% were identified correctly. Two reference strains of H. influenzae showed a negative result with the appropriate probe. Direct amplicon sequencing showed genetic variations in the targeted region (Hain Lifescience, personal communication).

The performance of the GenoType assay was evaluated for 279 bacterial isolates from positive blood cultures. With regard to species ID as defined by an interpretation chart provided with the kit, 97.4% of the gram-positive cocci and 97.8% of the gram-negative rods isolated were correctly differentiated. For gram-negative organisms, one E. aerogenes strain was misidentified as K. pneumoniae. Sequencing of the GenoType targeting region revealed an atypical species with a sequence variation in this case. Intraspecific variants of species involved in sepsis pathogenesis were also reported by other authors (1). One E. coli isolate and 4 gram-positive cocci failed with PCR amplification. Colonies picked from an overnight agar culture of these blood culture specimens retested by the GenoType assay led to a positive and correct result. Therefore, sequence variations were excluded in these cases. Missing amplification may be due to inhibition or amounts of bacteria in the liquid culture that are too small. The universal bacterial amplification controls showed a weak or missing signal, which supports this thesis, but we did not clarify the exact reason. An additional factor concerning the higher number of gram-positive cocci negative by the assay is the lower efficiency of DNA release for the mechanically robust cell wall (17). The GenoType blood culture assay allows the detection of the important van and the mecA genes (2, 5). Prevalence of MRSA among the S. aureus isolates was 25% in this study. One of 13 MRSAs was missed by GenoType assay. When the assay was repeated with agar-grown colonies, the MRSA was clearly identified. Some authors have reported difficulties for detection of mecA gene of CoNS other than S. epidermidis (25). We observed a high correlation between the GenoType assay and phenotypic results generated by VITEK 2 for S. epidermidis and also for CoNS (other than S. epidermidis). Concerning VITEK 2, other authors have also published reliable results for oxacillin resistance testing with CoNS generally (6). There was only one isolated E. faecium isolate that was resistant to vancomycin. The GenoType assay clearly identified the correct species and the vanA gene.

Evaluation studies for DNA-based differentiation of bacterial cultures with the technique of reverse hybridization are published with satisfying results. The tests can be easily implemented in a routine laboratory setting (14, 19, 25). The hybridization process, as performed in our evaluation, runs on a "walk away" device and only needs the reagents set up and the strips prepared. Handling requires only a few manual steps, and results are generated in 4 to 5 h. The range of organisms can easily be expanded by the addition of new probes to the strip. The test procedure is batched, and standardized hybridization conditions allow parallel performance of this test with other GenoType assays (19). The amount of hands-on time for the GenoType assay is very competitive, compared to real-time systems for the differentiation of bacteria derived from blood cultures. A real-time approach would require more single-amplification reactions or a stepwise approach, as described by Wellinghausen et al. (26), because until now this technique could not cover a high-throughput multiplex assay format like the GenoType test system (i.e., 15 probes for the gram-negative panel and 24 probes for the gram-positive panel). Costs for the thermocycler and hybridization device are 25% to 50% of the price of real-time equipment. The price per test strip (gram positive or gram negative) will be in the range of the GenoType series for identification of mycobacteria (ca. 15 Euros) (D. Hain, personal communication). The hybridization device is an open system; therefore, room separation is required, as it is recommended for DNA analysis. To monitor possible carryover events, a negative control was implemented in every run.

A DNA extraction procedure for direct amplification of bacterial DNA from clinical specimens, particularly from blood culture media, is crucial. The method should be successful in removing PCR inhibitors and concentrating DNA and should prove its applicability to routine diagnostic work (10, 17). The method first introduced with the GenoType kit is very easy to handle and is time efficient. It comprises one pipette step of a 15-µl blood culture solution on a special membrane (GenoCard; Hain Lifescience) and an incubation step of 15 min at 37°C until dried. A punched piece of the membrane, 1 mm in diameter, can be directly inserted into the PCR mixture. In some cases, we observed cross-contamination between samples. Therefore, a cleaning procedure (by taking two punches on a clean area of the card) is recommended.

The evaluated GenoType blood culture assay showed precise results in detecting the most important sepsis pathogens and mecA- and van-associated antibiotic resistance. The assay provides easy handling, due to the fixation of all detection probes on one paper strip, and simple workflow with an automated device.


    FOOTNOTES
 
* Corresponding author. Mailing address: Limbach Laboratory, Im Breitspiel 15, D-69126 Heidelberg, Germany. Phone: 49-6221-3432-192. Fax: 49-6221-3432-263. E-mail: a.fahr{at}docnet.de. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Anthony, R. M., T. J. Brown, and G. L. French. 2000. Rapid diagnosis of bacteremia by universal amplification of 23S ribosomal DNA followed by hybridization to an oligonucleotide array. J. Clin. Microbiol. 38:781-788.[Abstract/Free Full Text]
  2. Chambers, H. F. 2001. The changing epidemiology of Staphylococcous aureus. Emerg. Infect. Dis. 7:178-182.[Medline]
  3. DiGiovine, B., C. Chenoweth, C. Watts, and M. Higgins. 1999. The attributable mortality and costs of primary nosocomial bloodstream infections in the intensive care unit. Am. J. Respir. Crit. Care Med. 160:976-981.[Abstract/Free Full Text]
  4. Doern, G. V., R. Vautour, M. Gaudet, and B. Levy. 1994. Clinical impact of rapid in vitro susceptibility testing and bacterial identification. J. Clin. Microbiol. 32:1757-1762.[Abstract/Free Full Text]
  5. Gold, H. S. 2001. Vancomycin-resistant enterococci: mechanisms and clinical observations. Clin. Infect. Dis. 33:210-219.[CrossRef][Medline]
  6. Horstkotte, M. A., J. K. M. Knobloch, H. Rohde, S. Dobinsky, and D. Mack. 2002. Rapid detection of methicillin resistance in coagulase-negative staphylococci with the VITEK 2 system J. Clin. Microbiol. 40:3291-3295.[Abstract/Free Full Text]
  7. Kurupati, P., C. Chow, G. Kumarasinghe, and C. Laa Poh. 2004. Rapid detection of Klebsiella pneumoniae from blood culture bottles by real-time PCR. J. Clin. Microbiol. 42:1337-1340.[Abstract/Free Full Text]
  8. Lindholm, L., and H. Sarkkinen. 2004. Direct identification of gram-positive cocci from routine blood cultures by using AccuProbe tests. J. Clin. Microbiol. 42:5609-5613.[Abstract/Free Full Text]
  9. Marlowe, E. M., J. J. Hogan, J. F. Hindler, I. Andruszkiewicz, P. Gordon, and D. A. Bruckner. 2003. Application of an rRNA probe matrix for rapid identification of bacteria and fungi from routine blood cultures. J. Clin. Microbiol. 41:5127-5133.[Abstract/Free Full Text]
  10. Millar, B. C., X. Jiru, J. E. Moore, and J. A. P. Earle. 2000. A simple and sensitive method to extract bacterial, yeast and fungal DNA from blood culture material. J. Microbiol. Methods 42:139-147.[CrossRef][Medline]
  11. Mylotte, J. M., and A. Tayara. 2000. Blood cultures: clinical aspects and controversies. Eur. J. Clin. Microbiol. Dis. 19:157-163.
  12. NCCLS. 2004. Performance standards for antimicrobial susceptibility testing. NCCLS approved standard M100-S14. National Committee for Clinical Laboratory Standards, Wayne, Pa.
  13. Oliveira, K., S. M. Brecher, A. Durbin, D. S. Shapiro, D. R. Schwartz, P. C. De Girolami, J. Dakos, G. W. Procop, D. Wilson, C. S. Hanna, G. Haase, H. Peltroche-Llacsahuanga, K. C. Chapin, M. C. Musgnug, M. H. Levi, C. Shoemaker, and H. Stender. 2003. Direct identification of Staphylococcus aureus from positive blood culture bottles. J. Clin. Microbiol. 41:889-891.[Abstract/Free Full Text]
  14. Padilla, E., V. González, J. M. Manterola, A. Pérez, M. D. Quesada, S. Gordillo, C. Vilaplana, M. A. Pallarés, S. Molinos, M. D. Sánchez, and V. Ausina. 2004. Comparative evaluation of the new version of the INNO-LiPA Mycobacteria and GenoType Mycobacterium assays for identification of Mycobacterium species from MB/BacT liquid cultures artificially inoculated with mycobacterial strains. J. Clin. Microbiol. 42:3083-3088.[Abstract/Free Full Text]
  15. Pittet, D., N. Li, R. F. Woolson, and R. P. Wenzel. 1997. Microbiological factors influencing the outcome of nosocomial bloodstream infections: a 6-year validated population-based model. Clin. Infect. Dis. 24:1068-1078.[Medline]
  16. Pohlman, J. K., B. A. Kirkley, K. A. Easley, and J. A. Washington. 1995. Controlled clinical comparison of Isolator and BACTEC 9240 Aerobic/F resin bottle for detection of bloodstream infections. J. Clin. Microbiol. 33:2525-2529.[Abstract]
  17. Rantakokko-Jalava, K., and J. Jalava. 2002. Optimal DNA isolation method for detection of bacteria in clinical specimens by broad-range PCR. J. Clin. Microbiol. 40:4211-4217.[Abstract/Free Full Text]
  18. Reimer, L. G., M. L. Wilson, and M. P. Weinstein. 1997. Update on bacteremia and fungemia. Clin. Microbiol. Rev. 10:444-465.[Abstract]
  19. Richter, E., M. Weizenegger, S. Rüsch-Gerdes, and S. Niemann. 2003. Evaluation of GenoType MTBC assay for differentiation of clinical Mycobacterium tuberculosis complex isolates. J. Clin. Microbiol. 41:2672-2675.[Abstract/Free Full Text]
  20. Strand, C. L., and J. A. Shulman. 1988. Bloodstream infections. Laboratory detection and clinical considerations, p. 21-36. ASCP Press, Chicago, Ill.
  21. Trenholme, G. M., R. L. Kaplan, P. H. Karakusis, T. Stine, J. Fuhrer, W. Landau, and S. Levin. 1989. Clinical impact of rapid identification and susceptibility testing of bacterial blood culture isolates. J. Clin. Microbiol. 27:1342-1345.[Abstract/Free Full Text]
  22. Weinstein, M. P. 1996. Current blood culture methods and systems: clinical concepts, technology and interpretation of results. Clin. Infect. Dis. 23: 40-46.[Medline]
  23. Weinstein, M. P., M. L. Towns, S. M. Quartey, S Mirrett, L. G. Reimer, G. Parmigiani, and L. B. Reller. 1998. The clinical significance of positive blood cultures in the 1990s: a prospective comprehensive evaluation of the microbiology, epidemology, and outcome of bacteremia and fungemia in adults. Clin. Infect. Dis. 24:584-602.
  24. Weinstein, M. P. 2003. Blood culture contamination: persisting problems and partial progress. J. Clin. Microbiol. 41:2275-2278.[Free Full Text]
  25. Wellinghausen, N., B. Wirths, A. Essig, and L. Wassill. 2004. Evaluation of the Hyplex BloodScreen Multiplex PCR-enzyme-linked immunosorbent assay system for direct identification of gram-positive cocci and gram-negative bacilli from positive blood cultures. J. Clin. Microbiol. 42:3147-3152.[Abstract/Free Full Text]
  26. Wellinghausen, N., B. Wirths, A. R. Franz, L. Karolyi, R. Marre, and U. Reischl. 2004. Algorithm for the identification of bacterial pathogens in positive blood cultures by real-time LightCycler polymerase chain reaction (PCR) with sequence-specific probes. Diagn. Microbiol. Infect. Dis. 48:229-241.[CrossRef][Medline]


Journal of Clinical Microbiology, October 2005, p. 5256-5262, Vol. 43, No. 10
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.10.5256-5262.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eigner, U.
Right arrow Articles by Witte, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eigner, U.
Right arrow Articles by Witte, W.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Antimicrob. Agents Chemother. Clin. Microbiol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS