JCM Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stewart, M.
Right arrow Articles by Wilcox, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stewart, M.
Right arrow Articles by Wilcox, G.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, November 2005, p. 5574-5580, Vol. 43, No. 11
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.11.5574-5580.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

TaqMan Real-Time Reverse Transcription-PCR and JDVp26 Antigen Capture Enzyme-Linked Immunosorbent Assay To Quantify Jembrana Disease Virus Load during the Acute Phase of In Vivo Infection

Meredith Stewart,1,2 Moira Desport,1,2* Nining Hartaningsih,3 and Graham Wilcox1,2

School of Veterinary and Biomedical Science, Murdoch University, Murdoch, WA 6150, Australia,1 State Agricultural Biotechnology Centre, Murdoch University, Murdoch, WA 6150, Australia,2 Disease Investigation Centre, BPPH Wilayah VI, P.O. Box 3322, Denpasar, Indonesia 802233

Received 3 March 2005/ Returned for modification 12 April 2005/ Accepted 13 August 2005


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Jembrana disease virus (JDV) is an acutely pathogenic lentivirus that affects Bali cattle in Indonesia. The inability to propagate the virus in vitro has made it difficult to quantitate JDV and determine the kinetics of virus replication during the acute phase of the disease process. We report for the first time two techniques that enable quantification of the virus and the use of these techniques to quantify the virus load during the acute phase of the disease process. A one-step JDV pol TaqMan real-time reverse transcription-PCR (RT-PCR) assay was developed for the detection and quantification of JDV RNA in plasma. The limit of detection was 9.8 x 102 JDV viral RNA copies over 35 cycles, equivalent to 4.2 x 104 JDV genome copies/ml, and a peak virus load of 1.6 x 1012 during the acute febrile period. An antigen capture enzyme-linked immunosorbent assay (ELISA) was also developed to quantify the levels of JDV capsid (JDVp26) over a linear range of 10 to 200 ng/ml. Viral RNA and JDVp26 levels were correlated in 48 plasma samples obtained from experimentally infected cattle. A significant positive correlation (R = 0.860 and r2 = 0.740) was observed between the two techniques within the range of their detection limits. The relatively insensitive capture ELISA provides an economical and feasible method for monitoring of virus in the absence of more sensitive techniques.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Jembrana disease virus (JDV) causes an atypical lentivirus infection that results in an acute severe disease that affects Bali cattle (Bos javanicus) within Indonesia (4, 20, 36). JDV has a short incubation period of 4 to 12 days, and the disease is characterized by a febrile response, lethargy, anorexia, leukopenia, and enlargement of superficial lymph nodes and a mortality rate of about 17% (36). The majority of animals develop detectable antibodies to the virus only 6 weeks or more after recovery from the acute phase of the disease (17, 41). Surviving animals are resistant to reinfection, remain infectious for at least 2 years, and do not appear to suffer further episodes of disease (35).

Attempts to cultivate JDV in vitro have been unsuccessful (42), and this has restricted the development of assays for the quantification of infectious virus. A series of animal bioassay experiments reported by Soeharsono et al. (35) provide the only data available regarding virus replication during the acute phase of disease process. These studies revealed that there was a high titer of infectious virus in plasma of about 108 50% cattle infectious doses (ID50)/ml during the acute febrile period, decreasing to low levels and persisting at low levels in recovered animals. A strong correlation between the initial dose of virus in a sample and the time between infection and onset of the acute febrile disease period was observed (35). Although this bioassay provided a method for titration of infectious virus, it was time-consuming and expensive. Techniques that do not require the use of animals for assay of virus are needed for further studies on the kinetics of virus replication during the acute phase of the disease process and for understanding the persistence of virus in recovered animals. Additionally, the development of an inactivated virus vaccine for JDV which relied on clinical observations to determine the efficacy of different vaccine formulations has been reported (16), and further studies of vaccine development would be greatly facilitated by the capacity to quantify the virus load in vaccinated animals.

In this paper, we describe the development and correlation of two techniques for the detection and quantification of the JDV load in plasma: the quantification of virus RNA and the quantification of virus antigen by enzyme-linked immunosorbent assay (ELISA). The quantification of circulating viral RNA is a widely accepted method for monitoring the levels of human immunodeficiency virus (HIV) RNA, and the quantity of circulating viral RNA is considered a key indicator of lentivirus disease progression and severity (6, 12, 15, 38, 45). The tests used to quantify viral RNA require specialized equipment and reagents that may not always be available, and several reports have described the use of antigen capture ELISA techniques for quantification of viruses, including HIV type 1 (HIV-1) (37) and severe acute respiratory syndrome-associated coronavirus (5).


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Experimental cattle. Bali cattle were obtained from Nusa Penida, an island adjacent to Bali where there is no serological, clinical, or genetic evidence for the presence of JDV, and were transported to Bali. They were housed in isolation and tested to confirm their status as negative for antibody to bovine lentiviruses by a standard antibody ELISA (17).

JDV infection of experimental cattle. JDV strain Tabanan/87 was maintained by storing spleen tissue from infected animals at –70°C, as described previously (35). To prepare a high-titer virus stock for infection of experimental cattle, samples of the spleen were thawed and a donor animal was intravenously inoculated with 1 ml of a 10% (wt/vol) suspension of the spleen tissue. On the second day of the febrile response that developed in the donor animal, usually 6 to 8 days after inoculation when a titer of virus in plasma of ≥108 ID50/ml was normally expected (35), a blood sample was collected in EDTA anticoagulant, and the plasma was separated by centrifugation. The plasma sample was diluted to an estimated 103 ID50/ml in Hank's medium containing 10% (wt/vol) fetal calf serum, penicillin, and streptomycin. Experimental animals were inoculated intravenously with 1 ml of the diluted plasma.

Clinical observations and sample collections from infected cattle. Rectal temperatures were recorded at the same time daily on days 0, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, and 15. Plasma samples were collected on days –1, 0, 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, and 16 postchallenge and were stored at –80°C prior to testing. Samples were thawed and tested by capture ELISA at the same time that the RNA extractions were carried out to minimize sample degradation.

Sample preparation. Whole blood was collected in 10-ml EDTA Vacutainer tubes (Becton Dickinson Vacutainer System, Rutherford, N.J.) and centrifuged at 2,000 x g for 10 min to clarify the plasma. Plasma samples were stored as 1-ml aliquots at –80°C until they were required.

Extraction of viral RNA. RNA extractions were carried out with thawed plasma samples by using the QIAamp Viral RNA mini kit (QIAGEN, Australia), according to the manufacturer's instructions. Prior to extraction, plasma samples were centrifuged at 8,000 x g for 5 min. Viral RNA was extracted from 140 µl of plasma, eluted in a final volume of 60 µl of elution buffer (AVE buffer; QIAGEN), and stored at –80°C until required.

Primer and probe design. PCR primers and a TaqMan probe for the specific quantification of JDV were designed by using Primer Express software (PE Applied Biosystems, Australia) and checked by using the BLASTN program (1). All sequences were derived from the previously published JDV Tabanan/87 sequence U21603 (4). The primer set JDV pol1f (GGGAGACCCGTCAGATGTGGA; Invitrogen, Australia) and JDV pol1r (TGGGAAGCATGGACAATCAG; Invitrogen) specifically amplified 121 bp in JDV pol. The TaqMan probe (CCCACAACTTAGAAAGAACTTCCCCGCTG; Geneworks, Australia) was designed based on recommended guidelines (3) and labeled at the 5' end with the reporter dye 6-carboxyfluorescein and at the 3' end with Black Hole-2 quencher dye.

TaqMan real-time RT-PCR. The Access RT-PCR system (Promega, Australia) was modified and optimized for use with the JDV pol primer and probe set. The reaction mixture consisted of 0.5x AMV Tfl reaction buffer, 0.8 mM of each deoxynucleoside triphosphate, 2 mM MgCl2, 100 ng of each primer, 0.1 µM fluorogenic probe, 1 µl ROX reference dye, 0.2 U SUPERase • In (Ambion, Australia), 0.4% (wt/vol) Triton X-100, 2 mM dithiothreitol, 0.1 U/µl AMV reverse transcriptase, and 0.1 U/µl Tfl DNA polymerase in a final volume of 45 µl with 5 µl of extracted RNA. The one-step protocol consisted of a reverse transcription (RT) step at 48°C for 45 min; a 2-min inactivation step at 95°C; and the PCR conditions of 35 cycles of 95°C for 30 s, 58°C for 30 s, and 72°C for 1 min. All TaqMan real-time quantitative RT-PCRs were performed in MicroAMP optical tubes and caps (Applied Biosystems, Australia), with amplification, data acquisition, and analysis performed with an ABI Prism 7700 (Perkin-Elmer, Australia) sequence detection system. A control for PCR interference was not performed for these samples. Each sample was assayed in duplicate, and the assay was repeated if the standard deviation between the two replicates was greater than 1 cycle threshold (CT). CT is the first PCR cycle where a significant increase in fluorescence signal is detected. The data were analyzed by using the Sequence Detector software 1.9.1; the fluorescence emission baseline was calculated from the first 3 to 10 or 12 cycles, and the default threshold was set at 10 to 20 times the standard deviation of the baseline measurement. The JDV pol TaqMan real time RT-PCR products were visualized by agarose gel electrophoresis (32).

Preparation of standard curve for virus quantification. The viral titer of JDV was indirectly quantified from a DNA plasmid standard curve by using JDV clone 139, encompassing nucleotides 19 to 2881 of the Tabanan/87 JDV isolate (4). The mass of plasmid DNA was converted to moles and multiplied by Avogadro's number to give the equivalent amount of virus in each reaction mixture. As a lentivirus is made up of two identical RNA strands, one double-stranded plasmid was considered to be equivalent to one virus RNA genome. The number of RNA copies detected in each reaction was multiplied to convert it to the number per ml of plasma. Generation of a standard curve and regression analysis were performed by using StatView 5.0 (SAS Institute, Inc.).

JDVp26 capture antibody. Maxisorb ELISA plates (Nunc, Australia) were coated overnight at 4°C with a 1:1,000 dilution of JDVp26-specific monoclonal antibody BC10 (10) in carbonate buffer at pH 9.5. The specificity of this monoclonal antibody has recently been shown to be toward the carboxy terminus of the JDVp26 protein, possibly the major homology region (10).

A second monoclonal antibody, BC1, with reactivity to a different region of the JDV capsid (10) was also tested as an alternative capture antibody.

Recombinant protein standard. A biotinylated JDV recombinant p26 protein construct, Jgag6, was produced as described previously (10) and was used to provide a standard curve on each plate in the range of 10 to 200 ng/ml. The purified recombinant Jgag6 protein was quantified by the Bradford assay (Bio-Rad, Australia), diluted in the casein blocking solution, and tested in duplicate.

Sample preparation for JDVp26 antigen capture. Plasma samples were thawed immediately prior to use and were tested in duplicate with undiluted plasma and 1:2 and 1:10 dilutions of plasma in phosphate-buffered saline. An additional dilution of 1:100 was used for the plasma samples taken from eight infected but previously vaccinated animals. Triton X-100 was added to each plasma sample to a final concentration of 1% (wt/vol), and the mixture was incubated for 1 h at 37°C.

Detection of captured JDVp26 protein. All wells in the ELISA trays were treated with 100-µl volumes of each solution, and the samples were tested in duplicate. All washes were performed in triplicate by using phosphate-buffered saline containing 0.05% (wt/vol) Tween 20, and all incubations were at 37°C for 60 min, unless otherwise indicated. Each well was blocked with casein and washed prior to the addition of plasma samples treated with Triton X-100 and incubated for 2 h. After further washing, the captured protein was detected by the addition of a 1:4,000 dilution of rabbit anti-JDVp26 antiserum (a kind gift from J. Brownlie), followed by the addition of a 1:4,000 dilution of goat anti-rabbit immunoglobulin G conjugated with horseradish peroxidase (ICN, Australia). Tetramethylbenzidine substrate reagent (Bio-Rad, Australia) was added to each well, and the color was allowed to develop for 30 to 45 min. A solution of 2 M sulfuric acid was added to each well to stop the enzyme reaction, and the plates were read at 450 nm within 15 min on an ELISA plate reader. Unknown protein values were determined from the linear portion of the standard recombinant JDVp26 curve.

Correlation of quantitative real-time RT-PCR and antigen capture ELISA. All samples were subject to quantification for viral RNA copies by TaqMan real-time RT-PCR. The JDVp26 antigen capture ELISA was conducted on days –1, 1, and 2 after challenge and all days during the acute febrile phase of the disease. The log10 values of the viral RNA copies/ml and JDVp26 protein concentration (ng/ml) were analyzed by using StatView 5.0 (SAS Institute, Inc.). Values below 1 x 107 viral RNA copies/ml and 10 ng/ml of p26 protein were excluded from the correlation.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Sensitivity and dynamic range of the TaqMan real-time RT-PCR assay and generation of standard curve for quantification. A single-step quantitative TaqMan real-time RT-PCR was developed to provide a molecular tool to quantify the JDV viral RNA circulating in the plasma of infected animals. A total of 142 plasma samples obtained from animals experimentally infected with JDV were used to optimize the technique. The sensitivity and dynamic range of the quantitative assay were determined by amplifying serial dilutions of JDV plasmid 139. Successful amplification over an 8-log dynamic range from the limit of detection of 9.8 x 102 to 3.8 x 1010 copies of template per reaction mixture was obtained within 35 cycles. The single standard curve was used for all sample determinations to quantify the amount of virus per reaction mixture. The equation generated to predict the amount of virus per reaction was log10 JDV viral RNA copies = 12.896 – 0.283 x CT (Spearman's correlation = 0.986; r2 = 0.973; P < 0.0001) (Fig. 1). The value generated from the standard curve was adjusted to determine the number of virus copies per ml of plasma. The use of a curve for single-standard RNA reduced the levels of variation between experiments and standardized the quantification of the RNA.



View larger version (9K):
[in this window]
[in a new window]
 
FIG. 1. Standard curve generated to indirectly quantify the amount of virus/reaction mixture based on serial dilutions of JDV plasmid 139. The equation generated to predict the amount of virus/reaction was log10 JDV viral RNA copies = 12.896 – 0.283 x CT (Spearman's correlation = 0.986; r2 = 0.973; P < 0.0001). The different amount of JDV genome copies/reaction mixture used and the average CT for each amount are indicated.

 
An RNA sample was included as a control for the reverse transcriptase activity in each run to provide a positive control to check that the CT values were repeatable in each batch of assays. The sensitivity, efficiency, and dynamic range of the RT step was tested with 10-fold serially diluted RNA taken from a plasma sample containing approximately 108 ID50/ml, based on bioassays reported previously (35). Positive CT values were consistently detected in samples estimated to contain 1012 viruses/ml through to 105 viruses/ml within 35 amplification cycles (Fig. 2). JDV pol TaqMan real-time RT-PCR amplification had greater sensitivity in detecting low copy numbers of virus than the standard RT-PCR (Fig. 2). The JDV pol TaqMan real-time RT-PCR had an apparent sensitivity 100-fold greater than that of a standard RT-PCR: the JDV pol TaqMan real-time RT-PCR detected virus in samples diluted to contain an estimated 2.16 x 105 viruses/ml within 35 cycles, whereas the standard RT-PCR detected virus in samples containing a minimum 3.9 x 107 viruses/ml.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 2. TaqMan real-time RT-PCR using serial dilutions of viral RNA as a template. (A) Gel electrophoresis of TaqMan RT-PCR results. Lane 1, 1-kb-plus ladder (Invitrogen, Australia); lane 2, undiluted RNA sample; lane 3, 10–1 dilution; lane 4, 10–2 dilution; lane 5, 10–3 dilution; lane 6, 10–4 dilution; lane 7, 10–5 dilution; lane 8, 10–6 dilution; lane 9, ultrapure water. (B) Amplification plot generated during a standard TaqMan RT-PCR using the same RNA samples (linear representation). The RNA dilutions and baseline threshold are indicated. {Delta}Rn, recorded fluorescence emission adjusted for the baseline fluorescence.

 
Viral dynamics during the acute phase of clinical disease. The JDV pol TaqMan real-time RT-PCR was used to quantify the changes in circulating JDV RNA genome copy number during the acute phase of infection. Three experimentally infected animals (animals CB61, CB62, and CB63) were monitored and sampled daily to provide a greater understanding of the viral dynamics during the initial stages of JDV infection. In these experimentally infected animals, the changes in circulating JDV corresponded with the rectal temperatures (Fig. 3). The transient detection of circulating RNA in two of the three animals (animals CB62 and CB63) prior to the onset of a febrile response was not an uncommon occurrence and was observed in a number of other animals (Fig. 3).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 3. Febrile response and viral dynamics of circulating JDV RNA in the plasma during the acute phase of infection for animal CB61, animal CB62, and animal CB63. The animals were challenged with approximately 1,000 ID50 of Tabanan/87 strain of JDV on day 0. The daily rectal temperatures (°C) of each animal (bars) and the level of JDV genome copies/ml (dots) are shown. The results for samples with amounts below the limit of detection are not depicted.

 
There was a similar pattern of events after infection in all animals with respect to an increased rectal temperature and a concurrent increase in circulating virus levels. One day prior to the onset of fever (rectal temperature, ≥39.5°C), there was a rapid increase in viral replication and between 107 and 1010 JDV RNA copies/ml were detected in all animals (Fig. 3). The levels of circulating virus RNA reached a plateau during the febrile period, with titers consistently above 1010 copies/ml.

As the febrile response waned, the number of circulating RNA copies declined (Fig. 3). In one animal (animal CB61) (Fig. 3) there was a marked reduction in circulating JDV genome copies/ml 13 days after infection. Repeated examination of the sample did not indicate an error associated with amplification, as the CT value did not change between assays, but the transient decrease may have been associated with an error in sample processing or RNA extraction.

Sensitivity and reproducibility of the JDVp26 antigen capture ELISA. Monoclonal antibody BC10 was successfully used to detect concentrations of recombinant JDVp26 of between 10 and 200 ng/ml (Fig. 4). Protein concentrations less than 11.7 ng/ml were not reliably detected, and concentrations greater than 187.5 ng/ml became nonlinear. A standard curve was derived by using recombinant JDVp26 protein, and this was used to estimate the levels of JDVp26 in plasma. The standard prepared for each ELISA plate tested was reproducible on different days {optical density at 450 nm (OD450) = [0.00001 x (JDVp26, in ng/ml)2] + [0.011 x (JDVp26 ng/ml)] + 0.324} (R = 0.999; P < 0.001) (Fig. 4).



View larger version (9K):
[in this window]
[in a new window]
 
FIG. 4. Reproducibility of standard curve of recombinant JDVp26 protein detected by antigen capture ELISA. The concentrations of JDVp26 protein were measured in duplicate for each capture ELISA plate, and the mean and standard deviations were plotted against the OD450.

 
When 1:100 dilutions of plasma samples were tested, various levels of JDVp26 were measurable in 54 of the 142 plasma samples available for analysis. An additional six samples contained JDVp26 at levels above the measurable limit of the test, even when they were diluted 1:100. The remainder of the plasma samples were either JDVp26 negative or contained levels below the limit of detection of the test. For the six samples with JDVp26 levels above the measurable limit of the test, dilutions of up to 1:1,000 were required to obtain OD450 readings in the linear range of the standard curve. These six plasma samples were obtained from cattle during the acute phase of viral replication, which coincided with the peak febrile response to infection.

Monoclonal antibody BC1, with reactivity to a different region of the JDV capsid than BC10, was tested as an alternative capture antibody but was found to give a lower sensitivity than BC10 (data not shown).

Correlation of p26 antigen and JDV RNA copy numbers. A significant positive correlation between the concentration of JDVp26 antigen and the number of copies of JDV RNA/ml in 48 of 142 JDV-infected plasma samples was observed (Fig. 5). The statistical analysis of the linear regression produced by the correlation demonstrated a strong Spearman rank correlation (R = 0.860) and a good result by analysis of variance (r2 = 0.744) when values outside the detection limits of the ELISA were excluded (Fig. 5). All experimentally infected animals positive by the JDVp26 antigen capture ELISA had detectable viral RNA by the TaqMan real-time RT-PCR. Due to the relative lack of sensitivity of the JDVp26 antigen capture ELISA, the samples available to correlate the JDV genome copies/ml and JDVp26 concentration (ng/ml) were obtained from cattle during the acute phase of disease, when the number of viral RNA copies/ml was 108 or above.



View larger version (9K):
[in this window]
[in a new window]
 
FIG. 5. Correlation of the levels of JDVp26 antigen (ng/ml) and JDV RNA (number of copies/ml) from 48 plasma samples. The correlation coefficient was 0.860, and the equation used to determine the log10 amount of viral RNA/ml was (log10 JDVp26 (ng/ml) x 0.7) + 9.188 (n = 48; r2 = 0.744; P < 0.0001).

 
Comparison of p26 antigen and JDV RNA copy numbers with previous bioassay data. The previously reported animal bioassays estimating ID50/ml in cattle at intervals after JDV infection (34) were compared to the JDV RNA and JDVp26 antigen levels obtained in infected cattle. All the data were normalized to the days after the onset of fever, and the estimated viral titers were compared (Fig. 6). A complete comparison for all days during the acute febrile phase of disease was not possible, as the JDVp26 data and the previous bioassay data were incomplete. The three assays followed a similar pattern, with the viral load increasing just prior to the start of the febrile period, reaching a peak about 3 to 4 days after the initial onset of fever and then slowly declining (Fig. 6). The TaqMan assay-derived JDV RNA concentrations consistently provided estimates of virus load that were greater than those obtained by the bioassays that measured ID50/ml (Fig. 6).



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 6. Comparison during the acute phase of JDV infection of the estimated titer of virus generated from three sets of data: the previously reported animal bioassay (ID50/ml) data (33), the predicted number of RNA genome copies/ml determined by the JDV pol TaqMan real-time RT-PCR, and the capsid levels were determined by the JDVp26 antigen capture ELISA. The data were normalized to the onset of fever (rectal temperature, ≥39.5°C) after JDV infection. Bioassay ID50/ml data (34) are indicated by the black columns, the numbers of RNA genome copies/ml generated by TaqMan real-time RT-PCR are indicated by the white columns, and the capsid levels were determined by JDVp26 capture ELISA are indicated by the striped columns. Bars indicate standard deviations when sample numbers were >1.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The real-time RT-PCR method developed for the quantification of the viral RNA load in plasma was both sensitive and robust. The single-step reaction produced a linear result over a broad 8-log10 range, from 9.8 x 102 to 3.89 x 1010 JDV genome copies/reaction mixture. This was less sensitive than some other assays for lentivirus RNA that have been reported. As few as 50 copies/ml of simian immunodeficiency virus and HIV were detected in a similar volume of plasma (9, 18), and it may be possible to further increase the sensitivity of this assay for JDV RNA. The sensitivities of several published lentivirus fluorogenic assays have been increased by alteration of the agents used for RNA extraction and use of an increased initial volume of plasma for extraction (33), the ultracentrifugation of plasma followed by suspension in HIV-negative plasma prior to extraction (8), and the use of a two-step RT-PCR procedure rather than a one-step RT-PCR procedure (18). A single-step protocol rather than a two-step procedure was preferred in the current study, as it was less labor-intensive and required less sample handling, thereby reducing the processing time and the risk of sample contamination with large numbers of samples.

The use of TaqMan real-time RT-PCR is not feasible in every laboratory situation, and therefore, it was important that a simple and economical method that would facilitate monitoring of viral antigen be designed. The JDVp26 capture ELISA facilitated monitoring and detection of a circulating viral antigen during the acute phase of disease. The changes in the JDVp26 concentration during the acute phase of disease followed a trend similar to that observed with the changes in viral RNA genome copies. The observed trend was supported by a significant correlation between the JDVp26 concentration and the JDV RNA copy number (R = 0.860) and was comparable to those observed between HIV-1 p24 antigen and HIV-1 RNA copies by Nadal et al. (27) and Ribas et al. (29). Earlier research suggested that there was no close correlation between these two markers of HIV-1 infection (40); however, recent research has demonstrated that the HIV-1 capsid and RNA levels are good indicators of circulating virus and that the reverse transcriptase assay is the best method for the determination of infectious HIV-1 titers (24).

Unfortunately, the sensitivity of the JDVp26 capture ELISA was not sufficient to detect circulating p26 prior to the acute febrile response or postrecovery, when low levels of circulating virus are present. This limits its use to that as a research tool for monitoring the changes in JDVp26 in experimentally infected animals, although it would have an application as a diagnostic tool for animals presenting during the acute febrile response. The sensitivity of the JDV capture ELISA could possibly be improved by a number of procedures that have been reported by others for the detection of lentivirus capsid protein levels. Antigen capture ELISAs for the monitoring of HIV treatment have recently enjoyed a renaissance (22, 33), and the sensitivities of these tests have increased to the same levels as TaqMan-based methods without the associated costs in reagents and processing time. Heat denaturation of immune complexes was used to improve the sensitivity of the HIV-1 p24 capture ELISA (22), although this would be unlikely to have an effect with JDV, as JDV capsid antibodies are not detected until at least 6 weeks postinfection (17). Increased sensitivity might be achieved with the use of a tyramide-based signal amplification substrate (2), which has been shown to allow the detection of as little as 0.5 pg/ml of HIV-1 p24 antigen (27). Detection of dengue virus NS1 was significantly affected by the choice of capture monoclonal antibodies (44), and it is possible that the JDVp26 antigen ELISA could be improved when further JDVp26 monoclonal antibodies become available for testing. It was noted that the JDV capsid monoclonal antibody used, BC10, provided greater sensitivity than another anti-JDV capsid monoclonal antibody, BC1.

The specificity of the BC10 capture antibody used in this ELISA has been mapped to the C terminus of the capsid protein and is probably reactive with the major homology region, which has been reported to be an immunodominant cross-reactive epitope in the capsid protein of several lentiviruses (14). This suggests that, in theory, the JDVp26 capture ELISA could be used to detect the closely related bovine lentivirus bovine immunodeficiency virus, as well as JDV infections, as their capsid proteins have several cross-reacting epitope domains (10), and it is unlikely that it would discriminate between the two viruses. However, the relative insensitivity of the JDVp26 capture ELISA indicates that it is unlikely to detect circulating bovine immunodeficiency virus in infected animals, where only low titers of virus are thought to be present circulating in plasma (39).

The estimates of circulating JDV in the plasma determined by using an indirect method of quantification provided virus titers that were consistently higher than those reported previously by the use of bioassays, where ID50/ml results were determined by titration of the virus by using cattle as indicator hosts (35). This is not an unexpected phenomenon, as infectious virus is often a small component of total circulating virus (7, 24, 40). One estimate was that only 1% of HIV-1 particles circulating in plasma are infectious (7), and another was that the ratio of infectious HIV-1 to total circulating virus in plasma ranged from 1 in 477 to 1 in 117,803 (30). The reason for the difference between the titer of infectious virus and the total HIV-1 RNA load has been associated with the presence of neutralizing antibody, the loss of the viral envelope, the presence of genetically defective virus, and the loss of virus infectivity during collection and transport of plasma. Factors that might account for some of the discrepancies are the apparent instability of JDV in plasma, the infectivity of which was demonstrated to be reduced from approximately 108 to 102 ID50/ml at 4°C over 24 h and by 4 to 5 log10 after one freeze-thaw cycle (20). In comparison, the infectivity of HIV-1 did not significantly decrease at 4°C over 3 days (7, 26), and HIV-1 can be repeatedly frozen and thawed without a significant effect on the infectious titer (7). There were subtle differences in the method used for the collection and processing of the plasma samples used in the JDV bioassays (35) and those reported in this study that may account for some of the differences observed. The plasma for the bioassays was collected by using heparin as an anticoagulant, while EDTA was used in this study. With HIV-1, EDTA has been shown to protect viral RNA from degradation (11, 13, 19, 21, 25), while heparin maintained viral infectivity (7, 43).

While a previous study of the kinetics of the replication of JDV during Jembrana disease was conducted by using bioassays (33), that study was incomplete and was based on very few datum points because of the cost of the experiments. The use of the RT-PCR and JDVp26 capture ELISA has enabled the first complete investigation of the JDV components circulating in plasma during the acute phase of Jembrana disease. The results provide additional information but are broadly comparable to the data generated during animal bioassay experiments (34). The use of the JDVp26 antigen capture ELISA in Indonesia allows monitoring of the changes in circulating viral antigens during vaccination trials. The analysis of the viral RNA load in plasma supports the previous findings that JDV has a short incubation period prior to the onset of an acute disease phase, characterized by high viral titers (34, 35). The data support the results of previous bioassays (33) indicating that a detectable virus load of up to 105 viruses/ml is present in the period immediately prior to the onset of the acute febrile period that developed after a short incubation period. There was then a rapid increase in circulating virus concurrent with the development of the febrile period, with very high virus titers of up to 1012 virus/ml. The dynamics of JDV infection were consistent with the dynamics of other lentivirus infections (23, 28, 31, 38, 45). The levels of JDV genome copies/ml detected in the three infected animals demonstrated variation between the animals in respect to the amount of virus circulating in plasma, with the greatest variation observed in the pre- and postfebrile periods of infection. The variation decreases as peak viremia is reached, confirming the observations of Soeharsono et al. (35) that similar viral titers are obtained irrespective of the titer of the challenge dose. The variations in circulating viral RNA copy number before and after the acute phase of infection have been widely documented for other lentiviruses (18, 28, 31).


    ACKNOWLEDGMENTS
 
We are grateful to the research team at the Disease Investigation Centre, Denpasar, for assistance with the animal experiments and processing of blood samples. We sincerely thank J. Brownlie from the Royal Veterinary College, United Kingdom, for the polyclonal rabbit anti-JDVp26 serum.

This research was supported by the Australian Centre for International Agricultural Research (project AS1/2000/029).

All animal research complied with the ethical guidelines at the Disease Investigation Centre, Denpasar.


    FOOTNOTES
 
* Corresponding author. Mailing address: School of Veterinary and Biomedical Science, Murdoch University, South St., Murdoch, WA 6150, Australia. Phone: 61 (0)8 93606714. Fax: 61 (0)8 9310 4144. E-mail: mdesport{at}murdoch.edu.au. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402.[Abstract/Free Full Text]
  2. Bobrow, M. N., T. D. Harris, K. J. Shaughnessy, and G. J. Litt. 1989. Catalyzed reporter deposition, a novel method of signal amplification. Application to immunoassays. J. Immunol. Methods 125:279-285.[CrossRef][Medline]
  3. Bustin, S. A. 2002. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J. Mol. Endocrinol. 29:23-39.[Abstract]
  4. Chadwick, B. J., R. J. Coelen, G. E. Wilcox, L. M. Sammels, and G. Kertayadnya. 1995. Nucleotide sequence analysis of Jembrana disease virus: a bovine lentivirus associated with an acute disease syndrome. J. Gen. Virol. 76:1637-1650.[Abstract/Free Full Text]
  5. Che, X. Y., L. W. Qiu, Y. X. Pan, K. Wen, W. Hao, L. Y. Zhang, Y. D. Wang, Z. Y. Liao, X. Hua, V. C. Cheng, and K. Y. Yuen. 2004. Sensitive and specific monoclonal antibody-based capture enzyme immunoassay for detection of nucleocapsid antigen in sera from patients with severe acute respiratory syndrome. J. Clin. Microbiol. 42:2629-2635.[Abstract/Free Full Text]
  6. Cook, R. F., S. J. Cook, F. L. Li, R. C. Montelaro, and C. J. Issel. 2002. Development of a multiplex real-time reverse transcriptase-polymerase chain reaction for equine infectious anemia virus (EIAV). J. Virol. Methods 105:171-179.[CrossRef][Medline]
  7. Coombs, R. W., D. R. Henrard, W. F. Mehaffey, J. Gibson, E. Eggert, T. C. Quinn, and J. Phillips. 1993. Cell-free plasma human immunodeficiency virus type 1 titer assessed by culture and immunocapture-reverse transcription-polymerase chain reaction. J. Clin. Microbiol. 31:1980-1986.[Abstract/Free Full Text]
  8. Damond, F., M. Gueudin, S. Pueyo, I. Farfara, D. L. Robertson, D. Descamps, G. Chene, S. Matheron, P. Campa, F. Brun-Vezinet, and F. Simon. 2002. Plasma RNA viral load in human immunodeficiency virus type 2 subtype A and subtype B infections. J. Clin. Microbiol. 40:3654-3659.[Abstract/Free Full Text]
  9. Demeter, L. M., R. J. Bosch, R. W. Coombs, S. Fiscus, J. Bremer, V. A. Johnson, A. Erice, J. B. Jackson, S. A. Spector, K. M. Squires, M. A. Fischl, M. D. Hughes, and S. M. Hammer. 2002. Detection of replication-competent human immunodeficiency virus type 1 (HIV-1) in cultures from patients with levels of HIV-1 RNA in plasma suppressed to less than 500 or 50 copies per milliliter. J. Clin. Microbiol. 40:2089-2094.[Abstract/Free Full Text]
  10. Desport, M., M. E. Stewart, C. A. Sheridan, W. G. Ditcham, S. Setiyaningsih, W. M. Tenaya, N. Hartaningsih, and G. E. Wilcox. 2005. Recombinant Jembrana disease virus gag proteins identify several different antigenic domains but do not facilitate serological differentiation of JDV and nonpathogenic bovine lentiviruses. J. Virol. Methods 124:135-142.[CrossRef][Medline]
  11. Dickover, R. E., S. A. Herman, K. Saddiq, D. Wafer, M. Dillon, and Y. J. Bryson. 1998. Optimization of specimen-handling procedures for accurate quantitation of levels of human immunodeficiency virus RNA in plasma by reverse transcriptase PCR. J. Clin. Microbiol. 36:1070-1073.[Abstract/Free Full Text]
  12. Diehl, L. J., C. K. Mathiason-DuBard, L. L. O'Neil, and E. A. Hoover. 1995. Longitudinal assessment of feline immunodeficiency virus kinetics in plasma by use of a quantitative competitive reverse transcriptase PCR. J. Virol. 69:2328-2332.[Abstract]
  13. Ginocchio, C. C., X. P. Wang, M. H. Kaplan, G. Mulligan, D. Witt, J. W. Romano, M. Cronin, and R. Carroll. 1997. Effects of specimen collection, processing, and storage conditions on stability of human immunodeficiency virus type 1 RNA levels in plasma. J. Clin. Microbiol. 35:2886-2893.[Abstract]
  14. Grund, C. H., E. R. Lechman, C. J. Issel, R. C. Montelaro, and K. E. Rushlow. 1994. Lentivirus cross-reactive determinants present in the capsid protein of equine infectious anaemia virus. J. Gen. Virol. 75(Pt 3):657-662.[Abstract/Free Full Text]
  15. Haase, A. T., K. Henry, M. Zupancic, G. Sedgewick, R. A. Faust, H. Melroe, W. Cavert, K. Gebhard, K. Staskus, Z. Q. Zhang, P. J. Dailey, H. H. Balfour, Jr., A. Erice, and A. S. Perelson. 1996. Quantitative image analysis of HIV-1 infection in lymphoid tissue. Science 274:985-989.[Abstract/Free Full Text]
  16. Hartaningsih, N., D. M. Dharma, S. Soeharsono, and G. E. Wilcox. 2001. The induction of a protective immunity against Jembrana disease in cattle by vaccination with inactivated tissue-derived virus antigens. Vet. Immunol. Immunopathol. 78:163-176.[CrossRef][Medline]
  17. Hartaningsih, N., G. E. Wilcox, G. Kertayadnya, and M. Astawa. 1994. Antibody response to Jembrana disease virus in Bali cattle. Vet. Microbiol. 39:15-23.[CrossRef][Medline]
  18. Hofmann-Lehmann, R., R. K. Swenerton, V. Liska, C. M. Leutenegger, H. Lutz, H. M. McClure, and R. M. Ruprecht. 2000. Sensitive and robust one-tube real-time reverse transcriptase-polymerase chain reaction to quantify SIV RNA load: comparison of one- versus two-enzyme systems. AIDS Res. Hum. Retrovir. 16:1247-1257.[CrossRef][Medline]
  19. Holodniy, M., L. Mole, B. Yen-Lieberman, D. Margolis, C. Starkey, R. Carroll, T. Spahlinger, J. Todd, and J. B. Jackson. 1995. Comparative stabilities of quantitative human immunodeficiency virus RNA in plasma from samples collected in VACUTAINER CPT, VACUTAINER PPT, and standard VACUTAINER tubes. J. Clin. Microbiol. 33:1562-1566.[Abstract]
  20. Kertayadnya, G., G. E. Wilcox, S. Soeharsono, N. Hartaningsih, R. J. Coelen, R. D. Cook, M. E. Collins, and J. Brownlie. 1993. Characteristics of a retrovirus associated with Jembrana disease in Bali cattle. J. Gen. Virol. 74:1765-1778.[Abstract/Free Full Text]
  21. Kirstein, L. M., J. W. Mellors, C. R. Rinaldo, Jr., J. B. Margolick, J. V. Giorgi, J. P. Phair, E. Dietz, P. Gupta, C. H. Sherlock, R. Hogg, J. S. Montaner, and A. Munoz. 1999. Effects of anticoagulant, processing delay, and assay method (branched DNA versus reverse transcriptase PCR) on measurement of human immunodeficiency virus type 1 RNA levels in plasma. J. Clin. Microbiol. 37:2428-2433.[Abstract/Free Full Text]
  22. Ledergerber, B., M. Flepp, J. Boni, Z. Tomasik, R. W. Cone, R. Luthy, and J. Schupbach. 2000. Human immunodeficiency virus type 1 p24 concentration measured by boosted ELISA of heat-denatured plasma correlates with decline in CD4 cells, progression to AIDS, and survival: comparison with viral RNA measurement. J. Infect. Dis. 181:1280-1288.[CrossRef][Medline]
  23. Little, S. J., A. R. McLean, C. A. Spina, D. D. Richman, and D. V. Havlir. 1999. Viral dynamics of acute HIV-1 infection. J. Exp. Med. 190:841-850.[Abstract/Free Full Text]
  24. Marozsan, A. J., E. Fraundorf, A. Abraha, H. Baird, D. Moore, R. Troyer, I. Nankja, and E. J. Arts. 2004. Relationships between infectious titer, capsid protein levels, and reverse transcriptase activities of diverse human immunodeficiency virus type 1 isolates. J. Virol. 78:11130-11141.[Abstract/Free Full Text]
  25. Mole, L., D. Margolis, R. Carroll, J. Todd, and M. Holodniy. 1994. Stabilities of quantitative plasma culture for human immunodeficiency virus, RNA, and p24 antigen from samples collected in VACUTAINER CPT and standard VACUTAINER tubes. J. Clin. Microbiol. 32:2212-2215.[Abstract/Free Full Text]
  26. Moudgil, T., and E. S. Daar. 1993. Infectious decay of human immunodeficiency virus type 1 in plasma. J. Infect. Dis. 167:210-212.[Medline]
  27. Nadal, D., J. Boni, C. Kind, O. E. Varnier, F. Steiner, Z. Tomasik, and J. Schupbach. 1999. Prospective evaluation of amplification-boosted ELISA for heat-denatured p24 antigen for diagnosis and monitoring of pediatric human immunodeficiency virus type 1 infection. J. Infect. Dis. 180:1089-1095.[CrossRef][Medline]
  28. Parker, R. A., M. M. Regan, and K. A. Reimann. 2001. Variability of viral load in plasma of rhesus monkeys inoculated with simian immunodeficiency virus or simian-human immunodeficiency virus: implications for using nonhuman primate AIDS models to test vaccines and therapeutics. J. Virol. 75:11234-11238.[Abstract/Free Full Text]
  29. Ribas, S. G., P. Ondoa, J. Schupbach, G. van der Groen, and K. Fransen. 2003. Performance of a quantitative human immunodeficiency virus type 1 p24 antigen assay on various HIV-1 subtypes for the follow-up of human immunodeficiency type 1 seropositive individuals. J. Virol. Methods 113:29-34.[CrossRef][Medline]
  30. Rusert, P., M. Fischer, B. Joos, C. Leemann, H. Kuster, M. Flepp, S. Bonhoeffer, H. F. Gunthard, and A. Trkola. 2004. Quantification of infectious HIV-1 plasma viral load using a boosted in vitro infection protocol. Virology 326:113-129.[CrossRef][Medline]
  31. Ryan, G., D. Klein, E. Knapp, M. J. Hosie, T. Grimes, M. J. Mabruk, O. Jarrett, and J. J. Callanan. 2003. Dynamics of viral and proviral loads of feline immunodeficiency virus within the feline central nervous system during the acute phase following intravenous infection. J. Virol. 77:7477-7485.[Abstract/Free Full Text]
  32. Sambrook, J., and D. W. Russell (ed.). 2001. Molecular cloning: a laboratory manual, vol. 1, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  33. Schutten, M., B. van den Hoogen, M. E. van der Ende, R. A. Gruters, A. D. Osterhaus, and H. G. Niesters. 2000. Development of a real-time quantitative RT-PCR for the detection of HIV-2 RNA in plasma. J. Virol. Methods 88:81-87.[CrossRef][Medline]
  34. Soeharsono, S., N. Hartaningsih, M. Soetrisno, G. Kertayadnya, and G. E. Wilcox. 1990. Studies of experimental Jembrana disease in Bali cattle. I. Transmission and persistence of the infectious agent in ruminants and pigs, and resistance of recovered cattle to re-infection. J. Comp. Pathol. 103:49-59.[Medline]
  35. Soeharsono, S., G. E. Wilcox, A. A. Putra, N. Hartaningsih, K. Sulistyana, and M. Tenaya. 1995. The transmission of Jembrana disease, a lentivirus disease of Bos javanicus cattle. Epidemiol. Infect. 115:367-374.[Medline]
  36. Soesanto, M., S. Soeharsono, A. Budiantono, K. Sulistyana, M. Tenaya, and G. E. Wilcox. 1990. Studies on experimental Jembrana disease in Bali cattle. II. Clinical signs and haematological changes. J. Comp. Pathol. 103:61-71.[Medline]
  37. Sutthent, R., N. Gaudart, K. Chokpaibulkit, N. Tanliang, C. Kanoksinsombath, and P. Chaisilwatana. 2003. p24 antigen detection assay modified with a booster step for diagnosis and monitoring of human immunodeficiency virus type 1 infection. J. Clin. Microbiol. 41:1016-1022.[Abstract/Free Full Text]
  38. Ten Haaft, P., B. Verstrepen, K. Uberla, B. Rosenwirth, and J. Heeney. 1998. A pathogenic threshold of virus load defined in simian immunodeficiency virus- or simian-human immunodeficiency virus-infected macaques. J. Virol. 72:10281-10285.[Abstract/Free Full Text]
  39. Van Der Maaten, M. J., and C. A. Whetstone. 1992. Infection of rabbits with bovine immunodeficiency-like virus. Vet. Microbiol. 30:125-135.[CrossRef][Medline]
  40. Van Kerckhoven, I., K. Fransen, M. Peeters, H. De Beenhouwer, P. Piot, and G. van der Groen. 1994. Quantification of human immunodeficiency virus in plasma by RNA PCR, viral culture, and p24 antigen detection. J. Clin. Microbiol. 32:1669-1673.[Abstract/Free Full Text]
  41. Wilcox, G. E. 1997. Jembrana disease. Aust. Vet. J. 75:492-493.[Medline]
  42. Wilcox, G. E., G. Kertayadnya, N. Hartaningsih, D. M. Dharma, S. Soeharsono, and T. Robertson. 1992. Evidence for a viral aetiology of Jembrana disease in Bali cattle. Vet. Microbiol. 33:367-374.[CrossRef][Medline]
  43. Wu, S. C., J. L. Spouge, S. R. Conley, W. P. Tsai, M. J. Merges, and P. L. Nara. 1995. Human plasma enhances the infectivity of primary human immunodeficiency virus type 1 isolates in peripheral blood mononuclear cells and monocyte-derived macrophages. J. Virol. 69:6054-6062.[Abstract]
  44. Young, P. R., P. A. Hilditch, C. Bletchly, and W. Halloran. 2000. An antigen capture enzyme-linked immunosorbent assay reveals high levels of the dengue virus protein NS1 in the sera of infected patients. J. Clin. Microbiol. 38:1053-1057.[Abstract/Free Full Text]
  45. Zhang, Z., N. J. Watt, J. Hopkins, G. Harkiss, and C. J. Woodall. 2000. Quantitative analysis of maedi-visna virus DNA load in peripheral blood monocytes and alveolar macrophages. J. Virol. Methods 86:13-20.[CrossRef][Medline]


Journal of Clinical Microbiology, November 2005, p. 5574-5580, Vol. 43, No. 11
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.11.5574-5580.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stewart, M.
Right arrow Articles by Wilcox, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stewart, M.
Right arrow Articles by Wilcox, G.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Antimicrob. Agents Chemother. Clin. Microbiol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS