Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Garmendia, J. Articles by Frankel, G. Search for Related Content PubMed PubMed Citation Articles by Garmendia, J. Articles by Frankel, G.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, November 2005, p. 5715-5720, Vol. 43, No. 11
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.11.5715-5720.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Distribution of tccP in Clinical Enterohemorrhagic and Enteropathogenic Escherichia coli Isolates

Junkal Garmendia,^1, Zhihong Ren,^2, Sharon Tennant,^3, Monica Aparecida Midolli Viera,^4, Yuwen Chong,^5, Andrew Whale,^1, Kristy Azzopardi,⁷ Sivan Dahan,¹ Marcelo Palma Sircili,⁶ Marcia Regina Franzolin,⁶ Luiz R. Trabulsi,⁶ Alan Phillips,⁵ Tânia A. T. Gomes,⁴ Jianguo Xu,² Roy Robins-Browne,³ and Gad Frankel^1*

Centre for Molecular Microbiology and Infection, Department of Biological Sciences, Imperial College London, London, United Kingdom,¹ State Key Laboratory for Infectious Disease Prevention and Control, National Institute for Communicable Diseases Control and Prevention, China CDC, Beijing, China,² Department of Microbiology and Immunology; University of Melbourne,³ Murdoch Childrens Research Institute, Royal Children's Hospital, Victoria, Australia,⁷ Departamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de Sao Paulo, Sao Paulo, Brazil,⁴ Centre for Paediatric Gastroenterology, Royal Free and University College Medical School, London, United Kingdom,⁵ Laboratorio Especial de Microbiologia, Instituto Butanta, Sao Paulo, Brazil⁶

Received 14 April 2005/ Returned for modification 7 July 2005/ Accepted 17 August 2005

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Enterohemorrhagic Escherichia coli (EHEC) and enteropathogenic E. coli (EPEC) are diarrheagenic pathogens that colonize the gut through the formation of attaching and effacing lesions, which depend on the translocation of effector proteins via a locus of enterocyte effacement-encoded type III secretion system. Recently, two effector proteins, EspJ and TccP, which are encoded by adjacent genes on prophage CP-933U in EHEC O157:H7, have been identified. TccP consists of a unique N-terminus region and several proline-rich domains. In this project we determined the distribution of tccP in O157:H7, in non-O157 EHEC, and in typical and atypical EPEC isolates. All the EHEC O157:H7 strains tested were tccP⁺. Unexpectedly, tccP was also found in non-O157 EHEC, and in typical and atypical EPEC isolates, particularly in strains belonging to serogroups O26 (EHEC), O119 (typical EPEC), and O55 (atypical EPEC). We recorded some variation in the length of tccP, which reflects diversity in the number of the proline-rich repeats. These results show the existence of a class of "attaching and effacing" pathogens which express a combination of EPEC and EHEC virulence determinants.

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Enteric bacteria have a conserved core genomic organization that is widespread in both commensal and pathogenic strains. The core genomic structure equips the bacteria with mechanisms required for survival in the gut and the ability to transfer between hosts and survive in the environment. In pathogenic bacteria, genetic islands are often associated with virulence and are dotted along the conserved core genome (6). Prominent examples of such pathogenic bacteria are the diarrheal agents enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic E. coli (EHEC), the latter also being known as verocytotoxin-producing E. coli or Shiga toxin-producing E. coli (23).

EHEC strains cause a wide spectrum of illnesses ranging from mild diarrhea to severe diseases, such as hemorrhagic colitis and the hemolytic uremic syndrome (HUS). EHEC-induced HUS is now the leading cause of acute pediatric renal failure in developed countries and is caused by potent bacterial verocytotoxins (VT), also known as Shiga toxins (Stx), which cross the gut epithelium and spread systemically to damage small blood vessels, in particular, those of the kidney. There are two major types of VT referred to as VT1 and VT2 (26).

Strains of EHEC belonging to serogroup O157 are most commonly associated with severe human disease (29), but non-O157 EHEC are an emerging threat to human and animal health. EHEC can be isolated directly from the feces of large farm animals, in particular, calves and adult cattle, which represent an important source of human infection (24). Humans can become infected with EHEC through the consumption of contaminated food or by direct transmission from infected animals or humans.

EPEC is a frequent cause of infantile diarrhea in the developing world (4). EPEC strains are split into two evolutionally distinct lineages known as EPEC 1 (characteristically expressing flagellar antigen H6) and EPEC 2 (characteristically expressing flagellar antigen H2) (7). EPEC strains are also divided into typical (defined by the presence of the EAF plasmid which encodes the bundle-forming pilus) (13) and atypical (lacking the EAF plasmid) (27). The major O serogroups of typical EPEC are O55, O86, O111, O119, O127, and O142, while atypical EPEC strains consist of a large number of O serogroups (27).

The hallmark of EHEC and EPEC infections is their ability to colonize the intestinal mucosa and produce characteristic "attaching and effacing" (A/E) lesions (9, 23). A/E lesions are characterized by effacement of the brush border microvilli and intimate attachment of the bacterium to the enterocyte plasma membrane (21). In addition, infected cells produce elongated pedestal-like, actin-rich structures at the site of intimate bacterial adhesion (9).

The EPEC and EHEC genes encoding A/E lesion formation and actin polymerization map mostly to a pathogenicity island termed the locus of enterocyte effacement (22). In common with other enteric pathogens (e.g., Salmonella, Shigella, and Yersinia spp.), EPEC and EHEC employ a type III secretion system (18) to inject effector virulence proteins into host cells which interfere with eukaryotic cell physiology and function. Within the locus of enterocyte effacement, Tir, Map, EspF, EspG, EspH, and EspZ are known effector proteins that are translocated into host cells (11). Importantly, none of the above-named effectors, except Tir (20), plays a direct role in A/E lesion formation and actin polymerization.

Following translocation, Tir is targeted to the plasma membrane, where it adopts a hairpin loop topology (16). The extracellular, central, Tir domain binds the bacterial outer membrane adhesion molecule intimin (8), while the intracellular amino and carboxyl termini interact with a number of focal adhesion and cytoskeletal proteins linking the extracellular bacterium to the cell cytoskeleton (3). Although both pathways converge on the N-WASP and Arp2/3 complex, Tir-mediated actin accretion by EPEC and EHEC differ in that Tir_EPEC requires tyrosine (Y474) phosphorylation (19) and the N-WASP activator protein Nck (15), whereas Tir_EHEC is lacking a Y474 equivalent and utilizes a bacterial-encoded N-WASP activator—the effector protein TccP (Tir-cytoskeleton coupling protein) (12) (also known as EspF_U) (2). TccP is only the second effector after Tir that plays a direct role in EHEC-induced actin polymerization.

TccP belongs to a growing number of prophage-carried effector proteins that have been identified recently (reviewed in reference 11). tccP is carried on prophage CP-933U, forming an operon with the upstream gene espJ (10), which encodes another effector protein. EspJ was shown to influence the dynamics of clearance of the pathogen from the host's intestinal tract, suggesting a role in host survival and pathogen transmission in vivo; EspJ is not required for A/E lesion formation in cultured cells and ex vivo (5). Significantly, while espJ has been found in all the genomes of the sequenced A/E lesion-forming bacteria, tccP was exclusively found in the genomes of two sequenced EHEC O157:H7 isolates, EDL933 (25) and Sakai (17) strains. The main aim of this study was to survey a collection of EHEC and EPEC strains (934 isolates in total), isolated from humans, animals, and food, for the presence of tccP by PCR. The secondary aim of this investigation was to determine the prevalence of espJ among the tccP⁺ strains. To this end, we formed a network of laboratories in Australia, Brazil, China, and the United Kingdom interested in the epidemiology of EHEC and EPEC infection and standardized a PCR detection system for tccP and espJ.

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Bacterial strains. The bacterial strains used in this study included 365 EHEC O157, 200 non-O157 EHEC, 105 typical EPEC, and 264 atypical EPEC strains. These strains are part of laboratory collections in the participating institutes.

Detection of tccP and espJ by PCR. tccP was amplified by colony PCR using tccP-F1 (5'-ATGATTAACAATGTTTCTTCACTT) and tccP-R1 (5'-TCACGAGCGCTTAGATGTATTAATGCC) forward and reverse primers (30 cycles of 94°C for 1 min, 58°C for 1 min, and 72°C for 1 min), which anneal to the 5' and 3' ends of tccP, respectively. The identity of representative PCR products was confirmed by DNA sequencing. espJ was amplified using primers to detect the EHEC O157:H7 espJ gene (forward primer 5' ATGTCAATTATAAAAAACTGCTTATC and reverse primer 5' TTTTTTGAGAGGATATATGTCAAC) (16, 24) (30 cycles of 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min) and the EPEC O127:H6 espJ gene (forward primer 5' ATGCCAATCATAAAGAACTGC and reverse primer 5' TTTTTTGAGTGGGTGGATAT) (http://www.sanger.ac.uk/Projects/Escherichia_Shigella/) (30 cycles of 94°C for 1 min, 52°C for 1 min, and 72°C for 1 min). Genomic DNA from the EHEC O157:H7 EDL933 and EPEC O126:H6 E2348/69 strains were used as controls; of note is the fact that due to sequence variation the primers used in this screen might not amplify all the tccP/espJ variants.

Detection of Tir tyrosine phosphorylation by immunofluorescence. HEp-2 cells were grown in Dulbecco's modified Eagle medium supplemented with 10% fetal calf serum and 2 mM glutamine at 37°C in 5% CO₂. Cells were seeded onto glass coverslips (12-mm diameter) in 24-well plates at a density of 5 x 10⁴ cells per well. Bacteria for infection assays were grown in brain heart infusion overnight standing cultures at 37°C and added to HEp-2 cells at a multiplicity of infection of 100:1. Monolayers were infected for 6 h, fixed in formalin for 15 min at room temperature, and permeabilized in 0.1% Triton X-100. The cells were then incubated for 60 min at room temperature with mouse monoclonal antiphosphotyrosine clone PT-66 (Sigma) (diluted 1:40), washed with phosphate-buffered saline, and incubated for a further 30 min with fluorescein isothiocyanate-conjugated goat anti-mouse antibody (Sigma) (diluted 1:40). Coverslips were washed, mounted on Aqua Poly/Mount (Polysciences) and analyzed using a Zeiss Universal fluorescence microscope.

Nucleotide sequence accession numbers. The accession numbers of the different tir sequences are DQ007019 to DQ007024.

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Prevalence of tccP in EHEC O157:H7. A total of 365 EHEC O157:H7 strains were tested (Table 1), of which 234 were isolated in China (30, 31). Of the 234 strains, 191 carried the VT2 gene, 42 strains carried both VT1 and VT2 genes, and only one strain carried the VT1 gene. All 234 strains were tccP⁺/espJ⁺. However, while 32 of the 191 VT2 gene-positive strains (16.2%) carried a tccP gene that was smaller (ranging from 700 to 1,000 bp) than the prototype gene (1,150 bp) present in EHEC strain EDL933 (Z3072) (25), no variability in the length of tccP was recorded among strains carrying both VT1 and VT2 genes. Interestingly, tccP in EHEC strain Sakai is only 1,014 bp long (ECs2715) (17).

View this table: [in this window] [in a new window]

TABLE 1. Distribution of tccP among 361 EHEC O157 strains

Sequencing the 700-bp (two strains), 1,000-bp (one strain), and 1,150-bp (one strain) PCR products revealed that the predicted proteins consist of the 87 N-terminal amino acids and three, five, and six proline-rich repeats, respectively.

An additional 127 EHEC O157:H7 strains were tested in Australia (Table 1). The strains were isolated in different countries and were of human, animal, or food origin. Nineteen of the strains carried the VT1 gene, 34 strains carried both the VT1 and VT2 genes, and 18 strains carried the VT2 gene. The VT gene type was not determined for 56 strains. All 127 strains were tccP⁺ strains, regardless of their country of origin, source, or VT gene type; all the strains yielded a PCR fragment of the prototype tccP gene (1,150 bp). All of the EHEC O157:H7 strains tested in Australia were also espJ⁺.

Four O157:H7 strains (originating in the United States, Argentina, Egypt, and Denmark) were tested in Brazil and found to be tccP⁺ (1,150 kb)/espJ⁺.

In summary, all the 365 O157:H7 stains surveyed in this study were tccP⁺/espJ⁺, and some variation in the tccP gene length was recorded.

Prevalence of tccP in non-O157 EHEC. tccP was detected in 28 of 200 (14%) non-O157 EHEC (eae-positive/VT gene-positive) strains, belonging to different serogroups (Table 2). In particular, tccP was detected in five O26 isolates (four of which yielded a typical 1,150-bp PCR fragment and one of which yielded an 850-bp PCR fragment) and in four O5 strains (two of which yielded a typical 1,150-bp PCR fragment and two of which yielded a 1,000-bp PCR fragment). All nine tccP⁺ strains were espJ⁺. O5 and O26 EHEC strains are commonly associated with diarrhea in farm animals, which imposes a significant economic burden on livestock producers. Only one of 47 EHEC O111 isolates examined was tccP⁺, producing a PCR fragment of 1,000 bp. In contrast, all nine O172 EHEC strains isolated from cows in Hong Kong, and three O98 EHEC strains isolated from the same HUS case (but at different times during the infection), were tccP⁺. The O172 EHEC strains yielded a PCR product of 700 bp, whereas the O98 EHEC strains produced a PCR product of 850 bp. EHEC O156 (one isolate), nontypeable (NT) (four isolates), and rough (R) (one isolate) strains were also tccP⁺ (espJ⁺); three of the NT strains and the R strain yielded an 850-bp tccP PCR fragment.

View this table: [in this window] [in a new window]

TABLE 2. Characteristics of 28 tccP+ non-O157 EHEC strains

Sequencing the PCR products of tccP from strains O4-7G-10 (O172 and VT2 gene [cow]) and 9600608 (O156 [human]) revealed that the predicted proteins consist of the N-terminus domain and three and two proline-rich repeats, respectively.

Considering that EHEC O157:H7 is a recently emerged clone, the finding that all the isolates were tccP⁺ was anticipated. In contrast, the presence of tccP in EHEC strains belonging to serogroups other than O157 was unexpected, particularly as strains for which tir sequences are available (e.g., O26 and O111) possess a tyrosine residue homologous to that of EPEC strain O127:H6 Y474. The function of TccP in these strains and its contribution to commensalism, colonization, and infection of either animal or human intestine are intriguing subjects for further studies.

A total of 172 non-O157 EHEC isolates, from similar origins and sources, were surveyed and found to lack tccP. These strains belonged to the following serogroups (the number of strains is indicated in brackets): O1 (1), O5 (10), O9 (1), O15 (12), O16 (5), O25 (1), O26 (22), O111 (46), O112 (1), O113 (20), O116 (1), O118 (2), O121 (2), O123 (1), O128 (12), O130 (2), O145 (5), O147 (1), O153 (2), O163 (6), O168 (1), NT (13), and R (5).

Prevalence of tccP in atypical O55:H7 EPEC strain. An atypical EPEC strain belonging to serotype O55:H7 is believed to be the progenitor from which EHEC O157:H7 evolved (28). Therefore, it was of particular interest to determine the distribution of tccP among clinical O55:H7 isolates. We tested 18 isolates from Australia, Brazil, Thailand, and the United Kingdom (Table 3). Of these, 15 (83.3%) were tccP⁺, giving rise to PCR products of 850 to 1,300 bp (Table 3). Three O55:H7 strains (isolated in Brazil, Thailand, and United Kingdom) lacked tccP but were espJ⁺.

View this table: [in this window] [in a new window]

TABLE 3. Distribution of tccP in 18 EPEC O55:H7 strains

Consistent with these results, sequence determination of the 3' end of tir of the three strains lacking tccP showed that they all contain an EPEC-like Tir (i.e., having a tyrosine equivalent to Y474 of EPEC O127:H6 strain E2348/69). In contrast, the sequence of the 3' end of tir from representative tccP⁺ strains revealed that they all contain an EHEC (O157:H7)-like Tir (i.e., the equivalent position was occupied by serine) (Fig. 1A). In addition, application of phaloidine actin-staining and phosphotyrosine-specific antibodies (12) to HEp-2 cells infected with the O55:H7 strains revealed that while all the strains triggered actin polymerization under attached bacteria (data not shown), specific phosphotyrosine staining was seen only with the O55 strains lacking tccP; no phosphotyrosine staining was observed following infection with the O55:H7 tccP⁺ strains (Fig. 1B). These results show a correlation between Tir tyrosine phosphorylation and the absence of tccP and, conversely, between the absence of Tir tyrosine phosphorylation and possession of tccP. The results also show the existence of distinct EPEC-like and EHEC-like O55:H7 clones; it is likely that only a clone of the latter category was the progenitor of EHEC O157:H7.

View larger version (96K): [in this window] [in a new window]

FIG. 1. (A) Amino acid alignment of the 12-amino-acid C-terminus region containing the Nck binding site of TirEPEC and Y474 (3). EPEC O55:H7 strain CPG123-G58 (lacking tccP) (accession number DQ007022) has a sequence identical to that of EPEC O127:H6 strain E2348/69 (accession number AF02236). The sequence of the equivalent region of TirEHEC O157:H7 strain EDL93 (24) is identical to that of EPEC O55:H7 strain CPG122-G57 (tccP+) (accession number DQ007019). (B) Phase contrast image showing adhesion of atypical EPEC O55:H7 bacteria without tccP (i) and with tccP (iii) to HEp-2 cells (arrows). Immunofluorescent staining, using antiphosphotyrosine antibody, shows accumulation of tyrosine-phosphorylated proteins beneath attached bacteria in cells infected with O556:H7 lacking tccP (ii) (arrow) but not with tccP+ O55:H7 EPEC (iv). Both strains triggered actin polymerization under attached bacteria (not shown).

Prevalence of tccP in typical EPEC. We screened 105 typical EPEC strains (defined as eae positive, EAF positive, and VT gene negative) belonging to the classical EPEC serogroups for the presence of tccP (Table 4). Out of the 105 strains 21 (20%) were tccP⁺ strains. Twenty of the tccP⁺ strains were isolated in South America (Brazil and Chile), and one strain was isolated in Australia. In particular, 19 of the typical tccP⁺ EPEC strains belonged to a single serotype, O119:H6. Two O119:H6 strains yielded a tccP PCR fragment of the prototype length, one isolate yielded a 550-bp PCR fragment, and another isolate yielded a 1-kb PCR fragment. A PCR product of 850 bp was generated from 15 O119:H6 strains; significantly, two of these strains lacked espJ. In addition, one isolate each of EPEC O55:H- (850 bp) and O86:H34 (850 bp) were tccP⁺. The latter strain lacked espJ. While the O55:H- strain, like EHEC O157:H7, expressed the intimin gamma type, the O86:H34 strain expresses intimin type delta and was the only tccP⁺ strain expressing this intimin type in this survey.

View this table: [in this window] [in a new window]

TABLE 4. Characteristics of 21 tccP+ typical EPECa strains

Sequencing the PCR product of tccP from strain O119:H6 (850 bp) revealed that the predicted protein consists of the N-terminus region and four proline-rich repeats. In addition to TccP, this strain expresses a Tir that contains a Y474 equivalent.

EPEC O119:H6 is associated with diarrhea endemic in Brazil (14). This serogroup belongs to the EPEC 1 lineage, which is typically characterized by H6 and intimin type alpha. However, clinical isolates of O119:H6 are unusual among EPEC 1 strains because, although expressing the flagellar antigen H6, they encode intimin subtype beta (1). The fact that these strains are also tccP⁺ suggests that they have evolved by acquiring diverse virulence determinants from various sources. Revealing the physiological relevance of tccP in these isolates will show whether EPEC O119:H6 represents a group of strains undergoing specialization through acquisition of new virulence determinants and, if so, in which niches or under which environmental conditions the tccP/espJ locus increases fitness and competitiveness. The fact that 2 of the 18 tccP⁺ O119:H6 EPEC strains lack espJ suggests that different selective pressures may operate on these adjacent genes or, alternatively, that the lack of espJ is a consequence of recombination and/or deletions.

A total of 84 typical EPEC isolates, from similar origin and sources, were surveyed and found to lack tccP. The serogroups of these strains were as follows (with the number of strains indicated in brackets): O55 (13), O86 (7), O88 (6), O111 (15), O114 (5), O119 (9), O126 (1), O127 (10), O142 (14), and O145 (4). Importantly, nine O119:H6 lacked tccP, suggesting the existence of several clones within this serotype.

Prevalence of tccP in atypical EPEC. In addition to the 18 O55:H7 strains (Table 3), we screened for the presence of tccP in 246 isolates belonging to the atypical EPEC category (Table 5). We found 10 (4.1%) tccP⁺ atypical EPEC strains; 3 produced a prototype tccP PCR fragment, 5 produced a PCR fragment of 850 bp; 1 produced a PCR product of 1 kb, and another produced a PCR product of 1.3 kb. Three of the strains carried the gene for intimin beta, one possessed the gene for intimin gamma, three carried an NT intimin gene, and in three strains the intimin gene was not classified (Table 5).

View this table: [in this window] [in a new window]

TABLE 5. Characteristics of 10 tccP+ atypical EPECa strains

A total of 236 atypical EPEC isolates, from similar origin and sources, were surveyed and found to lack tccP. These strains belonged to the following serogroups (with the number of strains indicated in brackets): O2 (6), O4 (4), O5 (1), O8 (2), O11 (1), O15 (5), O16 (1), O20 (1), O25 (2), O26 (11), O28 (1), O33 (2), O45 (1), O49 (1), O51 (9), O60 (1), O63 (2), O70 (1), O71 (1), O88 (2), O91 (1), O98 (2), O101 (1), O103 (2), O104 (2), O106 (1), O107 (1), O109 (1), O111 (13), O116 (1), O117 (1), O123 (1), O124 (1), O125 (6), O128 (9), O139 (1), O149 (1), O153 (4), O154 (1), O161 (1), O162 (2), O70/172 (3), NT (85), and R (40).

The prototype tccP gene of EDL933 (1,150 bp) encodes a unique 87-amino-acid terminal domain believed to encompass the secretion and translocation signal and six identical proline-rich repeats, each comprising 47 amino acids (141 bp) (12). On the basis of the distinct PCR fragments that diverged from the prototype gene we assumed that the strains producing shorter PCR fragments represent genes missing one (1,000-bp), two (850-bp), or three (700-bp) repeats, while in strains harboring a longer tccP gene the number of repeats is greater (1,300 bp). Sequencing representative tccP amplicons confirmed this hypothesis. We are currently determining the minimum number of repeats needed for activity.

Results from the atypical EPEC serogroups indicate that, with the exception of serotype O55:H7, the prevalence of tccP is low (<5%). This suggests that acquisition of prophage CP-933U is a current process in the evolution of these pathogens or that there is no selective advantage for strains harboring CP-933U. For unknown reasons we found that among the typical EPEC stains, tccP is most prevalent in serotype O119:H6. These results show the presence of a class of A/E bacteria that express a combination of EPEC and EHEC virulence determinants. Although previous studies of A/E lesion formation have emphasized the divergence between EPEC and EHEC, highlighting the different methods of actin accumulation, the current study indicates a convergence between the two categories. The convergence is perhaps not too surprising in view of the retention of A/E capacity when virulence factors, e.g., intimin, EspA, and EspB, are exchanged between EPEC and EHEC or of the fact that O157:H7 TccP can substitute for host-derived Nck in EPEC infection of Nck-deficient cell lines (2, 12).

The benefit of having TccP in strains expressing tyrosine (Y474)-phosphorylated Tir (such as typical EPEC O119:H6; data not shown) is not apparent. However, it could be advantageous to the bacterium, as A/E lesion formation and colonization might be more efficient if the adaptor linking Tir to the actin cytoskeleton were cotranslocated with Tir or if Tir were coupled to the cytoskeleton simultaneously by Nck and TccP. Alternatively, the selective pressure to maintain the prophage might be driven from another, yet undefined, prophage-carried gene. Further surveys of EPEC and EHEC strains, together with functional analysis of TccP in the EPEC background, are needed in order to elucidate the role played by TccP in these unique bacterial strains.

 
This project was supported by the Wellcome Trust (GF) (as part of the International Partnership Research Award in Veterinary Epidemiology project entitled "Epidemiology and Evolution of Enterobacteriaceae Infections in Humans and Domestic Animals"); The Programa de Apoio a Núcleos de Excelência—PRONEX MCT/CNPq/FAPERJ (T.G.); The National Natural Science Foundation of China (30070042, 30371279) (J.X.); and the Australian National Health and Medical Research Council (R.R.-B.).

 
* Corresponding author. Mailing address: Centre for Molecular Microbiology and Infection, Flowers Building, Division of Molecular and Cellular Biology, Imperial College London, London SW7 2AZ, United Kingdom. Phone: 44 (0) 207594525. Fax: 44 (0) 2075943069. E-mail: g.frankel{at}imperial.ac.uk.

This study is in memory of Luiz R. Trabulsi, who passed away in June 2005.

J.G., Z.R., S.T., M.A.M.V., Y.C., and A.W. contributed equally to this study.

Top Abstract Introduction Materials and Methods Results and Discussion References

 

1
1. Adu-Bobie, J., G. Frankel, C. Bain, A. G. Goncaleves, L. R. Trabulsi, G. Douce, S. Knutton, and G. Dougan. 1998. Detection of intimin , ß, , and , four intimin derivatives expressed by attaching and effacing microbial pathogens. J. Clin. Microbiol. 36:662-668.[Abstract/Free Full Text]
2
2. Campellone, K. G., R. Robbins, and J. M. Leong. 2004. EspF_U is a translocated EHEC effector that interacts with Tir and N-WASP and promotes Nck-independent actin assembly. Dev. Cell 7:217-228.[CrossRef][Medline]
3
3. Campellone, K. G., and J. M. Leong. 2003. Tails of two Tirs: actin pedestal formation by enteropathogenic E. coli and enterohemorrhagic E. coli O157:H7. Curr. Opin. Microbiol. 6:82-90.[CrossRef][Medline]
4
4. Chen, H. D., and G. Frankel. 2005. Enteropathogenic Escherichia coli: unravelling pathogenesis. FEMS Microbiol. Rev. 29:83-98.[CrossRef][Medline]
5
5. Dahan, S., S. Wiles, R. M. La Ragione, A. Best, M. J. Woodward, M. P. Stevens, R. K. Shaw, Y. Chong, S. Knutton, A. Phillips, and G. Frankel. 2005. EspJ is a prophage-encoded type III effector protein of attaching and effacing pathogens that modulates infection dynamics. Infect. Immun. 73:679-686.[Abstract/Free Full Text]
6
6. Dobrindt, U., B. Hochhut, U. Hentschel, and J. Hacker. 2004. Genomic islands in pathogenic and environmental microorganisms. Nat. Rev. Microbiol. 2:414-424.[CrossRef][Medline]
7
7. Donnenberg, M. S., and T. S. Whittam. 2001. Pathogenesis and evolution of virulence in enteropathogenic and enterohemorrhagic Escherichia coli. J. Clin. Investig. 107:539-548.[Medline]
8
8. Frankel, G., A. D. Phillips, L. R. Trabulsi, S. Knutton, G. Dougan, and S. Matthews. 2001. Intimin and the host cell—is it bound to end in Tir(s)? Trends Microbiol. 9:214-218.[CrossRef][Medline]
9
9. Frankel, G., A. D. Phillips, I. Rosenshine, G. Dougan, J. B. Kaper, and S. Knutton. 1998. Enteropathogenic and enterohaemorrhagic Escherichia coli: more subversive elements. Mol. Microbiol. 30:911-921.[CrossRef][Medline]
10
10. Garmendia, J., and G. Frankel. 2005. Operon structure and gene expression of the espJ-tccP locus of enterohaemorrhagic Escherichia coli O157:H7. FEMS Microbiol. Lett. 247:137-145.[CrossRef][Medline]
11
11. Garmendia, J., G. Frankel, and V. F. Crepin. 2005. Enteropathogenic and enterohemorrhagic E. coli infections: translocation, translocation, translocation. Infect. Immun. 73:2573-2585.[Free Full Text]
12
12. Garmendia, J., A. Phillips, Y. Chong, S. Schuller, O. Marches, S. Dahan, E. Oswald, R. K. Shaw, S. Knutton, and G. Frankel. 2004. TccP is an enterohaemorrhagic E. coli O157:H7 type III effector protein that couples Tir to the actin-cytoskeleton. Cell Microbiol. 6:1167-1183.[CrossRef][Medline]
13
13. Giron, J. A., A. S. Ho, and G. K. Schoolnik. 1991. An inducible bundle-forming pilus of enteropathogenic Escherichia coli. Science 254:710-713.[Abstract/Free Full Text]
14
14. Gomes, T. A., M. A. Vieira, I. K. Wachsmuth, P. A. Blake, and L. R. Trabulsi. 1989. Serotype-specific prevalence of Escherichia coli strains with EPEC adherence factor genes in infants with and without diarrhea in Sao Paulo, Brazil. J. Infect. Dis. 160:131-135.[Medline]
15
15. Gruenheid, S., R. DeVinney, F. Bladt, D. Goosney, S. Gelkop, G. D. Gish, T. Pawson, and B. B. Finlay. 2001. Enteropathogenic E. coli Tir binds Nck to initiate actin pedestal formation in host cells. Nat. Cell Biol. 3:856-859.[CrossRef][Medline]
16
16. Hartland, E. L., M. Batchelor, R. M. Delahay, C. Hale, S. Matthews, G. Dougan, S. Knutton, I. Connerton, and G. Frankel. 1999. Binding of intimin from enteropathogenic Escherichia coli to Tir and to host cells. Mol. Microbiol. 32:151-158.[CrossRef][Medline]
17
17. Hayashi, T., K. Makino, M. Ohnishi, K. Kurokawa, K. Ishii, K. Yokoyama, C. G. Han, E. Ohtsubo, K. Nakayama, T. Murata, M. Tanaka, T. Tobe, T. Iida, H. Takami, T. Honda, C. Sasakawa, N. Ogasawara, T. Yasunaga, S. Kuhara, T. Shiba, M. Hattori, and H. Shinagawa. 2001. Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. DNA Res. 28:11-22.
18
18. Hueck, C. J. 1998. Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol. Mol. Biol. Rev. 62:379-433.[Abstract/Free Full Text]
19
19. Kenny, B. 1999. Phosphorylation of tyrosine 474 of the enteropathogenic Escherichia coli (EPEC) Tir receptor molecule is essential for actin nucleating activity and is preceded by additional host modifications. Mol. Microbiol. 31:1229-1241.[CrossRef][Medline]
20
20. Kenny, B., R. DeVinney, M. Stein, D. J. Reinscheid, E. A. Frey, and B. B. Finlay. 1997. Enteropathogenic E. coli (EPEC) transfers its receptor for intimate adherence into mammalian cells. Cell 91:511-520.[CrossRef][Medline]
21
21. Knutton, S., D. R. Lloyd, and A. S. McNeish. 1987. Adhesion of enteropathogenic Escherichia coli to human intestinal enterocytes and cultured human intestinal mucosa. Infect. Immun. 55:69-77.[Abstract/Free Full Text]
22
22. McDaniel, T. K., K. G. Jarvis, M. S. Donnenberg, and J. B. Kaper. 1995. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc. Natl. Acad. Sci. USA 92:1664-1668.[Abstract/Free Full Text]
23
23. Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11:142-201.[Abstract/Free Full Text]
24
24. Pearce, M. C., C. Jenkins, L. Vali, A. W. Smith, H. I. Knight, T. Cheasty, H. R. Smith, G. J. Gunn, M. E. Woolhouse, S. G. Amyes, and G. Frankel. 2004. Temporal shedding patterns and virulence factors of Escherichia coli serogroups O26, O103, O111, O145, and O157 in a cohort of beef calves and their dams. Appl. Environ. Microbiol. 70:1708-1716.[Abstract/Free Full Text]
25
25. Perna, N. T., G. R. Plunkett, V. Burland, B. Mau, J. D. Glasner, D. J. Rose, G. F. Mayhew, P. S. Evans, J. Gregor, H. A. Kirkpatrick, G. Posfai, J. Hackett, S. Klink, A. Boutin, Y. Shao, L. Miller, E. J. Grotbeck, N. W. Davis, A. Lim, E. T. Dimalanta, K. D. Potamousis, J. Apodaca, T. S. Anantharaman, J. Lin, G. Yen, D. C. Schwartz, R. A. Welch, and F. R. Blattner. 2001. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 409:529-533.[CrossRef][Medline]
26
26. Thorpe, C. M. 2004. Shiga toxin-producing Escherichia coli infection. Clin. Infect. Dis. 38:1298-1303.[CrossRef][Medline]
27
27. Trabulsi, L. R., R. Keller, and T. A. Tardelli Gomes. 2002. Typical and atypical enteropathogenic Escherichia coli. Emerg. Infect. Dis. 8:508-513.[Medline]
28
28. Wick, L. M., W. Qi, D. W. Lacher, and T. S. Whittam. 2005. Evolution of genomic content in the stepwise emergence of Escherichia coli O157:H7. J. Bacteriol. 187:1783-1791.[Abstract/Free Full Text]
29
29. Willshaw, G. A., T. Cheasty, H. R. Smith, O. B. S.J., and G. K. Adak. 2001. Verocytotoxin-producing Escherichia coli (VTEC) O157 and other VTEC from human infections in England and Wales: 1995 to 1998. J. Med. Microbiol. 50:135-142.
30
30. Xu, J., Q. Liu, H. Jing, B. Pang, J. Yang, G. Zhao, and H. Li. 2003. Isolation of Escherichia coli O157:H7 from dung beetles Catharsius molossus. Microbiol. Immunol. 47:45-49.[Medline]
31
31. Ye, C., and J. Xu. 2001. Prevalence of iron transport gene on pathogenicity-associated island of uropathogenic Escherichia coli in E. coli O157:H7 containing Shiga toxin gene. J. Clin. Microbiol. 39:2300-2305.[Abstract/Free Full Text]

---

Journal of Clinical Microbiology, November 2005, p. 5715-5720, Vol. 43, No. 11
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.11.5715-5720.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Toth, I., Schmidt, H., Kardos, G., Lancz, Z., Creuzburg, K., Damjanova, I., Paszti, J., Beutin, L., Nagy, B. (2009). Virulence Genes and Molecular Typing of Different Groups of Escherichia coli O157 Strains in Cattle. Appl. Environ. Microbiol. 75: 6282-6291 [Abstract] [Full Text]  
• Muller, D., Benz, I., Liebchen, A., Gallitz, I., Karch, H., Schmidt, M. A. (2009). Comparative Analysis of the Locus of Enterocyte Effacement and Its Flanking Regions. Infect. Immun. 77: 3501-3513 [Abstract] [Full Text]  
• Arbeloa, A., Blanco, M., Moreira, F. C., Bulgin, R., Lopez, C., Dahbi, G., Blanco, J. E., Mora, A., Alonso, M. P., Mamani, R. C., Gomes, T. A. T., Blanco, J., Frankel, G. (2009). Distribution of espM and espT among enteropathogenic and enterohaemorrhagic Escherichia coli. J Med Microbiol 58: 988-995 [Abstract] [Full Text]  
• Sitthidet, C., Stevens, J. M., Chantratita, N., Currie, B. J., Peacock, S. J., Korbsrisate, S., Stevens, M. P. (2008). Prevalence and Sequence Diversity of a Factor Required for Actin-Based Motility in Natural Populations of Burkholderia Species. J. Clin. Microbiol. 46: 2418-2422 [Abstract] [Full Text]  
• Iguchi, A., Ooka, T., Ogura, Y., Asadulghani, , Nakayama, K., Frankel, G., Hayashi, T. (2008). Genomic comparison of the O-antigen biosynthesis gene clusters of Escherichia coli O55 strains belonging to three distinct lineages. Microbiology 154: 559-570 [Abstract] [Full Text]  
• Abe, H., Miyahara, A., Oshima, T., Tashiro, K., Ogura, Y., Kuhara, S., Ogasawara, N., Hayashi, T., Tobe, T. (2008). Global Regulation by Horizontally Transferred Regulators Establishes the Pathogenicity of Escherichia coli. DNA Res 15: 25-38 [Abstract] [Full Text]  
• Whale, A. D., Hernandes, R. T., Ooka, T., Beutin, L., Schuller, S., Garmendia, J., Crowther, L., Vieira, M. A. M., Ogura, Y., Krause, G., Phillips, A. D., Gomes, T. A. T., Hayashi, T., Frankel, G. (2007). TccP2-mediated subversion of actin dynamics by EPEC 2 - a distinct evolutionary lineage of enteropathogenic Escherichia coli. Microbiology 153: 1743-1755 [Abstract] [Full Text]  
• Ogura, Y., Ooka, T., Whale, A., Garmendia, J., Beutin, L., Tennant, S., Krause, G., Morabito, S., Chinen, I., Tobe, T., Abe, H., Tozzoli, R., Caprioli, A., Rivas, M., Robins-Browne, R., Hayashi, T., Frankel, G. (2007). TccP2 of O157:H7 and Non-O157 Enterohemorrhagic Escherichia coli (EHEC): Challenging the Dogma of EHEC-Induced Actin Polymerization. Infect. Immun. 75: 604-612 [Abstract] [Full Text]  
• Munter, S., Way, M., Frischknecht, F. (2006). Signaling During Pathogen Infection. Sci Signal 2006: re5-re5 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Garmendia, J. Articles by Frankel, G. Search for Related Content PubMed PubMed Citation Articles by Garmendia, J. Articles by Frankel, G.