This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dow, M. A.
Right arrow Articles by Nagy, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dow, M. A.
Right arrow Articles by Nagy, B.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, March 2005, p. 1366-1371, Vol. 43, No. 3
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.3.1366-1371.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Predominance of afr2 and ral Fimbrial Genes Related to Those Encoding the K88 and CS31A Fimbrial Adhesins in Enteropathogenic Escherichia coli Isolates from Rabbits with Postweaning Diarrhea in Central Europe

Mohamed A. Dow,1 István Tóth,1 Pavel Alexa,2 Michael Davies,3 Anna Malik,1 Eric Oswald,4 and Béla Nagy1*

Veterinary Medical Research Institute of the Hungarian Academy of Sciences, Budapest, Hungary,1 Veterinary Research Institute, Brno, Czech Republic,2 Gastroenteric Disease Center, The Pennsylvania State University, University Park, Pennsylvania,3 UMR 1225 INRA "Interactions Hotes-Agents Pathogénes," Ecole Nationale Veterinaire de Toulouse, Toulouse, France4

Received 30 December 2003/ Returned for modification 20 May 2004/ Accepted 7 November 2004


arrow
ABSTRACT
 
PCR tests designed in these studies identified three rabbit adhesive factor genes among 43 enteropathogenic E. coli (EPEC) strains: afr1 (2 strains), the F4(K88)/CS31A-related afr2 (10 strains), and ral (15 strains). Several EPEC strains (i.e., O153:H7 and O157:H2) lacked these genes but did adhere to HeLa cells and produced attaching and effacing lesions in rabbits.


arrow
TEXT
 
Enteropathogenic Escherichia coli (EPEC) is an important cause of morbidity among infants in nonindustrialized countries and among young animals (32). It has been established that strains of E. coli that are highly pathogenic for weaned rabbits are EPEC (8, 27, 37, 38). EPEC typically do not produce known enterotoxins or Shiga toxins but damage the intestinal epithelial cells by effacing the microvilli and attaching intimately to the cell membrane. This leads to the characteristic "attaching and effacing" (AE) lesion and diarrhea (12, 25, 40). The ability of rabbit EPEC to produce AE lesions is due to the locus of enterocyte effacement (LEE) pathogenicity island inserted into the chromosome. LEE codes for the 94- to 97-kb outer membrane protein called intimin (Eae) and its translocated receptor (Tir) and for a type III secretion system which translocates the Tir protein into the host cell (46, 52). Variability of eae genes has led to the establishment of 10 different types ({alpha}, ß, {gamma}, {delta}, {varepsilon}, {eta}, {iota}, {kappa}, {theta}, and {xi}) (36, 51). In addition to the LEE, several colonization factors also have been found in rabbit EPEC. The adhesion to enterocytes and the colonization aptitude of the most intensively studied rabbit diarrheal E. coli (RDEC-1) were correlated to the presence of a plasmid-encoded fimbrial adhesin called adhesive factor/rabbit 1 (AF/R1) (13). Another fimbrial adhesin, adhesive factor/rabbit 2 (AF/R2), which confers on EPEC strains the ability to attach to rabbit enterocytes and to HeLa cells in a diffuse manner, is also associated with in vivo virulence (28). The afr2 operon is located on the chromosome (17). A further adhesin, called Ral (for rabbit EPEC adherence locus), has also been identified, and its genetic determinant (ral) was located on a plasmid (1, 23). Both AF/R2 and Ral share homology with the F4(K88) and CS31A adhesins (1). Ral and intimin act as adhesion factors cooperatively, with Ral-mediated adhesion preceding that mediated by intimin (23). Another virulence gene involved in the capability of enterohemorrhagic E. coli and EPEC to adhere to mammalian cells in vitro and in repression of the host lymphocyte activation response is the efa1/lifA gene (22, 45). The gene paa (porcine attaching and effacing-associated gene), first reported to be present in porcine EPEC, was also shown to be present in rabbit E. coli (3, 4, 5). Finally, long polar fimbriae similar to those of enterohemorrhagic E. coli O157:H7 may also act cooperatively with rabbit-specific fimbriae in early steps of the adhesion of rabbit EPEC (33).

Epidemiological studies revealed that EPEC strains isolated from diarrhoeic weaned rabbits most frequently harbor the ß type of eae (24, 36, 41). EPEC strains isolated in Belgium, The Netherlands (39), and the United States (12) belonged to serotype O15:K–H–, while rhamnose-negative O103:K–:H2 strains are predominant in France (11) and Spain (6, 7, 8, 24). In addition to Spain and France, strains of serogroup O103 were also detected in Belgium, Germany, Hungary, Italy, and the United States (18, 30, 32, 34, 37, 49). Studies in Belgium, France, and Spain revealed that strains of serotypes O15:K–:H–, O26:K–:H11, O103K–:H2, and O132:H2 were highly pathogenic for weaned rabbits (11, 39, 41).

Since no detailed reports exist on rabbit EPEC strains in Central Europe, we investigated the virulence genes of E. coli strains isolated from weaned rabbits in Hungary and the Czech Republic by using published PCR systems and by developing new PCR systems to detect genes of fimbrial adhesion factors of rabbit strains.

Sixty-six E. coli strains were isolated from caeca of 101 weaned rabbits: 40 diarrheal rabbits (22 strains) and 32 nondiarrheal rabbits (15 strains) obtained from one large rabbitry in Hungary and 29 diarrheal rabbits obtained from 17 rabbitries in the Czech Republic (29 strains).

The 66 E. coli strains were characterized by using different PCR assays for E. coli virulence genes, using previously published primers and control strains (Table 1), except for the rabbit fimbriae AF/R1, AF/R2, and Ral, for which the following PCR primers and conditions were designed, in 30 cycles, as follows: AF/R1-F (5'TACCGTTACTGCGAAGACCT3') and AF/R1-R (5'CGTGCTGTTAATCGCCACTA3'), 94°C for 45 s, 60°C for 45 s, and 72°C for 45 s; AF/R2-F (5'AAGTTAGGGGACGCCATTAC3') and AF/R2-R (5'CCAGGACTTATTCTGACCAG3'), 94°C for 45 s, 57°C for 45 s, and 72°C for 45s; RalG-F (5'GATCTTTGGCAGTGGACAC3') and RalG-R (5'CGGCAACAGTTCCTTTTGAA3'), 94°C for 45 s, 58°C for 60 s, and 72°C for 45 s. Cycles were finished by an extension time of 5 min at 72°C.


View this table:
[in this window]
[in a new window]
 
TABLE 1. PCR primers and reference E. coli strains used in this study

For colony dot blot hybridization for the major fimbrial subunit ralG genes, colonies of selected strains were grown overnight on Luria-Bertani agar plates, transferred to nitrocellulose membranes, lysed by alkali, and fixed as described by Mainil et al. (26). The ralG-specific PCR product was purified by using the QIAquick PCR purification kit (QIAGEN GmbH, Germany), and labeled with a digoxigenin ready-to-use labeling kit (Roche Diagnostics GmbH, Germany) according to the manufacturer's instructions. Hybridization was carried out at 68°C, and the rest of the protocol was conducted according to the manufacturer's manual.

Phenotypic characteristics of the wild-type E. coli strains included O typing (35), sugar fermentation, and hemolysin production (12). The HeLa cell adhesion assay was performed as described by De Rycke, et al. (15). AE activities of the rabbit EPEC strains were tested with ligated ileal loops of three weaned (6-week-old) rabbits as described by Moon et al. (29). Surgical anesthesia was provided by combined use of SBH-Ketamin (SelBruHa, Budapest, Hungary), Domitor (Pfizer), and Halothane (LECIVA, Prague, Czechoslovakia). Postsurgical comfort was provided under constant supervision by applications of Ketamin and Domitor for 12 to 14 h, followed by Nembutal (CEVA) euthanasia. AE lesions were identified by histopathology and electron microscopy (29).

Results of PCR testing of 66 E. coli strains isolated from weaned rabbits in both countries identified 43 strains with the intimin (eae) gene (36 from diarrheal rabbits and 7 from nondiarrheal rabbits), which were designated EPEC. The virulence attributes of the 43 rabbit EPEC strains are listed in Table 2. The F4(K88)/CS31A-related fimbrial genes afr2 and ral were the two predominant adhesive fimbrial genes present. The presence of the ral gene was confirmed by colony hybridization with six randomly selected ral-positive strains, where they were hybridized with ral-specific probe, while none of the three ral-negative strains tested exhibited a positive signal (Fig. 1).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Characteristics of E. coli strains isolated from diarrheal and normal weaned rabbits



View larger version (43K):
[in this window]
[in a new window]
 
FIG. 1. Agarose gel electrophoresis of ral G-specific PCR products (A) and ral-specific colony hybridization (B). Samples in panels A and B were the same. Samples in gel electrophoresis: lane 1, molecular weight marker ({lambda} phage DNA digested with PstI); lane 2, 83/39 ral-positive control strain; lanes 3 to 11, wild-type rabbit E. coli strains; lane 12, E. coli K-12 (DH5{alpha}), negative control. E. coli strains 5, 6, 7, 9, 10, and 11 were ral positive, and strains 3, 4, and 8 were ral negative.

The most frequent serogroups of eae-positive strains were O103, O153, O15, O132, and O157 (Table 2). Regarding sorbitol (S) rhamnose (R) fermentation, of the 12 strains of the O103 serogroup, six were S/R, three were S+/R, two were S/R+, and one was S+/R+. Among the four strains belonging to O157, three strains were S/R+ and one strain was S/R. The four strains belonging to O132:H2 were S+/R+. Representative strains of the most frequent EPEC serogroups with different fimbriae were tested for in vitro adhesion in the HeLa cell assay. All EPEC strains exhibited a diffuse adherence phenotype, defined as bacteria covering the whole cell surface rather than being limited to one or a few sites of the cell. The diffuse adherence phenotype was observed without any differences regarding the presence or type of fimbriae (Table 3). Adherence of bacteria and the presence of attaching and effacing lesions in ligated ileal loops of rabbits were observed with all of these representative strains (Table 3), which was confirmed by electron microscopy for both rabbit EPEC-infected samples taken for ultrastructural investigation (Fig. 2).


View this table:
[in this window]
[in a new window]
 
TABLE 3. Adherence phenotype of selected rabbit EPEC strains: production of AE lesion in rabbit intestine (in vivo) and adhesion to HeLa cells in vitro



View larger version (119K):
[in this window]
[in a new window]
 
FIG. 2. Electron micrographs of surface epithelium from the ligated ileal loops of weaned rabbits infected with a rabbit O103:rfa2 EPEC strain (A) or with a rabbit O153 EPEC strain without known rabbit or human fimbrial genes (B), illustrating intimate attachment of the bacteria to the epithelial cell membranes and effacement of the microvilli.

In this investigation we established that rabbit EPEC is the major type of pathogenic E. coli in rabbitries of Hungary and the Czech Republic, confirming reports from other countries (6, 11, 12, 18, 30, 32, 34, 37, 49). Furthermore, we detected the potential EPEC adhesins and established some peculiarities of rabbit EPEC in this region of Europe. First, we detected from rabbits in the Hungarian collection the classical human type EPEC O55:H7 bacteria, which have not been isolated from rabbits before (32). Interestingly, these bacteria did not harbor the genes of rabbit-specific fimbriae or bfp (specific to human EPEC) but possessed paa. Surprisingly, in this relatively small collection we also detected four strains of EPEC O157, of which one strain was O157:NM and three strains were O157:H2 (lacking rabbit fimbrial adhesins or bfp and all sorbitol negative). This seems to contrast to the reported isolation of O157 from rabbit (from Spain), where there was only 1 strain belonging to serogroup O157 out of 503 strains tested (8).

The EPEC fimbria called AF/R1, found in rabbits (13, 21), is a member of the family of type 1 fimbriae (class I adhesins): AfrA has 43 and 42% respective homologies with the major subunits of type 1 fimbriae (FimA) and Pap fimbriae (PapA), found to be associated with uropathogenic E. coli (50). AF/R1 is rarely detected in field isolates from rabbits (44). Using PCR primers designed for these studies, we found the presence of the afr1 gene in two unrelated Czech EPEC strains belonging to O153, indicating that the presence of this type of fimbria also seems to be rare in Central Europe. However, we were successful in specifically detecting two recently described rabbit EPEC adhesin genes (afr2 and ral) that are both related to F4(K88) fimbriae and to the nonfimbrial CS31A adhesin of porcine enterotoxigenic E. coli and bovine/porcine enterotoxigenic E. coli, respectively. The gene of adhesive factor/rabbit 2 (afr2) was detected in 11 strains of the O103 serogroup isolated from rabbits in both countries. The other recently identified adhesin, encoded by the rabbit EPEC adherence locus (ral) gene of an O15:H– EPEC (1), was detected here in 15 strains belonging to the O145, O153, O49, O15, and O132 serogroups. We also detected the porcine attaching and effacing-associated (paa) gene in 17 (38.8%) of the EPEC strains, with no association to any of the serogroups or to fimbrial types, while lifA was rare. Investigation of other, possibly cooperative adhesins (33) will be among aims of further studies.

In this study the representative eae-positive strains tested were able to adhere to HeLa cells and to produce AE lesions in the intestines of weaned rabbits independently of the type (AR/F1, AR/F2, or Ral) of their fimbrial adhesins. It is remarkable that several EPEC strains did not have rabbit-specific fimbrial adhesins. Two representatives of these strains (an O153:H7 strain and an O157:H2 strain) did adhere to HeLa cells in vitro and did produce AE lesions in vivo, like those with rabbit-specific fimbriae, suggesting the presence of further potential adhesins in some of these rabbit EPEC strains.


arrow
ACKNOWLEDGMENTS
 
We thank P. Z. Fekete, A. Milon, J. E. Peeters, R. A. Wilson, C. DebRoy, and M. Herpay for their valuable help.

Support of the Hungarian Basic Science Fund (OTKA), T034970, and of the Czech Ministry of Agriculture, MZE-M-03-99-01, is acknowledged. M. Dow is a Ph.D. student at the Eötvös Lóránd University, Faculty of Science, Budapest, supported by the Libyan Ministry of Education.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Veterinary Medical Research Institute of the Hungarian Academy of Sciences, 1143 Budapest, Hungaria Str. 21, Budapest, Hungary. Phone: 36-1-2522455. Fax: 36-1-2521069. E-mail: bnagy{at}vmri.hu. Back


arrow
REFERENCES
 
    1
  1. Adams, L. M., C. P. Simmons, L. Rezmann, R. A. Strugnell, and R. M. Robins-Browne. 1997. Identification and characterization of a K88- and CS31A-like operon of a rabbit enteropathogenic Escherichia coli strain which encodes fimbriae involved in the colonization of rabbit intestine. Infect. Immun. 65:5222-5230.[Abstract]
  2. 2
  3. Alexa, P., I. Rychlík, A. Nejezchleb, and J. Hamrík. 1997. Identification of enterotoxin-producing strains of Escherichia coli by PCR and biological methods. Vet. Med. 42:97-100.
  4. 3
  5. An, H., J. M. Faribrother, C. Desautels, and J. Harel. 1999. Distribution of a novel locus called Paa (porcine attaching and effacing associated) among enteric Escherichia coli. Adv. Exp. Med. Biol. 473:179-184.[Medline]
  6. 4
  7. An, H., J. M. Fairbrother, C. Desautels, T. Mabrouk, D. Dugourd, H. Dezfulian, and J. Harel. 2000. Presence of the LEE (locus of enterocyte effacement) in pig attaching and effacing Escherichia coli and characterization of eae, espA, espB and espD genes of PEPEC (pig EPEC) strain 1390. Microb. Pathog. 28:291-300.[CrossRef][Medline]
  8. 5
  9. Batisson, I., M. P. Guimond, F. Girard, H. An, C. Zhu, E. Oswald, J. M. Fairbrother, M. Jacques, and J. Harel. 2003. Characterization of the novel factor Paa involved in the early steps of the adhesion mechanism of attaching and effacing Escherichia coli. Infect. Immun. 71:4516-4525.[Abstract/Free Full Text]
  10. 6
  11. Blanco, J. E., M. Blanco, J. Blanco, A. Mora, L. Balaguer, L. Cuervo, C. Balsalobre, and F. Munoa. 1997. Prevalence and characteristics of enteropathogenic Escherichia coli with the eae gene in diarrhoeic rabbits. Microbiol. Immunol. 41:77-82.[Medline]
  12. 7
  13. Blanco, J. E., M. Blanco, J. Blanco, L. Rioja, and J. Ducha. 1994. Serotypes, toxins and antibiotic resistance of Escherichia coli strains isolated from diarrhoeic and healthy rabbits in Spain. Vet. Microbiol. 38:193-201.[CrossRef][Medline]
  14. 8
  15. Blanco, J. E., M. Blanco, J. Blanco, A. Mora, L. Balaguer, M. Mourino, A. Juarez, and W. H. Jansen. 1996. O serogroups, biotypes, and eae genes in Escherichia coli strains isolated from diarrheic and healthy rabbits. J. Clin. Microbiol. 34:3101-3107.[Abstract]
  16. 9
  17. Blanco, M., J. E. Blanco, J. Blanco, M. P. Alonso, C. Balsalobre, M. Mouriño, C. Madrid, and A. Juárez. 1996. Polymerase chain reaction for detection of Escherichia coli strains producing cytotoxic necrotizing factor type 1 and type 2. J. Microbiol. Methods 26:95-101.
  18. 10
  19. Blum, G., V. Falbo, A. Caprioli, and J. Hacker. 1995. Gene clusters encoding the cytotoxic necrotizing factor type 1, Prs-fimbriae and-hemolysin from the pathogenicity island II of uropathogenic Escherichia coli strain J96. FEMS Microbiol. Lett. 126:189-196.[Medline]
  20. 11
  21. Camguilhem, R., and A. Milon. 1989. Biotypes and O serogroups of E. coli involved in intestinal infections of weaned rabbits: clues to diagnosis of pathogenic strains. J. Clin. Microbiol. 27:743-747.[Abstract/Free Full Text]
  22. 12
  23. Cantey, J. R., and R. K. Blake. 1977. Diarrhea due to Escherichia coli in the rabbit: a novel mechanism. J. Infect. Dis. 135:454-462.[Medline]
  24. 13
  25. Cantey, J. R., R. K. Blake, J. R. Williford, and S. L. Moseley. 1999. Characterization of the Escherichia coli AF/R1 pilus operon: novel genes necessary for transcriptional regulation and for pilus-mediated adherence. Infect. Immun. 67:2292-2298.[Abstract/Free Full Text]
  26. 14
  27. China, B., V. Pirson, and J. Mainil. 1996. Typing of bovine attaching and effacing Escherichia coli by multiplex in vitro amplification of virulence-associated genes. Appl. Environ. Microbiol. 62:3462-3465.[Abstract]
  28. 15
  29. De Rycke, J., E. Comtet, C. Chalareng, M. Bourz, C. Tasca, and A. Milon. 1997. Enteropathogenic Escherichia coli O103 from rabbit elicits actin stress fibers and focal adhesions in HeLa epithelial cells, cytopathic effects that are linked to an analog of the locus of enterocyte effacement. Infect. Immun. 65:2555-2563.[Abstract]
  30. 16
  31. Elliott, S. J., L. A. Wainwright, T. K. McDaniel, K. G. Jarvis, Y. K. Deng, L. C. Lai, B. P. McNamara, M. S. Donnenberg, and J. B. Kaper. 1998. The complete sequence of the locus of enterocyte effacement (LEE) from enteropathogenic Escherichia coli E2348/69. Mol. Microbiol. 28:1-4.[CrossRef][Medline]
  32. 17
  33. Fiederling, F., M. Boury, C. Petit, and A. Milon. 1997. Adhesive factor/rabbit 2, a new fimbrial adhesin and a virulence factor from Escherichia coli O103, a serogroup enteropathogenic for rabbits. Infect. Immun. 65:847-851.[Abstract]
  34. 18
  35. Franke, S., H. Schmidt, A. Schwarzkopf, L. H. Wieler, G. Baljer, L. Beutin, and H. Karch. 1994. Nucleotide sequence analysis of enteropathogenic Escherichia coli (EPEC) adherence factor probe and development of PCR for rapid detection of EPEC harboring virulence plasmids. J. Clin. Microbiol. 32:2460-2463.[Abstract/Free Full Text]
  36. 19
  37. Goffaux, F., B. China, L. Janssen, and J. Mainil. 2000. Genotypic characterization of enteropathogenic Escherichia coli (EPEC) isolated in Belgium from dogs and cats. Res. Microbiol. 151:865-871.[Medline]
  38. 20
  39. Grunzburg, S. T., N. G. Tornieporth, and L. W. Riley. 1995. Identification of enteropathogenic Escherichia coli by PCR-based detection of the bundle-forming pilus gene. J. Clin. Microbiol. 33:1375-1377.[Abstract]
  40. 21
  41. Inman, L. R., and R. J. Cantey. 1984. Peyer's patch lymphoid follicle epithelial adherence of a rabbit enteropathogenic Escherichia coli (strain RDEC-1). Role of plasmid-mediated pili in initial adherence. J. Clin. Investig. 74:90-95.
  42. 22
  43. Klapproth, J. M., I. C. Scaletsky, B. P. McNamara, L. C. Lai, C. Malstrom, S. P. James, and M. S. Donnenberg. 2000. A large toxin from pathogenic Escherichia coli strains that inhibits lymphocyte activation. Infect. Immun. 68:2148-2155.[Abstract/Free Full Text]
  44. 23
  45. Krejany, E. O., T. H. Grant, V. Bennett-Wood, L. M. Adams, and R. M. Robins-Browne. 2000. Contribution of plasmid-encoded fimbriae and intimin to capacity of rabbit-specific enteropathogenic Escherichia coli to attach to and colonize rabbit intestine. Infect. Immun. 68:6472-6477.[Abstract/Free Full Text]
  46. 24
  47. Leroy, S. M., M. C. Lesage, E. Chaslus-Dancla, and J. P. Lafont. 1994. Presence of eaeA in pathogenic and non-pathogenic Escherichia coli strains isolated from weaned rabbits. J. Med. Microbiol. 40:90-94.[Abstract/Free Full Text]
  48. 25
  49. Licois, D., A. Reynaud, M. Federighi, B. Gaillard-Martinie, J. F. Guillot, and B. Joly. 1991. Scanning and transmission electron microscopic study of adherence of Escherichia coli O103 enteropathogenic and/or enterohemorrhagic strain GV in enteric infection in rabbits. Infect. Immun. 59:3796-3800.[Abstract/Free Full Text]
  50. 26
  51. Mainil, J. G., F. Bex, E. Jacquemin, P. Pohl, M. Couturier, and A. Kaeckenbeeck. 1990. Prevalence of four enterotoxin (StaP, StaH, STb, and LT) and four adhesion subunit (K99, K88, 987P, and F41) genes among Escherichia coli isolates from cattle. Am. J. Vet. Res. 51:187-190.[Medline]
  52. 27
  53. Milon, A., E. Oswald, and J. De Rycke. 1999. Rabbit EPEC: a model for the study of enteropathogenic Escherichia coli. Vet. Res. 30:203-219.[Medline]
  54. 28
  55. Milon, A., L. Esslinger, and R. Camguilhem. 1990. Adhesion of Escherichia coli strains isolated from diarrheic weaned rabbits to intestinal villi and HeLa cells. Infect. Immun. 58:2690-2695.[Abstract/Free Full Text]
  56. 29
  57. Moon, H. W., S. C. Whipp, R. A. Argenzio, M. M. Levine, and R. A. Gianella. 1983. Attaching effacing activities of rabbit and human enteropathogenic Escherichia coli in pig and rabbit intestines. Infect. Immun. 41:1340-1351.[Abstract/Free Full Text]
  58. 30
  59. Moon, H. W., D. K. Sorensen, J. H. Sautter, and J. M. Higbee. 1968. Experimental enteric colibacillosis in piglets. Can. J. Comp. Med. 32:493-497.
  60. 31
  61. Nagy, B., S. C. Whipp, H. Imberechts, H. U. Bertschinger, E. A. Dean-Nystrom, T. A. Casey, and E. Salajka. 1997. Biological relationship between F18ab and F18ac fimbriae of enterotoxigenic and verotoxigenic Escherichia coli from weaned pigs with oedema disease or diarrhoea. Microbial. Pathog. 22:1-11.
  62. 32
  63. Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11:142-201.[Abstract/Free Full Text]
  64. 33
  65. Newton, H. J., J. Sloan, V. Bennett-Wood, L. M. Adams, R. M. Robins-Browne, and E. L. Hartland. 2004. Contribution of long polar fimbriae to the virulence of rabbit-specific enteropathogenic Escherichia coli. Infect. Immun. 72:1230-1239.[Abstract/Free Full Text]
  66. 34
  67. Okerman, L. 1987. Enteric infections caused by non-enterotoxigenic Escherichia coli in animals: occurrence and pathogenicity mechanisms. A review. Vet. Microbiol. 14:33-46.
  68. 35
  69. Orskov, L., and F. Orskov. 1984. Serotyping of Escherichia coli, p. 43-112. In T. Bergan and J. R. Norris (ed.), Methods in microbiology. Academic Press, New York, N.Y.
  70. 36
  71. Oswald, E., H. Schmidt, S. Morabito, H. Karch, O. Marchés, and A. Caprioli. 2000. Typing of intimin genes in human and animal enterohemorrhagic and enteropathogenic Escherichia coli: characterization of a new intimin variant. Infect. Immun. 68:64-71.[Abstract/Free Full Text]
  72. 37
  73. Peeters, J. E. 1994. Escherichia coli infection in rabbits, cats, dogs, goats and horses, p. 261-283. In C. L. Gyles (ed.), Escherichia coli in domastic animals and humans. CAB International, Wallingford, United Kingdom.
  74. 38
  75. Peeters, J. E., G. J. Charlier, and P. H. Halen. 1984. Pathogenicity of attaching effacing enteropathogenic Escherichia coli isolated from diarrheic suckling and weanling rabbits for newborn rabbits. Infect. Immun. 46:690-696.[Abstract/Free Full Text]
  76. 39
  77. Peeters, J. E., P. Pohl, L. Okerman, and L. A. Devriese. 1984. Pathogenic properties of Escherichia coli strains isolated from diarrheic commercial rabbits. J. Clin. Microbiol. 20:34-39.[Abstract/Free Full Text]
  78. 40
  79. Peeters, J. E., R. Geeroms, and F. Orskov. 1988. Biotype, serotype, and pathogenicity of attaching and effacing enteropathogenic Escherichia coli strains isolated from diarrheic commercial rabbits. Infect. Immun. 56:1442-1448.[Abstract/Free Full Text]
  80. 41
  81. Penteado, A. S., L. A. Ugrinovich, J. Blanco, M. Blanco, J. E. Blanco, A. Mora, J. R. C. Andrade, S. S. Correa, and A. F. Pestana de Castro. 2002. Serotypes and virulence genes of Escherichia coli strains isolated from diarrheic and healthy rabbits in Brazil. Vet. Microbiol. 89:41-51.[CrossRef][Medline]
  82. 42
  83. Peres, S. Y., O. Marches, F. Daigle, L. P. Nougarede, F. Herault, C. Tasca, J. De Rycke, and E. Oswald. 1997. A new cytolethal distending toxin (CDT) from Escherichia coli producing CNF2 blocks HeLa cell division in G2/M phase. Mol. Microbiol. 24:1095-1097.[CrossRef][Medline]
  84. 43
  85. Perna, N. T., G. Plunkett, V. Burland, B. Mau, J. D. Glasner, D. J. Rose, G. F. Mayhew, P. S. Evans, J. Gregor, H. A. Kirkpatrick, G. Posfai, J. Hackett, S. Klink, A. Boutin, Y. Shao, L. Miller, E. J. Grotbeck, N. W. Davis, A. Lim, E. T. Dimalanta, K. D. Potamousis, J. Apodaca, T. S. Anantharaman, J. Lin, G. Yen, D. C. Schwartz, R. A. Welch, and F. R. Blattner. 2001. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 409:529-533.[CrossRef][Medline]
  86. 44
  87. Pohl, P., J. E. Peeters, E. R. Jacquemin, P. F. Lintermans, and J. G. Mainil. 1993. Identification of eae sequences in enteropathogenic Escherichia coli strains from rabbits. Infect. Immun. 61:2203-2206.[Abstract/Free Full Text]
  88. 45
  89. Stevens, M. P., P. M. vanDiemen, G. Frankel, A. D. Phillips, and T. S. Wallis. 2002. Efa1 influences colonization of the bovine intestine by Shiga toxin-producing serotypes O5 and O111. Infect. Immun. 70:5158-5166.[Abstract/Free Full Text]
  90. 46
  91. Tauschek, M., R. A. Strugnell, and R. M. Robins-Browne. 2002. Characterization and evidence of mobilization of the LEE pathogenicity island of rabbit-specific strains of enteropathogenic Escherichia coli. Mol. Microbiol. 44:1533-1550.[CrossRef][Medline]
  92. 47
  93. Tóth, I., E. Oswald, J. G. Mainil, M. Awad-Masalmeh, and B. Nagy. 2000. Characterization of intestinal cnf1+ Escherichia coli from weaned pigs. Int. J. Med. Microbiol. 290:539-542.[Medline]
  94. 48
  95. Tóth, I., F. Herault, L. Beutin, E. Oswald. 2003. Production of cytolethal distending toxins by pathogenic Escherichia coli strains isolated from human and animal sources: establishment of the existence of a new cdt variant (type IV). J. Clin. Microbiol. 41:4285-4291.[Abstract/Free Full Text]
  96. 49
  97. Varga, J., and L. Pesti. 1982. Serological and some pathological characteristics of Escherichia coli strains isolated from rabbits. Zentbl. Vet. Med. B 29:145-152.
  98. 50
  99. Wolf, M. K., C. E. Boedecker. 1990. Cloning of the genes for AF/R1 pili from rabbit enteropathogenic Escherichia coli RDEC-1 and DNA sequence of major structural subunit. Infect. Immun. 58:1124-1128.[Abstract/Free Full Text]
  100. 51
  101. Zhang, W. L., B. Köhler, E. Oswald, L. Beutin, H. Karch, S. Morabito, A. Caprioli, S. Suerbaum, and H. Schmidt. 2002. Genetic diversity of intimin genes of attaching and effacing Escherichia coli strains. J. Clin. Microbiol. 40:4486-4492.[Abstract/Free Full Text]
  102. 52
  103. Zhu, C., T. S. Agin, S. J. Elliott, L. A. Johnson, T. E. Thate, J. B. Kaper, and E. C. Boedeker. 2001. complete nucleotide sequence and analysis of the locus of enterocyte effacement from rabbit diarrheagenic Escherichia coli RDEC-1. Infect. Immun. 69:2107-2115.[Abstract/Free Full Text]


Journal of Clinical Microbiology, March 2005, p. 1366-1371, Vol. 43, No. 3
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.3.1366-1371.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dow, M. A.
Right arrow Articles by Nagy, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dow, M. A.
Right arrow Articles by Nagy, B.