JCM Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Palacios, G.
Right arrow Articles by Lipkin, W. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Palacios, G.
Right arrow Articles by Lipkin, W. I.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, April 2005, p. 1869-1878, Vol. 43, No. 4
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.4.1869-1878.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Molecular Identification of Mumps Virus Genotypes from Clinical Samples: Standardized Method of Analysis

G. Palacios,1* O. Jabado,1 D. Cisterna,3 F. de Ory,2 N. Renwick,1 J. E. Echevarria,2 A. Castellanos,2 M. Mosquera,2 M. C. Freire,3 R. H. Campos,4 and W. I. Lipkin1

Jerome L. and Dawn Greene Infectious Disease Laboratory, Mailman School of Public Health, Columbia University, New York, New York,1 Neurovirosis Division, Virology Department, Instituto Nacional de Enfermedades Infecciosas—ANLIS "Dr. Carlos G. Malbrán," Buenos Aires, Argentina,2 Services of Diagnostic Microbiology and Virology, Centro Nacional de Microbiología, Instituto de Salud Carlos III, Majadahonda, Madrid, Spain,3 Cátedra de Virología, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Buenos Aires, Argentina4

Received 10 September 2004/ Returned for modification 9 November 2004/ Accepted 15 December 2004


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A sensitive nested reverse transcription-PCR assay, targeting a short fragment of the gene encoding the small hydrophobic protein (SH gene), was developed to allow rapid characterization of mumps virus in clinical samples. The sensitivity and specificity of the assay were established using representative genotypes A, B, C, D, E, and F. Mumps virus RNA was characterized directly from cerebrospinal fluid (CSF) samples and in extracts of mumps virus isolates from patients with various clinical syndromes. Direct sequencing of products and subsequent phylogenetic analysis enabled genetic classification. A simple web-based system of sequence analysis was established. The study also allowed characterization of mumps virus strains from Argentina as part of a new subgenotype. This PCR assay for characterization of mumps infections coupled to a web-based analytical program provides a rapid method for identification of known and novel strains.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mumps virus (MV), in the genus Rubulavirus and family Paramyxoviridae, typically causes a benign childhood infection. Nonetheless, cerebrospinal fluid pleocytosis has been detected in more than a half of all mumps virus infections, indicating that the virus is commonly neuroinvasive (4). The most frequent central nervous system complication of mumps infection is aseptic meningitis (6, 15). Since mumps virus is monotypic, vaccine from any strain should provide lifelong protection against subsequent infection. However, mumps outbreaks have not been completely eliminated even in vaccinated populations (5, 9, 32) and, in some cases, mumps virus neutralizing antibodies do not protect against reinfection with a heterologous mumps virus genotype (18). While all MV live attenuated vaccines have been associated with cases of aseptic meningitis or viral encephalitis, some vaccine-derived strains may be more neuroinvasive.

The single-stranded mumps virus genomic RNA contains seven genes encoding the nucleocapsid (N), phospho (P), membrane (M), fusion (F), small hydrophobic (SH), hemagglutinin-neurominidase (HN), and large (L) proteins (7, 8). The SH gene encodes a protein of 57 amino acids (24). Reduced or absent expression of the SH gene, with a concomitant reduction of SH protein, has been described for certain mumps virus strains (3, 24, 25). Lack of expression of the SH protein does not affect virus replication in vitro, but may modify virus pathogenesis in vivo (24). Phylogenetic comparison of the SH gene revealed the existence of 10 genotypes, designated A to L (2, 10-14, 20, 27-30, 33, 34). Confirmation of mumps viral infection is generally carried out by direct culture of virus from cerebrospinal fluid (CSF). This method is time-consuming, expensive, and unable to detect low titers of virus.

The most promising development in direct detection of virus in the central nervous system has been the application of PCR. In a retrospective study in Argentina, mumps virus RNA was detected by a mumps reverse transcription (RT)-nested PCR targeting the NP gene in 25% of 236 CSF samples from patients with a clinical diagnosis of aseptic meningitis or acute encephalitis (22). Mumps virus PCR is more sensitive than viral culture and may detect mumps virus in CSF when viral culture does not (22). Here we describe a consensus RT-nested PCR assay, targeting the SH gene, for characterization of mumps virus. A simple sequence analysis of amplified products readily distinguishes vaccine and wild-type infections and can be used to characterize circulating genotypes for epidemiological research.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Virus strains. The prototype strain of mumps virus strain Jeryl Lynn was obtained from the American Type Culture Collection, was propagated in Vero cells, and stored at –70°C. Prototype strains of other paramyxoviruses, such as measles virus; canine distemper virus; respiratory syncytial virus A and B; and human parainfluenza viruses 1, 2, 3, and 4, were also obtained from the American Type Culture Collection and used to test assay specificity. Aliquots of each virus were prepared and stored frozen at –70°C.

Clinical specimens. Clinical specimens were obtained from the specimen collections at the Diagnostic Microbiology Service (Centro Nacional de Microbiología, ISCIII, Spain) and the Neurovirosis Division (INEI, Instituto C. Malbrán, Argentina). Specimens consisted of two virus isolates and 23 clinical samples (16 CSF, 7 sera, and 1 saliva). Clinical data for the samples and patients is shown in Table 1.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Clinical data for the specimens presented in this studya

 
Oligonucleotides. Degenerate oligonucleotides for use in this study were designed using computer-assisted analysis of the genomic RNA sequences of those mumps virus serotypes that have been fully or partially sequenced in genomic regions which encode SH proteins (EMBL and GenBank databases; MACAW version 2.0.5 software, 1995, National Center for Biotechnology Information, Bethesda, Maryland). Table 1 shows the sequences and the respective primer positions in mumps virus strain Jeryl Lynn. Degenerate positions are R (A/g), Y (T/C), W (T/A), S (C/g), M (A/C), and K (T/g). Deoxyinosine residues are indicated by letter I.

Synthetic standards. To test the reactivity of the selected primer pairs against mumps virus genotypes that were not available as clinical or laboratory isolates, we synthesized the SH genomic region using overlapping PCR. Eighty nucleotides of the target sequences were designed to overlap each other by 25 bp. Two artificial 25-nucleotide sequences were added to the 5' and 3' ends of the region selected. Equimolar amounts of these oligonucleotides were mixed, and the full-length product was generated in an extension reaction. Following amplification by PCR using primers complementary to the artificial 25-nucleotide flanking sequences, the product was cloned into vector pGEM-T Easy (Invitrogen, Carlsbad, CA). Serial dilutions of linearized plasmid were used to optimize the assay. Thereafter, RNA standards were generated by in vitro transcription of linearized plasmid DNA (mMESSAGE mMACHINE T7; Ambion, Austin, TX) and used to determine assay sensitivity.

RNA extraction and nested RT-PCR from clinical samples. Nucleic acids from virus isolates and clinical samples were precipitated as previously described (5a). After processing, the dried pellet was dissolved in 10 µl of water for immediate use. Five µl of RNA was added to 45 µl of RT-PCR mixture comprising components for reverse transcription and PCR steps (Access RT-PCR System; Promega Co., Madison, WI). The first reaction mixtures contain avian myeloblastosis virus (AMV)/Tfl 5x reaction buffer, 400 mM each deoxynucleoside triphosphate (dNTP), 2 mM Mg2SO4, 5 units of AMV reverse transcriptase, 5 units of Tfl DNA polymerase, and 10 pmol of each of the mumps SH sense (Mumps-SH-1S) and mumps antisense (Mumps-SH-1AS) primers. Samples, isolated virus, and controls were subjected to an initial cycle for reverse transcription at 42°C for 45 min, forty cycles (94°C for 1 min, 50°C for 1 min and 68°C for 1 min), and a final incubation at 68°C for 5 min.

Nested PCR amplifications were performed using a reaction mixture containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 200 µM each dNTP, 2.5 mM MgCl2, 2.5 units of Taq polymerase (Amplitaq; Perkin-Elmer Cetus, Norwalk) and 10 pmol of Mumps-SH-2A and Mumps-SH-2S degenerate primers. Nested PCR assays were subjected to an initial cycle of 94°C for 2 min and thirty cycles (94°C for 1 min, 50°C for 1 min and 72°C for 1 min) followed by a final incubation at 72°C for 5 min. Amplifications were carried out in a PTC-200 (Peltier Thermal Cycler, MJ Research, Inc., MA) utilizing thin-walled reaction tubes. Upon completion of nested PCR assays, 5 µl of each reaction mixture was analyzed by 2% agarose gel electrophoresis. Amplification products were purified by isopropanol precipitation and sequenced with standard sequencing methods.

Mumps virus sequence database. A mumps virus sequence database was constructed by extracting sequences from the National Center for Biotechnology Information GenBank. Each sequence was identified by name, place of isolation or detection, year, and genotype. Previously described genotypes were taken from their corresponding references.

A manual search was carried out for all the sequences in GenBank encompassing the targets of our selected primers. Genetic characterization was performed on a total data set of 375 mumps virus sequences. The database is accessible at http://www.greeneidlab.columbia.edu

Sequence analysis of amplified products. Original sequence data were first analyzed by the CHROMAS software (version 1.3, McCarthy 1996; School of Biomolecular and Biomedical Science, Faculty of Science and Technology, Griffith University, Brisbane, Queensland, Australia), and forward and reverse sequence data of each sample were aligned with the program EDITSEQ (DNASTAR Inc., Software, Madison, Wisconsin). The consensus sequence was compared and aligned to other samples or DNA database sequences using the program CLUSTAL X (version 1.83). The MEGA package (version 2.1) was used to produce phylogenetic trees using neighbor joining as the method to reconstruct the phylogeny and Kimura two-parameter as the nucleotide substitution calculation method. The statistical significance of a particular tree topology was evaluated by bootstrap resampling of the sequences 1,000 times.

Pairwise comparisons of the mumps virus database were done by global alignment using the Needleman Wunsch (17) algorithm, implemented by a program from EMBOSS, the European Molecular Biology Open Software Suite (23). Z-scores were calculated to test the significance of each pairwise alignment by Monte Carlo simulation on the shuffled sequences. Statistical analysis was conducted with the SPSS statistical package (SPSS Software, Chicago, Ill.). An automated program to perform the same analysis is available at http://www.greeneidlab.columbia.edu.

Nucleotide sequence accession number. The GenBank accession numbers of the nucleotide sequences determined in this study are AY735412 to AY735441.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Primer design and PCR sensitivity. Alignment of mumps virus nucleotide sequences spanning the SH gene revealed the variability between strains. Thus, primers were designed to complement all possible codon combinations by incorporating mixed base residues or deoxyinosine residues at the degenerated codon positions (Table 2).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Sequence alignment of primers and mumps virus strain sequences available on genomic databases

 
The Jeryl Lynn mumps virus RNA and the synthetic RNA of genotypes B, C, D, E, and F were reverse transcribed and amplified using primers for the first reaction. The first round amplified products were visualized on agarose gels establishing the limits of detection of the first reaction to 3 50% tissue culture infective doses (TCID50) or 5,000 copies of each mumps virus genotype reference strain. The nested PCR assay increases the sensitivity of the assay to a threshold for detection of 0.03 TCID50 or 5 to 50 copies of each standard.

Specificity of RT-nested PCR assays was examined using a panel consisting of dilutions equivalent to 10 TCID50 of prototype strains of the following paramyxoviruses: measles virus; canine distemper virus; respiratory syncytial viruses A and B; and human parainfluenza viruses 1, 2, 3, and 4. All were negative in the assay.

Analysis of MV-positive clinical samples. Isolates of MV from clinical samples obtained through years 1995 to 2001 and samples of CSF previously positive for mumps virus RNA were amplified and directly sequenced in both directions. All samples previously positive for mumps virus RNA (diagnostic assay) were positive for the SH RT-nested PCR assay.

Phylogenetic analysis of clinical samples and generation of a complete mumps virus SH database. A database was constructed comprising all published SH gene sequences and used to analyze the classification scheme and phylogenetically compare the sequences obtained by sequencing. The trees obtained by analysis of representative strains of all genotypes and our unknown sample sequences allowed quick and easy differentiation of the corresponding genotype (Fig. 1).



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 1. The set of nucleotide sequences was aligned with Clustal W. Phylogenetic analysis was performed using the Kimura two-parameter model as a model of nucleotide substitution and using the neighbor-joining method to reconstruct the phylogenetic tree (MEGA version 2.1 software package). The statistical significance of the phylogenies constructed was estimated by bootstrap analysis with 1,000 pseudoreplicate data sets. For clarity, only a subset of the database is shown.

 
Seven sequences from Spain were analyzed and confirmed to be from genogroup H, as previously published by Montes et al. (16). Some clinical samples were also shown to be vaccine-associated cases of viral encephalitis or aseptic meningitis. Those cases appeared to be associated with the subcomponent J15 of the Jeryl Lynn strain. Whether these in fact represent cases of vaccine-induced disease remains to be determined. Finally, all the remaining sequences from mumps cases from Argentina belonged to the genotype D. This is the first description of mumps virus sequences from South America.

However, the generation of a database comprising all sequence information available for the region selected allowed us to delineate some classification problems; these problems were mainly related to the use of limited sets of available sequences for phylogenetic analysis.

In our analysis, group G and the strains that belong to this group, reported by Inou et al. (10) and Jin et al. (11), could be further differentiated as members of two different subgenotypes, G1 and G2, at the nucleotide (Fig. 2a) and amino acid (Table 3) levels. The subgrouping for selected sequences of genotype H by Utz et al. (30) could be applied to all remaining known sequences of the genotype allowing the subclassification of the strains into two groups, namely H1 and H2, and characterizing the Spanish isolates in the H2 subgenotype (Fig. 2b). The subdivision is also supported at the amino acid level (Table 3).




View larger version (92K):
[in this window]
[in a new window]
 
FIG. 2. (a) Phylogenetic tree of a genotype G strain; genotype B sequences were included as the outgroup. (b) Phylogenetic tree of genotype H strains; genotype C sequences were included as the outgroup. (c) Phylogenetic tree of genotype D and K strains, genotype F sequences were included as the outgroup. All available sequences of the corresponding genotype were included in the trees. The analysis method was the same as that reported for Fig. 1.

 

View this table:
[in this window]
[in a new window]
 
TABLE 3. Alignment of deduced amino acid sequences of clusters of mumps virus SH protein sequencesa

 
The subgroupings proposed for genotype C by Utz et al. (30) and Tecle et al. (28) do not seem to be significant when all sequences available where used (data not shown) although both could be supported by amino acid variation (Table 3).

Genotype D described in 1997 was a highly heterogeneous group that included strains of the actually recognized genotypes D, K, and H. A subset of those sequences reported by Orvell et al. (20) were only included for analysis later by Wu et al. (33). They were not included in any posterior analysis. We observed that they form a separate group to the actual genotype D (group D1 in the tree) (Fig. 2d), forming the group D2. The new proposed group seems to be an ancestor of the sequences of genotype K described originally by Tecle et al. (26) and also sequences of genotype L. Indeed, one of the old sequences (SE V28) belongs to genotype K. Genotypes D1, D2, K, L, and H are different at the amino acid level (Table 3).

Finally, although the topology of the tree is the same when all published MV sequences are included in the analysis, bootstrap values are consistently lower and sometimes not significant for some groups (data not shown). Some strain sequences confounded the analysis due to sequence dissimilarity and were classified as outliers. The strains RW (X63708), ge2-87 (reconstructed from the publication) (2), Tay-UK50 (AF142774), MP93-N (AB003415), and UK02-19 (AY380077) are in this list. The strains Tay-UK50 and UK02-19 have been reported previously as outliers (10, 12, 14) or proposed as a new genotype (12), respectively. The strain RW has been initially presented in group B5 in the initial classification of mumps virus SH genotypes (2) and after that was reported as genotype D (20, 26) or lately as an outlier (10, 30). The strain MP93-N was reported as a member of genotype D (10, 26, 33). However, in our analysis when we include all other strains of mumps virus, it is clearly separated at the base of the group D. In the previous publications, the strain also appears as a distant member of the group. We proposed this strain as a new outlier. Finally, the postvaccinal strain ge2-87, originally reported as the unique member of group B4 (2) and then reported in group D (33) and not included in any other analysis, thereafter is proposed here as being another outlier. Interestingly, most of the outliers seem to be related to genotype D. We found that their exclusion from the phylogenetic analysis resulted in improved bootstrapping values for other groups.

Sequence analysis results. Pairwise sequence analysis using Needleman Wunsch global alignment was carried out on the 200-bp SH fragment. An all-against-all sequence comparison was made to evaluate the possibility of using sequence similarity to classify genotypes. Significant sequence similarity was observed when comparing sequences within the same genotype. This was evaluated by analysis of variance between groups, comparing the scores of sequence comparisons within genotypes to comparisons between genotypes (Fig. 3) Each group was significant to the P < 0.001 level. Genotypes with only one member sequence were excluded from the analysis. Previously untyped sequences were assigned to the group with the greatest similarity. All unknowns were classified correctly into their genotypic group (Fig. 4).



View larger version (45K):
[in this window]
[in a new window]
 
FIG. 3. Pairwise analysis of all available sequences of mumps virus SH against themselves is represented in the graph. Pairwise nucleotide alignment between all members of the database was done. The average score between members of each genotype is plotted in the graph. The different colors represent the Needleman Wunch scores obtained for each genotype comparison.

 


View larger version (14K):
[in this window]
[in a new window]
 
FIG. 4. Pairwise analysis of four mumps virus strains randomly chosen from the database. Samples are 570LCR-Argentina, genotype A; SF47-Argentina, genotype D2; V0012-Spain-1996, genotype H1; and IS98-58-KOREA-1997 (GenBank accession number AF180384). A pairwise Needleman Wunch score for the test sequence against all other members of the database was determined. The average score (with the corresponding standard deviation) against members of each genotype is plotted in the graph.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We present a molecular method for genotyping of mumps viruses. Although it is not the first method proposed for mumps virus genotyping (1, 11, 27, 33), it is the first to be assessed as a diagnostic methodology with respect to sensitivity for analysis of a broad range of mumps virus genotypes. The method was applied mainly to CSF samples, where genotypic information is particularly important, given the significance of strain type as a determinant of neuroinvasiveness and the need to detect vaccine-derived disease.

The use of pairwise comparison to classify sequences has been used for enteroviruses (19, 21) and potyvirus (31). Multiple alignment and rigorous phylogenetic methods are preferable to establish exact lineages of sequence strains, discover recombination events, and positively identify regions; however, pairwise comparison can substitute if only a high level of taxonomic classification is desired. Here, we show that mumps virus genotypes can be classified using the sequence of SH gene region amplified by the PCR. The advantages of pairwise comparison for classification are speed, simplicity, and availability. The database and classification scheme provide a repository for sequences, complementing efforts in tracking mumps virus genotype distribution. A website has been deployed wherein clinical labs can post their sequences (www.greeneidlab.columbia.edu.) and location and circumstances of isolation or detection. The laboratory would instantly receive a report detailing the genotype, date, and location of the most similar sequence isolate in the database. New genotypes can readily be identified because the classification scheme will fail to relate them to any described group.

In conclusion, we propose a sensitive RT-nested PCR-based method for the molecular identification of mumps infections. The method has been tested using a broad range of genotypes and clinical samples. Major advantages of this approach are that cell culture is not needed, only a short fragment is required for sequencing, and a "sequence similarity-based" software is established that facilitates the rapid acquisition of results. This approach constitutes a useful tool for both the diagnosis and the epidemiological research on mumps infections in endemic and nonendemic areas. We have detected vaccine-associated disease, associated the sequences obtained with known genetic groups, and characterized strains of mumps virus circulating in South America. The use of an extended database of all available sequences of the mumps virus SH gene has also allowed us to reassess some of the previous classification attempts and propose or reevaluate some groupings.

Mumps SH-1 AS5' GATCAMYCACTCTAGAAAGATCYY 3'  GAAAGATCTCCAGTTTGAACACGTCC   (3)   GAAAGATCTCCAATTAGGACAAGTCC   (2)   GAAAGATCTCCAGTTAGGACAAGTCC   (2)   GGAAGATCTCCAGTTAGGACACGTCC   (1)   GGAAGATCCCCAGGTGGGACAAGTCC   (1)   GAAAGATCTCCAGTTAGGGCAAGTCC   (1)   GAAAGATCCCTAGTTAGGACAAGTCT   (1)   GAACGATCTCCAGTTAGGACAAGTCT   (1)   GATAGATCTCCATTTAGGACAGGTCC   (1)   GATAGATCTCTATTTAGGACAAGTCC   (1)   GAAAGATCTCCATCTAGGACAAATCC   (1)   GAAAGGTCTCCAGCTGGGAAAAGTCC   (1)   GAAAGATCTCCAGCTGGGAAAAGTCC   (1)   GAAAGATCTCCAGCGGGGAAAAGTCC   (1)   GAAAGATCTCCAGCCCGGACAAGTCC   (1)   GAGAGATCTCCAGCCAGGACAAGTCC   (1) Mumps SH-1AS5' GATCAMYCACTCTAGAAAGATCYCYAR 3'  internal  GATCACTCACTCTAGAAAGATCTCCAG   (54)  antisense  GATCACCCACTCTAGAAAGATCTCCAG   (16)  (6427-6453)  GATCACTCACTCTAGAAAGATATCCAG   (12)   GATCACTCACCCTAGGAAGATCTCCAG   (10)   GATCACTCACTCTAGGAAGATCTCCAG   (8)   GATCACTCACTCTAGAAAGATCTCCAA   (7)   GATCACTCATTCTAGATAGATCTCCAT   (5)   GATCAATCACTCTAGAAAGATCCCCAG   (5)   GATCAATCACTCTAGAAAGATCCTCAG   (4)   GATCACTCACTCTAGAAAGATCCCCAA   (4)   GATCACTCACTCTAAGAAGATCCCCAG   (1)   GATCACTCACTCTAGAAAGATCTCTAG   (1)   GATCACTCACTCTAGAAAGATCTCTAG   (1)   GATCACCCACTCTAGAAAGATCCCTAG   (1)   GATAACCCACTCTAGAAAGATCTCCAG   (1)   GATCACCCACTCTAGAAAAATCTCCAG   (1)   GATCATTCACTTTAGAAAGATCTCCAG   (1)   GATCACCCACTTTAGAAAGATCTCCAG   (1)   GATCATCAACTCTAGAAAGATCTCCAG   (1)   GATCACTCACTCTAGAACGATCTCCAG   (1)   GACCACCCACTCTAGAACGATCTCCAG   (1)   GATCACTCACTCTAGAAAGGTCTCCAG   (1)   GATCACTCACTCTAGAGAGATCTCCAG   (1)   GATCACTCATTCTAGATAGATCTCTAT   (1)   GATCACTCACTCTAGAAAGATCTCCAT   (1)   GATCACTCACCCTAGAAAGATCTCCAG   (1)


    ACKNOWLEDGMENTS
 
This investigation received financial support from the "Fundación Alberto J. Roemmers," Buenos Aires, Argentina. G. Palacios and W. I. Lipkin are supported by the Ellison Medical Foundation and the National Institutes of Health (AI 51292 and U54 AI57158-Lipkin). F. de Ory, J. E. Echevarria, A. Castellanos, and M. Mosquera are supported by the Instituto the Salud Carlos III (ISCIII 02/25).


    FOOTNOTES
 
* Corresponding author. Mailing address: Jerome L. and Dawn Greene Infectious Disease Laboratory, Mailman School of Public Health, Columbia University, 722 W 168th Street, Fl. 18, New York, NY 10032. Phone: (212) 342-9051. Fax: (212) 342-9044. E-mail: gp2050{at}columbia.edu. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Afzal, M. A., J. Buchanan, J. A. Dias, M. Cordeiro, M. L. Bentley, C. A. Shorrock, and P. D. Minor. 1997. RT-PCR based diagnosis and molecular characterisation of mumps viruses derived from clinical specimens collected during the 1996 mumps outbreak in Portugal. J. Med. Virol. 52:349-353.[CrossRef][Medline]
  2. Afzal, M. A., J. Buchanan, A. B. Heath, and P. D. Minor. 1997. Clustering of mumps virus isolates by SH gene sequence only partially reflects geographical origin. Arch. Virol. 142:227-238.[CrossRef][Medline]
  3. Afzal, M. A., G. D. Elliott, B. K. Rima, and C. Orvell. 1990. Virus and host cell-dependent variation in transcription of the mumps virus genome. J. Gen. Virol. 71:615-619.[Abstract/Free Full Text]
  4. Bang, H., and J. Bang. 1943. Involvement of the central nervous system in mumps. Acta Med. Scand. 113:487-505.
  5. Briss, P. A., L. J. Fehrs, R. A. Parker, P. F. Wright, E. C. Sannella, R. H. Hutcheson, and W. Schaffner. 1994. Sustained transmission of mumps in a highly vaccinated population: assessment of primary vaccine failure and waning vaccine-induced immunity. J. Infect. Dis. 169:77-82.[Medline]
  6. Casas, I., L. Powell, P. E. Klapper, and G. M. Cleator. 1995. New method for the extraction of viral RNA and DNA from cerebrospinal fluid for use in the polymerase chain reaction assay. J. Virol. Methods 53:25-36.[CrossRef][Medline]
  7. Committee, I. P. A. 1997. Mumps prevention. Morbid. Mortal. Wkly. Rep. 38:397-400.
  8. Elango, N., T. M. Varsanyi, J. Kovamees, and E. Norrby. 1988. Molecular cloning and characterization of six genes, determination of gene order and intergenic sequences and leader sequence of mumps virus. J. Gen. Virol. 69:2893-2900.[Abstract/Free Full Text]
  9. Elliott, G. D., M. A. Afzal, S. J. Martin, and B. K. Rima. 1989. Nucleotide sequence of the matrix, fusion and putative SH protein genes of mumps virus and their deduced amino acid sequences. Virus Res. 12:61-75.[CrossRef][Medline]
  10. Germann, D., A. Strohle, K. Eggenberger, C. A. Steiner, and L. Matter. 1996. An outbreak of mumps in a population partially vaccinated with the Rubini strain. Scand. J. Infect. Dis. 28:235-238.[Medline]
  11. Inou, Y., T. Nakayama, N. Yoshida, H. Uejima, K. Yuri, M. Kamada, T. Kumagai, H. Sakiyama, A. Miyata, H. Ochiai, T. Ihara, T. Okafuji, T. Nagai, E. Suzuki, K. Shimomura, Y. Ito, and C. Miyazaki. 2004. Molecular epidemiology of mumps virus in Japan and proposal of two new genotypes. J. Med. Virol. 73:97-104.[CrossRef][Medline]
  12. Jin, L., S. Beard, and D. W. Brown. 1999. Genetic heterogeneity of mumps virus in the United Kingdom: identification of two new genotypes. J. Infect. Dis. 180:829-833.[CrossRef][Medline]
  13. Jin, L., D. W. Brown, P. A. Litton, and J. M. White. 2004. Genetic diversity of mumps virus in oral fluid specimens: application to mumps epidemiological study. J. Infect. Dis. 189:1001-1008.[Medline]
  14. Kashiwagi, Y., T. Takami, T. Mori, and T. Nakayama. 1999. Sequence analysis of F, SH, and HN genes among mumps virus strains in Japan. Arch. Virol. 144:593-599.[CrossRef][Medline]
  15. Lee, J. Y., Y. Y. Kim, G. C. Shin, B. K. Na, J. S. Lee, H. D. Lee, J. H. Kim, W. J. Kim, J. Kim, C. Kang, and H. W. Cho. 2003. Molecular characterization of two genotypes of mumps virus circulated in Korea during 1998-2001. Virus Res. 97:111-116.[Medline]
  16. Minor, P. D. 1997. Laboratory tests for mumps vaccines. Biologicals 25:35-40.[CrossRef][Medline]
  17. Montes, M., G. Cilla, J. Artieda, D. Vicente, and M. Basterretxea. 2002. Mumps outbreak in vaccinated children in Gipuzkoa (Basque Country), Spain. Epidemiol. Infect. 129:551-556.[Medline]
  18. Needleman, S. B., and C. D. Wunsch. 1970. A general method applicable to the search for similarities in the amino acid sequence of two proteins. J. Mol. Biol. 48:443-453.[CrossRef][Medline]
  19. Nojd, J., T. Tecle, A. Samuelsson, and C. Orvell. 2001. Mumps virus neutralizing antibodies do not protect against reinfection with a heterologous mumps virus genotype. Vaccine 19:1727-1731.[CrossRef][Medline]
  20. Oberste, M. S., K. Maher, D. R. Kilpatrick, M. R. Flemister, B. A. Brown, and M. A. Pallansch. 1999. Typing of human enteroviruses by partial sequencing of VP1. J. Clin. Microbiol. 37:1288-1293.[Abstract/Free Full Text]
  21. Orvell, C., M. Kalantari, and B. Johansson. 1997. Characterization of five conserved genotypes of the mumps virus small hydrophobic (SH) protein gene. J. Gen. Virol. 78:91-95.[Abstract]
  22. Palacios, G., I. Casas, A. Tenorio, and C. Freire. 2002. Molecular identification of enterovirus by analyzing a partial VP1 genomic region with different methods. J. Clin. Microbiol. 40:182-192.[Abstract/Free Full Text]
  23. Poggio, G. P., C. Rodriguez, D. Cisterna, M. C. Freire, and J. Cello. 2000. Nested PCR for rapid detection of mumps virus in cerebrospinal fluid from patients with neurological diseases. J. Clin. Microbiol. 38:274-278.[Abstract/Free Full Text]
  24. Rice, P., I. Longden, and A. Bleasby. 2000. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 16:276-277.[CrossRef][Medline]
  25. Takeuchi, K., K. Tanabayashi, M. Hishiyama, and A. Yamada. 1996. The mumps virus SH protein is a membrane protein and not essential for virus growth. Virology 225:156-162.[CrossRef][Medline]
  26. Takeuchi, K., K. Tanabayashi, M. Hishiyama, A. Yamada, and A. Sugiura. 1991. Variations of nucleotide sequences and transcription of the SH gene among mumps virus strains. Virology 181:364-366.[CrossRef][Medline]
  27. Tecle, T., B. Bottiger, C. Orvell, and B. Johansson. 2001. Characterization of two decades of temporal co-circulation of four mumps virus genotypes in Denmark: identification of a new genotype. J. Gen. Virol. 82:2675-2680.[Abstract/Free Full Text]
  28. Tecle, T., B. Johansson, A. Jejcic, M. Forsgren, and C. Orvell. 1998. Characterization of three co-circulating genotypes of the small hydrophobic protein gene of mumps virus. J. Gen. Virol. 79:2929-2937.[Abstract]
  29. Tecle, T., A. Mickiene, B. Johansson, L. Lindquist, and C. Orvell. 2002. Molecular characterisation of two mumps virus genotypes circulating during an epidemic in Lithuania from 1998 to 2000. Arch. Virol. 147:243-253.[CrossRef][Medline]
  30. Uchida, K., M. Shinohara, S. Shimada, Y. Segawa, and Y. Hoshino. 2001. Characterization of mumps virus isolated in Saitama Prefecture, Japan, by sequence analysis of the SH gene. Microbiol. Immunol. 45:851-855.[Medline]
  31. Utz, S., J. L. Richard, S. Capaul, H. C. Matter, M. G. Hrisoho, and K. Muhlemann. 2004. Phylogenetic analysis of clinical mumps virus isolates from vaccinated and non-vaccinated patients with mumps during an outbreak, Switzerland 1998-2000. J. Med. Virol. 73:91-96.[CrossRef][Medline]
  32. Ward, C. W., N. M. McKern, M. J. Frenkel, and D. D. Shukla. 1992. Sequence data as the major criterion for potyvirus classification. Arch. Virol. Suppl. 5:283-297.[Medline]
  33. Wharton, M., S. L. Cochi, R. H. Hutcheson, J. M. Bistowish, and W. Schaffner. 1988. A large outbreak of mumps in the postvaccine era. J. Infect. Dis. 158:1253-1260.[Medline]
  34. Wu, L., Z. Bai, Y. Li, B. K. Rima, and M. A. Afzal. 1998. Wild type mumps viruses circulating in China establish a new genotype. Vaccine 16:281-285. (Erratum, 16:759.)[CrossRef][Medline]
  35. Yeo, R. P., M. A. Afzal, T. Forsey, and B. K. Rima. 1993. Identification of a new mumps virus lineage by nucleotide sequence analysis of the SH gene of ten different strains. Arch. Virol. 128:371-377.[CrossRef][Medline]


Journal of Clinical Microbiology, April 2005, p. 1869-1878, Vol. 43, No. 4
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.4.1869-1878.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Palacios, G.
Right arrow Articles by Lipkin, W. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Palacios, G.
Right arrow Articles by Lipkin, W. I.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Antimicrob. Agents Chemother. Clin. Microbiol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS