Department of Pediatric Pulmonology,1 Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent,2 Cystic Fibrosis Rehabilitation Centre "Zeepreventorium," De Haan, Belgium3
Received 26 July 2004/ Returned for modification 15 October 2004/ Accepted 31 January 2005
| ABSTRACT |
|---|
|
|
|---|
| TEXT |
|---|
|
|
|---|
Therefore we started a study to determine the prevalence and risk of transmission of P. aeruginosa among cystic fibrosis patients in a Belgian rehabilitation center (24). The P. aeruginosa-colonized patients lived there together as in a boarding school, with shared dining and living facilities but with separate bedrooms.
During this study we also identified other nonfermenting gram-negative bacilli present together with P. aeruginosa. Predominant among these were Achromobacter xylosoxidans isolates. Moreover, using randomly amplified polymorphic DNA analysis and amplified fragment length polymorphism (AFLP) typing, we found that several patients were carrying a common genotype of A. xylosoxidans.
The taxonomic position of A. xylosoxidans has been uncertain during the last decades, leading to name changes from Achromobacter to Alcaligenes and back to Achromobacter. The species was described as the type species of the genus Achromobacter (27). Later on, Kersters and De Ley (13) proposed to transfer the type species of the genus Achromobacter to the genus Alcaligenes. However, more recently, the results of phylogenetic analyses of 16S rRNA nucleotide sequences and a difference of more than 10% in GC content of DNA demonstrated that Achromobacter xylosoxidans and Alcaligenes faecalis, the type species of the genus Alcaligenes, belong to two distinct genera, respectively, Achromobacter and Alcaligenes (26).
Isolation and identification.
Lactose-negative colonies on McConkey agar were isolated on Mueller-Hinton agar containing 5% sheep blood and subsequently tested for oxidase activity. Oxidase-positive isolates were further identified using tDNA-PCR in combination with fluorescent capillary electrophoresis (2). This approach enables us to distinguish between gram-negative nonfermenters such as P. aeruginosa, Burkholderia species, and Achromobacter species (unpublished data) by comparing the tDNA-PCR fingerprints of unknowns with those of reference strains in a library (available at http://allserv.ugent.be/
mvaneech/LBR.html). Identification of isolates as Achromobacter xylosoxidans was confirmed by using API20 NE (bioMérieux, Marcy l'Etoile, France). Some of the isolates, identified genotypically as A. xylosoxidans, were initially considered atypical P. aeruginosa in our routine laboratory. Due to the diversity of colonial morphologies and biochemical reactivity encountered, misdiagnosis of gram-negative nonfermenters cultured from CF sputum may occur. In one study, misidentification of 11% of A. xylosoxidans strains was reported (20).
Genotyping. For each patient, the A. xylosoxidans isolates were first genotyped by means of arbitrarily primed PCR, using alkaline cell lysis for DNA extraction and randomly amplified polymorphic DNA analysis with Ready-to-Go beads (Amersham Biosciences AB, Uppsala, Sweden) with primer ERIC2 (AAGTAAGTGACTGGGGTGAGCG) at an annealing temperature of 35°C, as described previously (9). For the purpose of selective restriction fragment amplification (AFLP), total bacterial DNA was isolated from fresh cultures on tryptic soy agar by using a QIAamp DNA Mini kit (QIAGEN, Hilden, Germany). AFLP with one fluorescent primer (fAFLP) and with fragment length analysis by means of ABI310 (Applied Biosystems, Foster City, Calif.)-based capillary electrophoresis was carried out basically as described previously (22). Briefly, a combined restriction-ligation procedure was used in which 10 ng of total genomic DNA was incubated with 2 pmol of EcoRI adapter, 20 pmol of MseI adapter, 1 U of EcoRI (Amersham Biosciences), 1 U of MseI (New England Biolabs, Beverly, Mass.), 50 mM NaCl, 50 ng of bovine serum albumin per µl (Roche, Basel, Switzerland), and 4 U of T4 DNA ligase (Amersham Biosciences) in a total volume of 10 µl of 1x reaction buffer for 3 h at 37°C, after which the mixture was diluted 20 times with Tris buffer (Tris [10 mM]-EDTA [0.1 mM], pH 8.0). For the selective amplification of the restriction fragments, five microliters of the diluted restriction-ligation mixture was used for amplification in a volume of 10 µl under the following conditions: 0.4 µM TET-labeled EcoR + 0 primer, 1.2 µM Mse + C primer (Eurogentec, Seraing, Belgium) (E1), 0.2 mM each deoxynucleoside triphosphate, 1.5 mM MgCl2, 1x reaction buffer, and 1 U of GoldStar DNA polymerase (Eurogentec). After 2 min of incubation at 72°C and at 94°C the cycling conditions were 36 cycles of 30 s at 94°C, 30 s at 65 to 56°C, and 60 s at 72°C. During the first 13 cycles, the annealing temperature was lowered by 0.7°C per cycle. After an additional 10 min of incubation at 72°C, the samples were cooled. An overview of PCR primers and adapter sequences is shown in Table 1. To one µl of PCR product were added 12 µl of deionized formamide and 0.3 µl of GS-400 High Density size standard and 0.2 µl of GS-500 size standard, which both contain ROX-labeled fragments in the range of 50 to 500 bp, and this mixture was electrophoresed on an ABI PRISM 310 system (Applied Biosystems, Foster City, Calif.).
|
|
|
|
The 10 V-cluster patients came from seven different CF centers. During the first study period (from 8 January 2001 until 30 April 2001) (Table 3), 7 of these patients had an overlapping stay: in only one patient (V2) the V genotype was already cultured at arrival and in one patient (V6) a "new infection" could be suspected, and the five other patients remained free of the V genotype during this period. In the second study period (from 1 September 2001 until 23 October 2002) (Table 4), three patients (V2, V4, and V8) already carried the V genotype at (re)admission. However, possibly new infections with the V genotype could be suspected for six patients (V1, V3, V5, V7, V9, and B), all occurring within a period of 6 months (between 1 October 2001 and 1 April 2002).
Three of the four S-genotype patients were followed at the same CF center (B, S1, and S2). The S genotype was already cultured at arrival in three patients (S1, S2, and S3). The fourth patient (B) only showed his S genotype at readmission, after an absence of 3 months. During the previous stays of this patientlasting 4 and 2 months, respectivelycultures were always negative for the S genotype. It is therefore possible that patient-to-patient transmission took place at the CF center, where the patient was followed with two other S-cluster patients.
All patients colonized with A. xylosoxidans, except patients S1 and S2, also carried P. aeruginosa genotypes, with patient B having up to three different P. aeruginosa genotypes in addition to his/her three A. xylosoxidans genotypes. These data at first glance appear to point to a strong tendency of cocolonization with P. aeruginosa and A. xylosoxidans but may be biased, since the study included only patients assumed to be colonized with P. aeruginosa. No study was undertaken to establish in how many cases patients were carrying A. xylosoxidans without P. aeruginosa. Also, Tan et al. (23) reported that most patients carrying A. xylosoxidans were colonized by P. aeruginosa, and in another study, six of the eight patients with A. xylosoxidans were also colonized with P. aeruginosa (17).
We found, for the same population, 14 clusters of P. aeruginosa, comprising 2 to 10 patients per cluster (24). Thus, the largest cluster of A. xylosoxidans colonization (10 patients) was the same size as the largest P. aeruginosa cluster. Furthermore, when a patient was colonized by A. xylosoxidans, its isolates always belonged to one of two shared genotypes, with patient B even colonized by isolates of both genotypes, whereas in the same population 45/76 patients (59%) were found carrying a P. aeruginosa strain not related to any other strain and thus with a separate genotype. So it can be stated that there was much less genotypic diversity among the A. xylosoxidans strains observed compared with the P. aeruginosa strains for the same patient population.
A. xylosoxidans has been recognized as an emerging CF pathogen since one study published in 1985 (14) and later on in several others (3, 4, 6, 7, 8). Fabbri et al. (7) identified 12 of the 71 isolates (16.9%) from 24 patients as A. xylosoxidans. Ferroni et al. (8) reported A. xylosoxidans to be the second most frequent gram-negative nonfermenter, after P. aeruginosa, among 1,093 isolates from 148 patients (10 isolates from 8 patients). Moissenet et al. (17) reported colonization with A. xylosoxidans in 6% of 120 CF children, with a mean age of 14.2 years for colonized children. Still, the prevalence may be higher, since in one study A. xylosoxidans was detected in CF patients only after usage of a selective medium (18). A phase III study of aerosolized tobramycin showed that a much higher number of the 595 patients were colonized with Stenotrophomonas maltophilia, A. xylosoxidans, Aspergillus species, and oxacillin-resistant Staphylococcus aureus than had been established by the CF foundation patient registry efforts (4). In this study, A. xylosoxidans (in 8.7% of the patients) was almost as frequently isolated as S. maltophilia (10.3%).
Although colonization of CF patients with A. xylosoxidans is well established, epidemiological studies thus far have been unable to establish evidence of much transmission of strains of this species. Dunne and Maisch (6) in 1995 had already reported persistent colonization of outpatients with A. xylosoxidans but did rule out patient-to-patient transmission by means of PCR-based genotyping. Vu-Thien et al. (25) found persistent colonization of patients with Burkholderia cepacia, S. maltophilia, and A. xylosoxidans but could show the presence of identical isolates in different patients only for B. cepacia. In a large study including 92 A. xylosoxidans-positive patients from 46 centers, Krzewinski et al. (15) found five pairs of patients, which included two pairs of siblings and one pair of friends, with genotypically identical A. xylosoxidans isolates. Furthermore, one additional instance of cross-colonization with A. xylosoxidans in two siblings (19) and the presence of the same strain in two of eight colonized children (17) were reported. Our study revealed two large clusters of patients colonized by the same A. xylosoxidans strains. These findings are supported by a recent publication of Kanellopoulou et al. (12) that showed that A. xylosoxidans isolates of five colonized CF patients were genetically related, suggesting a common-source outbreak.
Although for most of the nonfermenting gram-negative rods the disk diffusion antibiogram is not validated by the CLSI (formerly NCCLS), we carried out an antibiogram to evaluate its possible usefulness as a preliminary typing technique. Several interpretation problems were apparent, such as heterogeneous growth in the inhibition zone and unclear inhibition zone borders. In our hands this approach indicated that all isolates except one showed large inhibition zones for piperacillin (30 to 45 mm) and showed no inhibition zone for amikacin, gentamicin, ofloxacin, ampicillin, aztreonam, temocillin, cefuroxime, and cefotaxime. The activity of ceftazidime and meropenem was very variable, while that of cotrimoxazole and colimycin was difficult to interpret. Fabbri et al. (7) found this organism to be the least susceptible for antibiotics among gram-negative nonfermenting rods and concluded that ceftazidime was most active. We found very variable results for ceftazidime, while for only one strain (B other) no large inhibition zone for piperacillin was observed. Also, Saiman et al. (20) found piperacillin among the most active antibiotics in vitro. There were no consistent susceptibility characteristics which enabled one to differentiate between the four genotypes, but the susceptibility pattern, i.e., colimycin resistance and combined resistance to aminoglycosides and quinolones, was considered to be helpful in distinguishing this species from P. aeruginosa.
The pathogenic potential of these newly emerging CF "pathogens" has been ill studied. One study (10) addressed the endotoxic potential of eight species of gram-negative organisms, including A. xylosoxidans, and found that, with the exception of S. maltophilia, lipopolysaccharide extracted from all of the bacteria upregulated, by various degrees, expression of each of the proinflammatory cytokines assayed. Given the high antibiotic resistance observed in this and previous studies and taking into account that some strains may be transmissible, it may be advisable to pay attention to the presence of A. xylosoxidans in the lungs of cystic fibrosis patients. Tan et al. (23) showed in their retrospective case-controlled study of 557 CF patients that the 13 patients that were chronically infected with A. xylosoxidans did not deteriorate more in clinical or pulmonary function than patients colonized with P. aeruginosa only. More clinical data will be necessary in the future to resolve the issue regarding the pathogenicity of A. xylosoxidans in CF patients.
In summary, although several authors have indicated that transmissibility of A. xylosoxidans is low, we report the occurrence of genotypically identical strains of this species among two clusters of CF patients attending the same rehabilitation center.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Antimicrob. Agents Chemother. | Clin. Microbiol. Rev. |
|---|---|
| Clin. Vaccine Immunol. | ALL ASM JOURNALS |
|---|