Previous Article | Next Article 
Journal of Clinical Microbiology, July 2005, p. 3373-3379, Vol. 43, No. 7
0095-1137/05/$08.00+0 doi:10.1128/JCM.43.7.3373-3379.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Differential Distribution and Expression of Panton-Valentine Leucocidin among Community-Acquired Methicillin-Resistant Staphylococcus aureus Strains
Battouli Saïd-Salim,1
Barun Mathema,1
Kevin Braughton,2
Stacy Davis,1
Daniel Sinsimer,1,3
William Eisner,1
Yekaterina Likhoshvay,1
Frank R. DeLeo,2 and
Barry N. Kreiswirth1*
TB Center, Public Health Research Institute, Newark, New Jersey 07103,1
Laboratory of Human Bacterial Pathogenesis, Rocky Mountain Laboratories, and National Institute of Allergy and Infectious Diseases, National Institutes of Health, Hamilton, Montana 59840,2
and Department of Microbiology and Molecular Genetics, University of Medicine and Dentistry of New Jersey, Newark, New Jersey 071033
Received 2 November 2004/
Returned for modification 23 December 2004/
Accepted 25 February 2005

ABSTRACT
Community-acquired methicillin-resistant
Staphylococcus aureus (CA-MRSA) is an emerging threat worldwide. CA-MRSA strains differ
from hospital-acquired MRSA strains in their antibiotic susceptibilities
and genetic backgrounds. Using several genotyping methods, we
clearly define CA-MRSA at the genetic level and demonstrate
that the prototypic CA-MRSA strain, MW2, has spread as a homogeneous
clonal strain family that is distinct from other CA-MRSA strains.
The Panton-Valentine leucocidin (PVL)-encoding genes,
lukF and
lukS, are prevalent among CA-MRSA strains and have previously
been associated with CA-MRSA infections. To better elucidate
the role of PVL in the pathogenesis of CA-MRSA, we first analyzed
the distribution and expression of PVL among different CA-MRSA
strains. Our data demonstrate that PVL genes are differentially
distributed among CA-MRSA strains and, when they are present,
are always transcribed, albeit with strain-to-strain variability
of transcript levels. To directly test whether PVL is critical
for the pathogenesis of CA-MRSA, we evaluated the lysis of human
polymorphonuclear leukocytes (PMNs) during phagocytic interaction
with PVL-positive and PVL-negative CA-MRSA strains. Unexpectedly,
there was no correlation between PVL expression and PMN lysis,
suggesting that additional virulence factors underlie leukotoxicity
and, thus, the pathogenesis of CA-MRSA.

INTRODUCTION
Staphylococcus aureus is an important human pathogen capable
of causing diseases in the hospital and community settings (
23).
The increased incidence of multidrug-resistant
S. aureus strains
among nosocomial (or hospital-acquired [HA]) infections has
added a challenging dimension to the
S. aureus problem (
5).
These strains are typically labeled HA methicillin-resistant
Staphylococcus aureus (MRSA) strains or simply MRSA strains.
Several risk factors, such as recent hospitalization or exposure
to a health care setting, residence in long-term-care facilities,
invasive or surgical procedures, and injection drug use, predispose
a patient to MRSA acquisition.
Methicillin resistance in S. aureus is conferred by the mecA gene, which encodes an altered penicillin binding protein (PBP 2') (22). The mecA gene is harbored in a large mobile genetic element (referred to as the staphylococcal chromosomal cassette mec [SCCmec]) that has a unique chromosomal integration locus (14). Sequence analyses defined three major SCCmec types (SCCmec types I, II, and III) among nosocomial MRSA strains. SCCmec types are distinguished on the basis of their sizes, which range from 26 and 67 kb, and genetic compositions, in which their genomes include recombinases and antibiotic resistance genes (16).
In the community, the majority of S. aureus infections, which include skin and soft tissue infections (6, 8, 13, 23), are caused by methicillin-susceptible S. aureus (MSSA) strains. However, since 1991 there have been increasing reports of MRSA infections in the community and in patients with and without risk factors for MRSA infection (4, 5). These MRSA strains, commonly referred to as community-acquired MRSA (CA-MRSA) strains (7, 8, 11-13, 18, 20, 30), differ from nosocomial MRSA strains on the basis of their genetic backgrounds and antibiograms. CA-MRSA strains harbor the recently described SCCmec type IV element in their genomes. Compared with other SCCmec types, the SCCmec type IV element is distinguished by its small size, the presence of functional recombinases, and the absence of antibiotic resistance markers (25). This distinction is consistent with the observation that CA-MRSA strains are more susceptible to antibiotics than hospital-acquired MRSA strains. In fact, many CA-MRSA strains are highly susceptible and show resistance only to ß-lactam antibiotics, an observation that clearly distinguishes them from the multidrug-resistant nosocomial MRSA strains.
The genome of prototypic CA-MRSA strain, MW2, was fully sequenced (1) and revealed the presence of the SCCmec type IV element described above (15). Additionally, the sequencing results for this strain revealed unique CA-MRSA-specific virulence factors. For example, MW2 harbors the Panton-Valentine leucocidin (PVL), encoded by two contiguous and cotranscribed genes (lukF and lukS); staphylococcal enterotoxin H (seh); and staphylococcal enterotoxin C (sec). PVL, a bicomponent, secreted leucocidin found in <5% of S. aureus isolates (21), is cytotoxic to human and rabbit monocytes, macrophages, and human polymorphonuclear leukocytes (PMNs) (10). The protein forms nonspecific pores in leukocyte plasma membranes, which result in increased permeability and eventual host cell lysis (32). PVL has gained much attention as one of the key virulence determinants present in CA-MRSA strains. Lina and colleagues (21) found that 50 to 93% of the S. aureus strains causing primary skin infections produce PVL. Furthermore, a study by Gillet et al. (10) demonstrated a strong association between PVL and necrotizing pneumonia in healthy children and young adults. From these studies, the authors hypothesized that the propensity of many CA-MRSA strains to cause severe skin and soft tissue infections and, occasionally, necrotizing pneumonia is due to their ability to produce PVL (10, 21).
Previous studies have defined CA-MRSA strains as isolates recovered within 48 h after hospital admission and/or in patients without known risk factors for MRSA acquisition. Given the fluidity between community and health care settings, i.e., with hospital strains being transferred into the community and vice versa (29), we opted to utilize a genetic approach based on the presence of SCCmec type IV to define CA-MRSA. The presumed role of PVL in the pathogenesis of CA-MRSA led us to investigate the distribution of PVL among CA-MRSA strains in our collection and evaluate its expression. Furthermore, to gain insight into the role of PVL during infection, we assessed PMN lysis during phagocytic interaction with PVL-negative and PVL-positive S. aureus strains of closely related genetic backgrounds.

MATERIALS AND METHODS
Strain collection.
One hundred twenty-one strains were grouped as CA-MRSA based
on the presence of the SCC
mec type IV element in their genomes.
Eighty-three strains were sent to our laboratory by clinical
institutions for genotyping. These strains were suspected of
being CA-MRSA based on their reduced drug resistance profile;
and SCC
mec typing, indeed, classified them as SCC
mec type IV
(see below). These strains were susceptible to two or all three
of the following antibiotics: fluoroquinolones, clindamycin,
and erythromycin. As certain genetic backgrounds based on
spa type (
spa types 1, 7, and 17) appear to be prevalent among CA-MRSA
strains, we selected from our database additional strains with
these genotypes for SCC
mec typing. Strains that were classified
as SCC
mec type IV were included in this study. In a previous
study, we used several genotyping techniques, including a side-by-side
pulsed-field gel electrophoresis (PFGE) comparison, to demonstrate
that an MSSA strain known as MnCop was the parental strain of
MW2 (
8). The
spa type 35 of MnCop is closely related to MW2
spa type 131, as they both share the same multilocus sequence
typing (MLST) profile (data not shown). For this reason, we
included several MSSA strains from our collection of
spa type
35 strains in this study.
SCCmec typing.
Multiplex PCR analysis was performed as described previously (26) to distinguish the four genetic elements for SCCmec, with one modification; that is, the pls gene was amplified by using the following primers from the sequence with GenBank accession number AF115379: primer PlsF (GGGGTGGTTAATGGTATGAATAAA) and primer PlsR (CGGAATGTTGCTCTTGGTTGTGCGTTTTC).
spa typing.
The method of spa typing was developed in our laboratory, and its accuracy and discriminatory power for determination of the subspecies of S. aureus strains is superior to that of MLST analysis (19, 27). Spa typing is a DNA sequencing-based method that distinguishes strains based upon the makeup of the variable number of tandem repeats in the 3' region of the protein A gene, which is both unique and conserved among S. aureus isolates. Currently, the Public Health Research Institute database contains 625 different spa types among a collection of over 2,500 S. aureus isolates.
PFGE.
PFGE was performed and the results were interpreted as described previously (33). Briefly, the organisms were embedded in agarose, and the intact chromosome was digested with SmaI. DNA fragments were resolved for 22 h with a Bio-Rad CHEF DR-II PFGE unit (Bio-Rad, Hercules, CA).
agr typing.
the S. aureus strains were analyzed for their agr types by the method of Jarraud et al. (17). The agr types were identified by PCR amplification of the hypervariable domain of the agr locus by using oligonucleotide primers specific for each of the four major agr types, as described by Shopsin et al. (31).
Detection of PVL genes.
The presence of genes encoding PVL was determined by Southern blot analysis, as described below, and by PCR with the following primers: primer LukS-PV (GGCCTTTCCAATACAATATTGG) and primer LukF-PV (CCCAATCAACTTCATAAATTG). Thermal cycling was performed in a GeneAmp 9600 instrument (Perkin-Elmer Corporation, Applied Biosystems, Foster City, CA); and the parameters consisted of initial heating at 95°C for 5 min, followed by 35 cycles of denaturation (1 min at 94°C), annealing (30 s at 57°C), and extension (1 min at 72°C).
The presence of PVL was validated by molecular beacon analysis with the lukF component of pvl. The beacon experiment was carried out by using the following beacon and primers: primer lukF beacon [5'-6-FAM d(CGCGAAGAATTTATTGGTGTCCTATCTCGATCGCG)-DABCYL-3', where FAM is 6-carboxyfluorescein and DABCYL is 4-(4'-dimethylaminophenylazo)benzoic acid], primer LukF F (5'-GCCAGTGTTATCCAGAGG-3'), and primer LukF R (CTATCCAGTTGAAGTTGATCC-3').
The quantitative real-time PCR mixture contained 1x I.Q. supermix (Bio-Rad), 0.1 µM of each molecular beacon, 0.5 µM of each primer, and DNA template. The thermal cycling program consisted of 10 min on a spectrofluorometric thermal cycler (iCycler; Bio-Rad) at 95°C, followed by 45 cycles of 30 s at 95°C, 30 s at 50°C, and 30 s at 72°C.
Southern blot analysis.
Chromosomal DNA was digested with the ClaI restriction enzyme, and Southern blot hybridization was performed as described elsewhere (28).
RNA isolation.
S. aureus strains were cultured to postexponential phase, and RNA isolation and detection were performed as described previously (28).
Reverse transcription-PCR with lukF beacon.
The first-strand cDNA for the lukF gene was synthesized by using a Omniscript RT PCR kit (QIAGEN) with the lukF reverse primer described above. Samples incubated in the absence of reverse transcriptase served as controls. Quantitative real-time PCR was performed as described above. A molecular beacon probe for a Staphylococcus genome-specific region of the 16S rRNA gene (SG16S) was used as a control. The sequences of the SG16S forward and reverse primers, as well as the molecular beacon sequence, are as follows: primer SG16S-F, 5'-TGGAGCATGTGGTTTAATTCGA-3'; primer SG16S-R, 5'-TGCGGGACTTAACCCAACA-3'; and probe SG16S-MB, 5'-[HEX]-CGCTGACTTACCAAATCTTGACATCCTTCAGCG-[DABCYL]-3', where HEX is hexachlorofluorescein.
Standard curves were generated to calculate the copy numbers of each gene in the reaction. Briefly, this was accomplished by taking the cycle threshold (CT) value for each sample and applying the following formula:
where
the slope and
y-intercept values were calculated from the standard
curve by using Stratagene Mx4000 software (Stratagene Corporation,
La Jolla, CA). Each sample was assayed in triplicate, and the
average number of
pvl copies was divided by the average number
of SG16S copies to obtain a normalization value. The average
standard deviation in the cycle thresholds for both
pvl and
SG16S probes was less than 1 cycle.
Isolation of human PMNs and assay for PMN lysis (release of lactate dehydrogenase [LDH]).
Human PMNs were isolated from the venous blood of healthy individuals, in accordance with a protocol approved by the Institutional Review Board for Human Subjects, National Institute of Allergy and Infectious Diseases. Human PMNs were purified by the method described by Boyum (3), but with modifications. Briefly, whole human blood was mixed 1:1 with 0.9% NaCl (Irrigation USP; Abbott Laboratories, North Chicago, Ill.) containing 3% dextran 500 (Amersham Biosciences, Piscataway, NJ) for 20 min to sediment the erythrocytes. The leukocyte-rich supernatant was transferred to a new tube and was centrifuged at
670 x g for 10 min. The cells were resuspended in 35 ml 0.9% NaCl, and the suspension was underlaid with 10 ml Hypaque-Ficoll-Paque Plus (1.077 g/liter; Amersham). The cells were centrifuged at 350 x g for 25 min at room temperature to separate the peripheral blood mononuclear cells (PBMCs) from the PMNs and erythrocytes. The PBMC layer was removed by aspiration, and the cell pellet containing the PMNs and erythrocytes was resuspended in water (Irrigation USP; Abbott Laboratories) for 15 to 30 s. Isotonicity was restored by adding an equal volume of 1.7% NaCl. PMNs were centrifuged again, resuspended in RPMI 1640 medium (Invitrogen Corporation, Carlsbad, CA) buffered with 10 mM HEPES (RPMI/H), and enumerated with a hemacytometer. The purities of the PMN preparations and cell viability were routinely assessed by flow cytometry (FACSCalibur; BD Biosciences, San Jose, CA). Cell preparations contained 98 to 99% PMNs, and all reagents used contained <25 pg/ml endotoxin.
Strains of S. aureus were cultured to mid-exponential phase of growth (optical density at 600 nm = 0.75) and resuspended in RPMI/H. Bacteria (107) were combined on ice with human PMNs (106), and phagocytosis was synchronized by centrifugation at 350 x g for 8 min at 4°C. The culture plates were incubated at 37°C with 5% CO2 for the indicated times, and the release of cytosolic PMN LDH (cell lysis) was evaluated with a cytotoxicity detection kit (Roche Applied Sciences, Indianapolis, IN), according to the manufacturer's instructions. The assay is based on the conversion of lactate to pyruvate by LDH, whereby NAD+ is reduced to NADH/H+. Diaphorase utilizes H/H+ from NADH/H+ to reduce 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium chloride to formazan. Colorimetric detection of LDH activity was performed with triplicate wells by using a SpectraMax Plus384 microplate spectrophotometer (Molecular Devices, Sunnyvale, CA) at 490 nm and a reference
of 600 nm. The percent cell lysis induced by S. aureus was determined with the measured absorbance readings in the equation {[(absorbance for S. aureus and PMN mixture absorbance for S. aureus alone) absorbance for time-matched, untreated human PMNs (spontaneous release of LDH)]/[absorbance for PMNs treated with 2% Triton X-100 (maximum releasable LDH activity) absorbance for time-matched, untreated human PMNs (spontaneous release of LDH)]} x 100.

RESULTS
Molecular characterization of CA-MRSA strains. (i) CA-MRSA spa types.
One hundred twenty-one geographically diverse isolates in our
strain collection (clustered based on SCC
mec type IV) were genotyped
by sequencing the polymorphic repeat region of the gene encoding
protein A (
spa) and by PFGE. From this analysis the CA-MRSA
strains were divided into five major groups defined by their
spa types (Table
1). The first group consisted of strains with
the same
spa type as prototypic CA-MRSA strain MW2 (
spa type
131; MLST type 1-1-1-1-1-1-1). The second group included strains
with
spa type 1 isolated from human immunodeficiency virus (HIV)-positive
as well as HIV-negative patients in Los Angeles and New York
City. Group 3 consisted of strains of
spa type 7. We note that
these
spa types differ by a single nucleotide and that their
MLST types differ by a single allele;
spa type 1 is MLST 3-3-1-1-4-4,
and
spa type 7 is MLST 3-3-1-1-4-16. The fourth group consisted
of
spa type 17 strains, and the fifth group had various
spa types and is listed as miscellaneous (Table
1). These results
suggest that although CA-MRSA strains share certain molecular
characteristics, they are not a single clonal type but, rather,
are derived from a number of genetic backgrounds.
(ii) CA-MRSA PFGE.
Using a more discriminatory genotyping tool, PFGE, we were able
to differentiate CA-MRSA strains of the same
spa type. PFGE
patterns were indistinguishable among
spa type 131 isolates,
indicating that
spa type 131 strains define a clone (Fig.
1).
The data for
spa type 35 strains indicate that these
spa types
are closely related to each other (at least at the genetic level)
and to
spa type 131 strains. Furthermore, among the miscellaneous
spa types,
spa type 194 had a
spa repeat pattern similar to
that of
spa type 131 (Table
1). Of interest, three
spa type
194 strains in our collection were isolated from the Midwest
(United States), as was our
spa type 131 reference strain, MW2.
These strains have subtle PFGE pattern differences and are thus
closely related to each other and to
spa type 131 (Fig.
1).
On the other hand, strains of
spa types 1, 7, and 17 had significant
PFGE pattern differences and deviated significantly from
spa type 131 strains. These data indicate that although these strains
share the same SCC
mec type, they are not clonal (Fig.
1) and
their genetic background is quite distinct from that of the
MW2 clone.
(iii) CA-MRSA agr types.
Four major
agr types (
agr types I, II, III, and IV) have been
identified among
S. aureus strains. Two recent studies demonstrated
that CA-MRSA strains fall into the
agr III group (
24,
34). To
further determine the genetic backgrounds of our CA-MRSA isolates,
we assessed their
agr types by PCR, as described previously
(
31). Consistent with the findings of previous studies (
30,
31), CA-MRSA strains of the MW2 clone (
spa type 131) and those
of
spa types 35 and 194 belong to
agr type III. Thus,
agr type
III appears to be linked to strains genetically related to MW2.
Interestingly, all of the other strains of the different
spa types were
agr type I. Taken together, our data from the different
genotyping methods (
spa, PFGE, and
agr typing) demonstrate that
CA-MRSA has multiple genetic backgrounds and that the MW2 clone
is genetically distinct from the other CA-MRSA strains.
Distribution and expression of PVL in CA-MRSA.
Previous studies suggest that PVL is a significant virulence determinant in the pathogenesis of CA-MRSA. Therefore, we analyzed the distribution of PVL among the different CA-MRSA strains using PCR coupled with Southern blot analysis and a lukF-specific beacon. We used additional techniques to validate the PCR results because the genes encoding PVL share high homologies to other leucocidins, such as
-hemolysin, and in some instances, the primers can amplify these homologous genes. Our results indicate that the PVL genes are present among all spa type 131 isolates (MW2 clone), an observation that supports the idea that these strains are clonal (Table 1). Furthermore, all spa type 194 strains analyzed possessed the PVL genes. On the other hand, none of the spa type 7 strains tested contained the genes encoding PVL. There was a differential distribution of PVL in spa types 1, 17, and 35; and only a subset of these strains contained the gene. Although not all CA-MRSA strains possessed PVL, we observed a significant increase in the number of PVL-positive strains (33 to 50%) among the CA-MRSA strains tested compared to that reported in the literature for other S. aureus strains (<5%) (21). This finding is in agreement with that of a recent study that demonstrated the increased prevalence of PVL among CA-MRSA strains compared to that among HA-MRSA strains (24).
Although a number of investigations have demonstrated an association of the PVL genes and CA-MRSA, their mRNA levels in different genetic backgrounds have not been analyzed. We first confirmed that CA-MRSA isolates containing the lukF and lukS genes expressed the corresponding messages. PVL transcripts were identified by real-time reverse transcription-PCR coupled with the use of a molecular beacon specific for lukF. CA-MRSA BK 9924, which lacks PVL genes, was used as a negative control. Notably, the PVL transcript was expressed in all strains harboring the PVL genes (Fig. 2). However, the levels of expression of genes encoding PVL varied from strain to strain, with isolate 9918 expressing nearly 10-fold more of the PVL message than any other isolate.
PVL- and CA-MRSA-induced PMN lysis.
Previous investigators have suggested that PVL facilitates the
pathogenesis of
S. aureus, presumably by altering human leukocyte
responses to infection (
10,
32). To assess the impact of PVL
in the pathogenesis of CA-MRSA, we determined the cytotoxicity
(lysis) for human PMNs during phagocytic interaction with PVL-positive
and PVL-negative CA-MRSA strains (Fig.
3A). Each pair of PVL-positive
and PVL-negative isolates comprised strains of closely related
genetic backgrounds (Fig.
3B). Unexpectedly, there was no significant
correlation between strains that expressed PVL and human PMN
cytotoxicity. For example, in some cases the PVL-negative strain
caused higher levels of PMN lysis compared to the levels of
lysis caused by the genetically matched PVL-positive strain.
Finally, in the
spa type 35 genetic background, the cytotoxicity
for PMNs was similar for both PVL-negative and PVL-positive
strains (Fig.
3A). Although there is a higher incidence of PVL
among CA-MRSA strains, our in vitro data suggest that other
factors produced by CA-MRSA strains facilitate leukocidal activity.

DISCUSSION
CA-MRSA is an emerging pathogen that can cause severe and, in
some cases, fatal infections in the community. CA-MRSA strains
share certain properties such as the presence of a genomic SCC
mec type IV element and increased susceptibilities to a variety
of antibiotics (compared to those of HA-MRSA strains). We and
others demonstrated that CA-MRSA strains have multiple genetic
backgrounds, and we have extended this analysis in this study
to show how the clonal MW2 CA-MRSA strains are differentiated
from other strain families. This is particularly important to
understanding of the relationship between genetic backgrounds
and CA-MRSA disease.
The agr data indicate that CA-MRSA can be subdivided into two groups. The first group consists of the "true" CA-MRSA strains, i.e., MW2 and related strains (spa types 131 and 194). These strains tend to be susceptible to a wide array of non-beta-lactam antibiotics and have the agr III subtype (Table 1). The prevalence of agr type III among CA-MRSA strains has been reported previously (24, 34), and our results are in agreement with the findings from those studies. The second family consists of strains of spa types 1, 7, 17, and other miscellaneous spa types. In addition to the beta-lactams, this group is also resistant to erythromycin and, sometimes, fluoroquinolones. Unlike the MW2 clone, the second group belongs primarily to the agr I subtype. The grouping of CA-MRSA strains into two agr subgroups is in agreement with our previous study that classified CA-MRSA strains into two epidemiological groups, i.e., CA-MRSA strains with and without risk factors (29). Interestingly, CA-MRSA strains without risk factors correspond to the agr type III subgroup, and CA-MRSA strains with risk factors correspond to the agr type I subgroup.
Although the genes encoding PVL are rarely present in S. aureus strains (<5%) (21), they are highly represented among CA-MRSA strains. All spa type 131 and 194 strains tested contain lukF and lukS, consistent with their clonality, as determined by PFGE analysis (Fig. 1). On the other hand, only a subset of the other spa types has these genes, again, in concordance with their heterogeneous pulsotypes, as determined by PFGE. These results are in contrast to those of a recent study that reported on the presence of PVL in all CA-MRSA strains analyzed (34). Although the study by Vandenesch and colleagues (34) analyzed a collection of diverse CA-MRSA strains, they can be categorized as CA-MRSA strains without risk factors (34). In addition, 97% of the isolates tested were of agr type III. The discrepancy between the two studies may be explained by the difference in the two collections. For instance, the collection used by Vandenesch and colleagues (34) would exclude the agr type I CA-MRSA strains previously described in the Los Angeles population of men who have sex with men (6). As our collection is more inclusive (based on agr types) and consists of CA-MRSA strains both with and without risk factors, we report an unequal distribution of the genes encoding PVL among our strains.
PVL has been demonstrated to be cytotoxic to human PMNs, which are essential for the innate host defense against invading microorganisms (23, 32). Therefore, we used PMN lysis as a proxy for CA-MRSA virulence and pathogenesis. However, our results demonstrate that the presence (or absence) of PVL failed to correlate with the degree of PMN lysis, suggesting that additional factors are involved in leukotoxicity and the pathogenesis of CA-MRSA.
The conflicting results of the role of PVL in the pathogenesis of CA-MRSA are similar to the results reported on the role of the Salmonella plasmid virulence (spv) genes (9). One study demonstrated that spv genes are important virulence determinants, as an spvR mutant of Salmonella enterica serovar Dublin was attenuated in both enteric and systemic diseases. Conversely, another study reported that an spvR mutant of S. enterica serovar Typhimurium causes lethal enteric infection similar to that caused by the wild-type strain. Taken together, these results reiterate the multifactorial nature of bacterial pathogenesis. To better elucidate the role of PVL in the pathogenesis of CA-MRSA, comparative analyses with isogenic strains (PVL positive and negative) both in vitro and in vivo are needed. Deciphering of the pathogenesis of CA-MRSA strains will require multipronged strategies aimed at both the microbial level and the host level (2).
In summary, this study demonstrates that prototypic CA-MRSA strain MW2 and its related strains form a subclone different from other CA-MRSA strains at the genotypic and phenotypic levels. The presence and expression of the PVL-encoding genes are not uniform among CA-MRSA strains. Finally, these data do not support a clear correlation between the presence of PVL and the ability of the strain to cause PMN cytotoxicity.

ACKNOWLEDGMENTS
We are grateful to Surbhi Leekha and Madhavi Koraboina for technical
assistance with
lukF beacon essays and Alex Ravikovitch for
assistance with the figures.

FOOTNOTES
* Corresponding author. Mailing address: TB Center, Public Health Research Institute, 225 Warren Street, Newark, NJ, 07103. Phone: (973) 854-3240. Fax: (973) 854-3241. E-mail:
barry{at}phri.org.


REFERENCES
1 - Baba, T., F. Takeuchi, M. Kuroda, H. Yuzawa, K. Aoki, A. Oguchi, Y. Nagai, N. Iwama, K. Asano, T. Naimi, H. Kuroda, L. Cui, K. Yamamoto, and K. Hiramatsu. 2002. Genome and virulence determinants of high virulence community-acquired MRSA. Lancet 359:1819-1827.[CrossRef][Medline]
2 - Blaser, M. J., and J. M. Musser. 2001. Bacterial polymorphisms and disease in humans. J. Clin. Investig. 107:391-392.[CrossRef][Medline]
3 - Boyum, A. 1968. Isolation of mononuclear cells and granulocytes from human blood. Isolation of mononuclear cells by one centrifugation, and of granulocytes by combining centrifugation and sedimentation at 1 g. Scand. J. Clin. Lab. Investig. Suppl. 97:77-89.[Medline]
4 - Centers for Disease Control and Prevention. 1999. Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureusMinnesota and North Dakota, 1997-1999. JAMA 282:1123-1125.[Free Full Text]
5 - Centers for Disease Control and Prevention. 1999. National Nosocomial Infections Surveillance (NNIS) System report, data summary from January 1990-May 1999, issued June 1999. Am. J. Infect. Control 27:520-532.[CrossRef][Medline]
6 - Centers for Disease Control and Prevention. 2003. Outbreaks of community-associated methicillin-resistant Staphylococcus aureus skin infectionsLos Angeles County, California, 2002-2003. Morb. Mortal. Wkly. Rep. 52:88.[Medline]
7 - Daum, R. S., T. Ito, K. Hiramatsu, F. Hussain, K. Mongkolrattanothai, M. Jamklang, and S. Boyle-Vavra. 2002. A novel methicillin-resistance cassette in community-acquired methicillin-resistant Staphylococcus aureus isolates of diverse genetic backgrounds. J. Infect. Dis. 186:1344-1347.[CrossRef][Medline]
8 - Fey, P. D., B. Said-Salim, M. E. Rupp, S. H. Hinrichs, D. J. Boxrud, C. C. Davis, B. N. Kreiswirth, and P. M. Schlievert. 2003. Comparative molecular analysis of community- or hospital-acquired methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 47:196-203.[Abstract/Free Full Text]
9 - Fierer, J., and D. G. Guiney. 2001. Diverse virulence traits underlying different clinical outcomes of Salmonella infection. J. Clin. Investig. 107:775-780.[Medline]
10 - Gillet, Y., B. Issartel, P. Vanhems, J. C. Fournet, G. Lina, M. Bes, F. Vandenesch, Y. Piemont, N. Brousse, D. Floret, and J. Etienne. 2002. Association between Staphylococcus aureus strains carrying gene for Panton-Valentine leukocidin and highly lethal necrotising pneumonia in young immunocompetent patients. Lancet 359:753-759.[CrossRef][Medline]
11 - Groom, A. V., D. H. Wolsey, T. S. Naimi, K. Smith, S. Johnson, D. Boxrud, K. A. Moore, and J. E. Cheek. 2001. Community-acquired methicillin-resistant Staphylococcus aureus in a rural American Indian community. JAMA 286:1201-1205.[Abstract/Free Full Text]
12 - Gross-Schulman, S., D. Dassey, L. Mascola, and C. Anaya. 1998. Community-acquired methicillin-resistant Staphylococcus aureus. JAMA 280:421-422.
13 - Herold, B. C., L. C. Immergluck, M. C. Maranan, D. S. Lauderdale, R. E. Gaskin, S. Boyle-Vavra, C. D. Leitch, and R. S. Daum. 1998. Community-acquired methicillin-resistant Staphylococcus aureus in children with no identified predisposing risk. JAMA 279:593-598.[Abstract/Free Full Text]
14 - Hiramatsu, K., L. Cui, M. Kuroda, and T. Ito. 2001. The emergence and evolution of methicillin-resistant Staphylococcus aureus. Trends Microbiol. 9:486-493.[CrossRef][Medline]
15 - Hiramatsu, K., Y. Katayama, H. Yuzawa, and T. Ito. 2002. Molecular genetics of methicillin-resistant Staphylococcus aureus. Int. J. Med. Microbiol. 292:67-74.[CrossRef][Medline]
16 - Ito, T., Y. Katayama, K. Asada, N. Mori, K. Tsutsumimoto, C. Tiensasitorn, and K. Hiramatsu. 2001. Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 45:1323-1336.[Abstract/Free Full Text]
17 - Jarraud, S., C. Mougel, J. Thioulouse, G. Lina, H. Meugnier, F. Forey, X. Nesme, J. Etienne, and F. Vandenesch. 2002. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect. Immun. 70:631-641.[Abstract/Free Full Text]
18 - Jones, T. F., M. E. Kellum, S. S. Porter, M. Bell, and W. Schaffner. 2002. An outbreak of community-acquired foodborne illness caused by methicillin-resistant Staphylococcus aureus. Emerg. Infect. Dis. 8:82-84.[Medline]
19 - Koreen, L., S. V. Ramaswamy, E. A. Graviss, S. Naidich, J. M. Musser, and B. N. Kreiswirth. 2004. spa typing method for discriminating among Staphylococcus aureus isolates: implications for use of a single marker to detect genetic micro- and macrovariation. J. Clin. Microbiol. 42:792-799.[Abstract/Free Full Text]
20 - L'Heriteau, F., J. C. Lucet, A. Scanvic, and E. Bouvet. 1999. Community-acquired methicillin-resistant Staphylococcus aureus and familial transmission. JAMA 282:1038-1039.[Free Full Text]
21 - Lina, G., Y. Piemont, F. Godail-Gamot, M. Bes, M. O. Peter, V. Gauduchon, F. Vandenesch, and J. Etienne. 1999. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin. Infect. Dis. 29:1128-1132.[CrossRef][Medline]
22 - Livermore, D. M. 2000. Antibiotic resistance in staphylococci. Int. J. Antimicrob. Agents 16(Suppl. 1):S3-S10.
23 - Lowy, F. D. 1998. Staphylococcus aureus infections. N. Engl. J. Med. 339:520-532.[Free Full Text]
24 - Naimi, T. S., K. H. LeDell, K. Como-Sabetti, S. M. Borchardt, D. J. Boxrud, J. Etienne, S. K. Johnson, F. Vandenesch, S. Fridkin, C. O'Boyle, R. N. Danila, and R. Lynfield. 2003. Comparison of community- and health care-associated methicillin-resistant Staphylococcus aureus infection. JAMA 290:2976-2984.[Abstract/Free Full Text]
25 - Okuma, K., K. Iwakawa, J. D. Turnidge, W. B. Grubb, J. M. Bell, F. G. O'Brien, G. W. Coombs, J. W. Pearman, F. C. Tenover, M. Kapi, C. Tiensasitorn, T. Ito, and K. Hiramatsu. 2002. Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. J. Clin. Microbiol. 40:4289-4294.[Abstract/Free Full Text]
26 - Oliveira, D. C., A. Tomasz, and H. de Lencastre. 2002. Secrets of success of a human pathogen: molecular evolution of pandemic clones of meticillin-resistant Staphylococcus aureus. Lancet Infect. Dis. 2:180-189.[CrossRef][Medline]
27 - Robinson, D. A., and M. C. Enright. 2003. Evolutionary models of the emergence of methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 47:3926-3934.[Abstract/Free Full Text]
28 - Said-Salim, B., P. M. Dunman, F. M. McAleese, D. Macapagal, E. Murphy, P. J. McNamara, S. Arvidson, T. J. Foster, S. J. Projan, and B. N. Kreiswirth. 2003. Global regulation of Staphylococcus aureus genes by Rot. J. Bacteriol. 185:610-619.[Abstract/Free Full Text]
29 - Said-Salim, B., B. Mathema, and B. N. Kreiswirth. 2003. Community-acquired methicillin-resistant Staphylococcus aureus: an emerging pathogen. Infect. Control Hosp. Epidemiol. 24:451-455.[CrossRef][Medline]
30 - Salmenlinna, S., O. Lyytikainen, and J. Vuopio-Varkila. 2002. Community-acquired methicillin-resistant Staphylococcus aureus, Finland. Emerg. Infect. Dis. 8:602-607.[Medline]
31 - Shopsin, B., B. Mathema, P. Alcabes, B. Said-Salim, G. Lina, A. Matsuka, J. Martinez, and B. N. Kreiswirth. 2003. Prevalence of agr specificity groups among Staphylococcus aureus strains colonizing children and their guardians. J. Clin. Microbiol. 41:456-459.[Abstract/Free Full Text]
32 - Staali, L., H. Monteil, and D. A. Colin. 1998. The staphylococcal pore-forming leukotoxins open Ca2+ channels in the membrane of human polymorphonuclear neutrophils. J. Membr. Biol. 162:209-216.[CrossRef][Medline]
33 - Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H. Persing, and B. Swaminathan. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33:2233-2239.[Medline]
34 - Vandenesch, F., T. Naimi, M. C. Enright, G. Lina, G. R. Nimmo, H. Heffernan, N. Liassine, M. Bes, T. Greenland, M. E. Reverdy, and J. Etienne. 2003. Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence. Emerg. Infect. Dis. 9:978-984.[Medline]
Journal of Clinical Microbiology, July 2005, p. 3373-3379, Vol. 43, No. 7
0095-1137/05/$08.00+0 doi:10.1128/JCM.43.7.3373-3379.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Wirtz, C., Witte, W., Wolz, C., Goerke, C.
(2009). Transcription of the phage-encoded Panton-Valentine leukocidin of Staphylococcus aureus is dependent on the phage life-cycle and on the host background. Microbiology
155: 3491-3499
[Abstract]
[Full Text]
-
Brady, J. M., Stemper, M. E., Weigel, A., Chyou, P.-H., Reed, K. D., Shukla, S. K.
(2007). Sporadic "Transitional" Community-Associated Methicillin-Resistant Staphylococcus aureus Strains from Health Care Facilities in the United States. J. Clin. Microbiol.
45: 2654-2661
[Abstract]
[Full Text]
-
Rossney, A. S., Shore, A. C., Morgan, P. M., Fitzgibbon, M. M., O'Connell, B., Coleman, D. C.
(2007). The Emergence and Importation of Diverse Genotypes of Methicillin-Resistant Staphylococcus aureus (MRSA) Harboring the Panton-Valentine Leukocidin Gene (pvl) Reveal that pvl Is a Poor Marker for Community-Acquired MRSA Strains in Ireland. J. Clin. Microbiol.
45: 2554-2563
[Abstract]
[Full Text]
-
Christianson, S., Golding, G. R., Campbell, J., the Canadian Nosocomial Infection Surveillance Pro, , Mulvey, M. R.
(2007). Comparative Genomics of Canadian Epidemic Lineages of Methicillin-Resistant Staphylococcus aureus. J. Clin. Microbiol.
45: 1904-1911
[Abstract]
[Full Text]
-
Dumitrescu, O., Boisset, S., Badiou, C., Bes, M., Benito, Y., Reverdy, M.-E., Vandenesch, F., Etienne, J., Lina, G.
(2007). Effect of Antibiotics on Staphylococcus aureus Producing Panton-Valentine Leukocidin. Antimicrob. Agents Chemother.
51: 1515-1519
[Abstract]
[Full Text]
-
Labandeira-Rey, M., Couzon, F., Boisset, S., Brown, E. L., Bes, M., Benito, Y., Barbu, E. M., Vazquez, V., Hook, M., Etienne, J., Vandenesch, F., Bowden, M. G.
(2007). Staphylococcus aureus Panton-Valentine Leukocidin Causes Necrotizing Pneumonia. Science
315: 1130-1133
[Abstract]
[Full Text]
-
French, G. L.
(2006). Bactericidal agents in the treatment of MRSA infections--the potential role of daptomycin. J Antimicrob Chemother
58: 1107-1117
[Abstract]
[Full Text]
-
Aiello, A. E., King, N. B., Foxman, B.
(2006). Ethical Conflicts in Public Health Research and Practice: Antimicrobial Resistance and the Ethics of Drug Development. AJPH
96: 1910-1914
[Abstract]
[Full Text]
-
Huygens, F., Inman-Bamber, J., Nimmo, G. R., Munckhof, W., Schooneveldt, J., Harrison, B., McMahon, J. A., Giffard, P. M.
(2006). Staphylococcus aureus Genotyping Using Novel Real-Time PCR Formats.. J. Clin. Microbiol.
44: 3712-3719
[Abstract]
[Full Text]
-
Ramdani-Bouguessa, N., Bes, M., Meugnier, H., Forey, F., Reverdy, M.-E., Lina, G., Vandenesch, F., Tazir, M., Etienne, J.
(2006). Detection of Methicillin-Resistant Staphylococcus aureus Strains Resistant to Multiple Antibiotics and Carrying the Panton-Valentine Leukocidin Genes in an Algiers Hospital. Antimicrob. Agents Chemother.
50: 1083-1085
[Abstract]
[Full Text]
-
McClure, J.-A., Conly, J. M., Lau, V., Elsayed, S., Louie, T., Hutchins, W., Zhang, K.
(2006). Novel multiplex PCR assay for detection of the staphylococcal virulence marker panton-valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from -resistant staphylococci.. J. Clin. Microbiol.
44: 1141-1144
[Abstract]
[Full Text]
-
Voyich, J. M., Braughton, K. R., Sturdevant, D. E., Whitney, A. R., Said-Salim, B., Porcella, S. F., Long, R. D., Dorward, D. W., Gardner, D. J., Kreiswirth, B. N., Musser, J. M., DeLeo, F. R.
(2005). Insights into Mechanisms Used by Staphylococcus aureus to Avoid Destruction by Human Neutrophils. J. Immunol.
175: 3907-3919
[Abstract]
[Full Text]
-
Sinsimer, D., Leekha, S., Park, S., Marras, S. A. E., Koreen, L., Willey, B., Naidich, S., Musser, K. A., Kreiswirth, B. N.
(2005). Use of a Multiplex Molecular Beacon Platform for Rapid Detection of Methicillin and Vancomycin Resistance in Staphylococcus aureus. J. Clin. Microbiol.
43: 4585-4591
[Abstract]
[Full Text]