This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sloan, L. M.
Right arrow Articles by Cockerill, F. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sloan, L. M.
Right arrow Articles by Cockerill, F. R., III

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, July 2005, p. 3516-3518, Vol. 43, No. 7
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.7.3516-3518.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Detection of Tropheryma whipplei DNA in Clinical Specimens by LightCycler Real-Time PCR

Lynne M. Sloan, Jon E. Rosenblatt, and Franklin R. Cockerill III*

Division of Clinical Microbiology, Department of Laboratory Medicine and Pathology, Mayo Clinic and Mayo Foundation, Rochester, Minnesota

Received 18 October 2004/ Returned for modification 6 December 2004/ Accepted 24 February 2005


arrow
ABSTRACT
 
A real-time PCR method using the LightCycler (Roche Applied Science, Indianapolis, IN) was compared to a conventional PCR assay for the detection of Tropheryma whipplei in 321 clinical specimens. The LightCycler method had sensitivity and specificity comparable to the conventional method but required considerably less labor and time (3 h versus 3 to 5 days).


arrow
TEXT
 
The diagnosis of Whipple's disease, caused by the bacillus Tropheryma whipplei, is supported by the observation of periodic acid-Schiff-positive bacilli in infected tissue (3). Recent reports have demonstrated that T. whipplei can be cultured in a variety of human cell lines (1, 2, 5, 6). However, due to technical difficulties with culturing, PCR is the preferred method for confirming the presence of T. whipplei in human specimens. We report an easy-to-perform and rapid PCR method for detecting T. whipplei in a variety of human specimens.

Specimens. This study was approved by the Institutional Review Board of the Mayo Foundation. Clinical specimens from 321 patients (132 whole blood, 82 tissue, 62 cerebrospinal fluid [CSF], and 45 synovial fluid) were collected from February 1996 to October 2002. The great majority of specimens were received through our referral laboratory practice from health care institutions outside of the Mayo Clinic. Therefore, clinical histories and additional specimens for testing were generally only available for those patients evaluated at the Mayo Clinic.

Specimens were tested by the conventional PCR assay as part of the routine clinical work flow in our laboratory. Conventional PCR was performed on relatively fresh samples, depending on when the assay was set up. Because the conventional PCR assay is only set up once weekly due to low specimen numbers, fresh tissue samples were frozen at –70°C, paraffin blocks were stored at room temperature, and blood samples were refrigerated at 4°C until the assay was performed. The LightCycler assay was performed on specimens which were frozen, refrigerated, or at room temperature and stored for longer periods of time than the specimens tested by the conventional PCR method.

Isolation of DNA. For the LightCycler PCR assay, a 200-µl aliquot of each blood, CSF, and synovial fluid specimen was extracted using the automated MagNA Pure LC instrument and the MagNA Pure total nucleic acid isolation kit (Roche Applied Science). For the conventional PCR assay, 200 µl of blood or CSF was extracted using the manual IsoQuick (Orca Research, Inc., Bothell, WA) nucleic acid extraction kit and 1 ml of synovial fluid was extracted with the QIAamp DNA Blood Midi Kit (QIAGEN, Valencia, CA). Extractions were performed according to the manufacturer's instructions. Biopsy samples of tissue fixed in paraffin blocks were cut into sections and dewaxed with xylene and 95% ethanol washes. The tissue was digested overnight at 55°C and 500 rpm in 1x Tris-EDTA (0.01 M Tris-HCl [pH 8.0], 0.001 M EDTA; Sigma, St. Louis, MO)-10% sodium dodecyl sulfate-proteinase K (Sigma, St. Louis, MO) at a final concentration of 80 to 100 U/ml. A 200-µl aliquot of the tissue digest was extracted on the MagNA Pure instrument for the LightCycler assay, and 200 µl was extracted using the IsoQuick extraction kit for the conventional PCR assay.

Conventional PCR assay. A 284-bp target sequence from a region of the 16S rRNA gene sequence of T. whipplei was amplified (polyacrylamide gel electrophoresis-purified primers pW3FE [5' GGAATTCCAGAGATACGCCCCCCGCAA 3'] and pW2RB [5' CGGGATCCCATTCGCTCCACCTTGCGA 3']), electrophoresed in a 2% agarose gel, and Southern blotted using the ECL DNA hybridization probe for T. whipplei (101 bp, positions 243 to 344) (4).

LightCycler assay. The heat shock protein (hsp65) gene of T. whipplei was selected as the target sequence. A 213-bp target sequence of hsp65 was amplified using the forward primer TW704 (5' AAAGAGGTTGAGACTG 3') and the reverse primer TW899 (5' ATCGGTTACAAAATAAGC 3'). The sequence of the anchor probe (3' fluorescein labeled), TW795, was 5' AGAAGGTTGGCAAGGAAGGC 3', and the sequence of the donor probe (5' LC RED-640 labeled), TW817, was 5' TGTCACTGTCGAGGAGTCAAATACT 3'.

The reaction mixture consisted of 15 µl of the PCR master mix plus 5 µl of the DNA extracts from the clinical specimens per cuvette. The PCR master mix included 3 mM MgCl2, 1x LightCycler FastStart DNA master hybridization probes (Roche Applied Science, Indianapolis, IN), 0.35 µM each primer, and 0.2 µM each fluorescein- and LC RED-640-labeled probe. Cycling parameters consisted of 1 cycle of 95°C for 10 min, followed by amplification for 45 cycles of 95°C for 10 s, 55°C for 15 s, and 72°C for 15 s. A melting curve was generated by measuring the fluorescent signal generated with the following profile: 95°C for 0 s, 59°C for 20 s, 45°C for 20 s with a 0.2°C/s transition, and 85°C for 0 s with a 0.2°C/s transition. Version 3.5 of the LightCycler software was used for most experiments. Software version 3.5.17 was installed and used on all samples after September 2004. Verification of the software showed no significant difference between software versions 3.5 and 3.5.17. Sterile water was used as a negative control and a plasmid clone constructed from the 213-bp amplicon was used as a positive control with each run. A specimen with a melting curve at the same location as the positive control (65°C ± 2°C) was interpreted as positive.

The analytical sensitivity of the LightCycler assay was evaluated by (i) a 10-fold dilution series (104 to 100 targets/µl) of a T. whipplei-positive plasmid clone in triplicate and (ii) spiking of dilutions of the positive control plasmid into the various specimen matrices (blood, CSF, synovial fluid) and extraction with the MagNA Pure extraction system. The analytical specificity was determined by evaluation of DNA extracted from pure cultures of a variety of organisms genetically similar to T. whipplei (Table 1). Two hundred thirty-three nucleic acid extracts of samples (51 blood, 66 CSF, 60 synovial fluid, 56 tissue) negative for T. whipplei were spiked with 50 target sequences per reaction mixture and tested by the LightCycler assay to test for the presence of PCR inhibitors.

The results of the LightCycler assay were compared to the conventional PCR assay to determine sensitivity, specificity, and positive and negative predictive values. Discordant results between the two PCR assays were resolved by repeat testing of a recent extract of the original specimen. The approximate time required for specimen processing and assay performance was recorded for each PCR method.

Results. The LightCycler PCR method demonstrated an analytical sensitivity of less than 25 target sequences per 5-µl reaction mixture (5,000 target sequences/ml) for both the plasmid clone dilutions and the positive plasmid control spiked into the different specimen matrices. All non-T. whipplei bacteria (Table 1) tested were negative by the LightCycler assay. Complete inhibition of LightCycler assay amplification occurred in 1 of 60 (2%) synovial fluid samples and 1 of 56 (2%) tissue samples. The overall inhibition rate for the LightCycler assay for blood, CSF, synovial fluid, and tissue was 2 of 233 samples or less than 1%.


View this table:
[in this window]
[in a new window]
  		TABLE 1. Bacterial strains used to test the specificity of the primers and probes of the LightCycler assay

Of the 321 clinical specimens, 47 (15%) were identified as positive and 270 (84%) were negative by both the LightCycler and conventional PCR assays. Three specimens were positive only by LightCycler PCR, and one specimen was positive only by conventional PCR (Table 2). The medical history was available for only one of these discrepant specimens (conventional PCR positive, LightCycler assay negative), and the diagnosis was not felt to be Whipple's disease. The sensitivity, specificity, and positive and negative predictive values of the LightCycler assay compared to the conventional PCR assay were 98%, 99%, 94%, and 100%, respectively.


View this table:
[in this window]
[in a new window]
  		TABLE 2. Comparison of LightCycler PCR versus conventional PCR for detection of T. whipplei in clinical samples

Approximately 2.5 h was required for MagNA Pure extraction of nucleic acid and 1 h for analysis and reporting of results (total time requirement for LightCycler assay = 3.5 h). The actual hands-on time was approximately 20 to 25 min for 32 samples. For the conventional PCR, manual extraction (IsoQuick) required approximately 65 to 70 min of hands-on time for 32 samples. Amplification on a conventional thermocycler required up to 5 h. Adding these times to the times required for electrophoreses on an agarose gel and transfer by overnight Southern blotting resulted in a total time of 2 to 3 days.

Discussion. The results of our study indicate that automated extraction of DNA using the MagNA Pure instrument combined with the LightCycler PCR is a reliable, easy-to-perform method for detection of T. whipplei DNA in a variety of human specimens. The sensitivity, specificity, and positive and negative predictive values of the LightCycler PCR were comparable to the conventional PCR. Importantly, the hands-on labor time and time for completing the LightCycler assay versus the conventional PCR assay were appreciably less (20 min versus 70 min and 3.5 h versus 2 to 3 days, respectively).


arrow
ACKNOWLEDGMENTS
 
We thank JoAnn Brunette for assistance in preparing the manuscript.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Division of Clinical Microbiology, Department of Laboratory Medicine & Pathology, Mayo Clinic—Mayo Foundation, 200 First Street SW, Rochester, MN 55905. Phone: (507) 284-3697. Fax: (507) 284-4272. E-mail: cockerill.franklin{at}mayo.edu. Back


arrow
REFERENCES
 
    1
  1. Boulos, A., J. M. Rolain, and D. Raoult. 2004. Antibiotic susceptibility of Tropheryma whipplei in MRC5 cells. Antimicrob. Agents Chemother. 48:747-752.[Abstract/Free Full Text]
    2. 2
  2. Drancourt, M., A. Carlioz, and D. Raoult. 2001. rpoB sequence analysis of cultured Tropheryma whipplei. J. Clin. Microbiol. 39:2425-2430.[Abstract/Free Full Text]
    3. 3
  3. Dutly, F., and M. Altwegg. 2001. Whipple's disease and "Tropheryma whipplei." Clin. Microbiol. Rev. 14:561-583.[Abstract/Free Full Text]
    4. 4
  4. Maiwald, M., A. von Herbay, D. H. Persing, P. P. Mitchell, M. F. Abdelmalek, J. N. Thorvilson, D. N. Fredricks, and D. A. Relman. 2001. Tropheryma whipplei DNA is rare in the intestinal mucosa of patients without other evidence of Whipple disease. Ann. Intern. Med. 134:115-119.[Abstract/Free Full Text]
    5. 5
  5. Raoult, D., M. L. Birg, B. La Scola, P. E. Fournier, M. Enea, H. Lepidi, V. Roux, J. C. Piette, F. Vandenesch, D. Vital-Durand, and T. J. Marrie. 2000. Cultivation of the bacillus of Whipple's disease. N. Engl. J. Med. 342:620-625.[Abstract/Free Full Text]
    6. 6
  6. Schoedon, G., D. Goldenberger, R. Forrer, A. Gunz, F. Dutly, M. Hochli, M. Altwegg, and A. Schaffner. 1997. Deactivation of macrophages with interleukin-4 is the key to the isolation of Tropheryma whipplei. J. Infect. Dis. 176:672-677.[Medline]

Journal of Clinical Microbiology, July 2005, p. 3516-3518, Vol. 43, No. 7
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.7.3516-3518.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Schneemann, M., Schoedon, G., Sloan, L. M., Rosenblatt, J. E., Cockerill, F. R. III (2005). Whipple's DNA Is Not Whipple's Disease. J. Clin. Microbiol. 43: 5414-5414 [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sloan, L. M.
Right arrow Articles by Cockerill, F. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sloan, L. M.
Right arrow Articles by Cockerill, F. R., III

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»