Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ibrahim, A. I. Articles by Gärtner, B. C. Search for Related Content PubMed PubMed Citation Articles by Ibrahim, A. I. Articles by Gärtner, B. C.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, August 2005, p. 4172-4174, Vol. 43, No. 8
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.8.4172-4174.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Prevalence of Herpes Simplex Virus (Types 1 and 2), Varicella-Zoster Virus, Cytomegalovirus, and Human Herpesvirus 6 and 7 DNA in Cerebrospinal Fluid of Middle Eastern Patients with Encephalitis

Ali I. Ibrahim,¹ Michel T. Obeid,¹ Muhidien J. Jouma,¹ Klaus Roemer,² Nikolaus Mueller-Lantzsch,² and Barbara C. Gärtner^2*

Department of Clinical Chemistry and Microbiology, University of Damascus, Syria,¹ Department of Virology, University of Saarland Medical School, Homburg/Saar, Germany²

Received 31 March 2005/ Returned for modification 10 May 2005/ Accepted 14 May 2005

Top Abstract Text References

 
HSV-1 DNA was detected in 32 (30%) of 106 cerebrospinal fluid samples from patients with encephalitis. Cytomegalovirus, varicella-zoster virus, and human herpesvirus 6 (HHV-6) DNAs were each detected in three patients (3%); herpes simplex virus type 2 (HSV-2) and HHV-7 PCRs were negative. HSV detection was associated with seizure (P = 0.02), especially focal seizure (P = 0.0002), and pathological computed tomography (P = 0.02) with focal lesions (P = 0.0004).

Top Abstract Text References

 
Herpesviruses, especially herpes simplex virus (HSV), varicella-zoster virus (VZV), and human herpesvirus 6 (HHV-6), play a major role as a cause of meningitis or encephalitis (8, 9, 13). Viral encephalitis is associated with significant mortality and morbidity, and its outcome is directly correlated with the rapid onset of antiviral therapy (12, 15). Therefore, the appropriate management of encephalitis needs techniques suitable for a rapid diagnosis, such as PCR (1, 10).

The aims of this study were to evaluate the prevalences of HSV-1, HSV-2, VZV, cytomegalovirus (CMV), HHV-6, and HHV-7 in cerebrospinal fluid (CSF) samples from Middle Eastern patients with encephalitis or meningitis, as well as in controls, and to correlate virus detection with clinical symptoms.

CSF was obtained from 106 patients with encephalitis and 11 patients with meningitis, and the patients had a mean age of 4 years (1 month to 40 years). Sixty-one samples (52%) were taken 1 to 5 days after the onset of symptoms, 33 samples (28%) were taken 6 to 10 days after symptom onset, and 23 samples (22%) were taken after 11 days after symptom onset. Patients were considered to have meningitis when at least one of the following symptoms was present and other causes were ruled out: nuchal rigidity, Kernig's sign, Brudzinski's sign, and Lasegue's sign. Encephalitis was suspected when an altered level of consciousness or significant change in personality or cognitive dysfunction or focal neurological symptoms not explained by cranial nerve paralysis persisted for 24 h and other causes were excluded. In all patients, the disease was accompanied by at least two of the following symptoms: headache, nausea, temperature of 38°C, and pleocytosis (>5 white blood cells/µl CSF). As controls, 35 patients (mean age, 2 years [2 months to 12 years]) with noninfectious neurological disorders or with infectious but nonneurological diseases were enrolled.

DNA was extracted by use of the QIAamp tissue kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions. DNA was detected by a hot-start real-time PCR on the LightCycler instrument (Roche, Mannheim, Germany), as previously described in detail for HSV-1, HSV-2, and CMV (5). For VZV, HHV-6, and HHV-7 PCRs, a similar PCR was performed using the following primers and probes: for HHV-6, primers 5'GCTTTTCTAGCCGCCTCTTC3' and 5'CCACATCTATAATTTTAGACGATCCC3', fluorescein probe 5' CCATATCTACAAAACTTAGGTGCTGGGTGA3', and Red640 probe 5'GTTGTAAGTGGTTGCGATATCTTTAGCTTCC3'; for HHV-7, primers 5'TATCCCAGCTGTTTTCATATAGTAAC3' and 5'TTGCGGTAGCACTAGATTTTTTG3', fluorescein probe 5'CATTTGTACTTCAAAGTAGCCTTCATTAGGATAGCT3', and Red640 probe 5'GACACCAACATCTGTCTATCATTTCTGGATGAA3'; and for VZV, primers 5'TTGAGGAAGTTGAAGCCAGATCA3' and 5'TCCAGTTCCAACCAACCGTTA3', fluorescein probe 5'TGAAAACGATCCATTGCATAATTGGAAT3', and Red640 probe 5'TTCTCTGTATGCACCATCCCGTAGG3'. Annealing temperature was 64°C for VZV and HHV-6 and 61°C for HHV-7. Inhibition and extraction control was performed by a second extraction and PCR with the same sample spiked with positive control before extraction. Statistical analysis was done by Fisher's exact test and the Mann-Whitney U test.

HSV-1 DNA was detected in 32 patients out of 106 with encephalitis (30%); none of the patients with meningitis alone was HSV DNA positive. Other herpesviruses were present at a much lower rate. VZV DNA was detected in three patients (3%) with encephalitis and in one with meningitis (9%). DNAs of CMV and HHV-6 were each found exclusively in three patients with encephalitis (3%). HSV-2 and HHV-7 were not detectable. Double infections were found in two patients (HSV/CMV and HSV/HHV-6). Together, herpesviral DNA was found in 39 patients (37%) with encephalitis and at a much lower frequency in patients with meningitis (1 patient, 9%). By contrast, all 35 samples of the control group were negative. When the sampling time was taken into consideration, the rate of PCR-positive samples was highest within days 6 through 10 after the onset of symptoms (48%). Sampling at days 1 to 5 revealed a much lower rate (25%) (P = 0.02), as did sampling >10 days after the onset of symptoms (35%).

To identify historical, clinical, and laboratory abnormalities associated with herpes simplex-positive encephalitis, the data from the 32 patients with HSV DNA in CSF were compared with those of 74 HSV-negative patients with encephalitis (Table 1). The clinical presentations differed significantly only in the numbers of patients with seizures (P = 0.02) and in particular, seizures of the focal type (P = 0.0002). This is also reflected by the higher number of pathological computed tomography scans (P = 0.02), and again, the focal appearance of lesions (P = 0.0004). In addition, the outcome of the encephalitis was worse in patients with HSV-1 encephalitis. All other clinical, historical, and laboratory data were not significantly different.

View this table: [in this window] [in a new window]

TABLE 1. Historical, clinical and neurodiagnostic data of 32 HSV-1 PCR-positive patients compared to 74 HSV-1 PCR-negative patients, both groups with encephalitis

The present study covered mainly pediatric patients from Syria. Herpesviral DNA was strongly predominant (37% in patients with encephalitis). HSV encephalitis is known to occur at any age; however, it has a bimodal distribution, with one-third occurring at an age of less than 20 years (14). The prevalence of HSV-1 is high in Syria, reaching 80% even at a young age of 6 to 10 years (6), explaining the elevated numbers of HSV encephalitis in these pediatric patients. The failure to identify HSV-2 likewise reflects the epidemiology of rarely seen HSV-2 infections in Syria (6). Although HHV-6 und CMV are known to cause encephalitis in rare cases (7, 11), it cannot be excluded that contamination by leukocytes may account for the few PCR-positive subjects. Of note in this context, HHV-6 genome and antigens are frequently detected in patients with multiple sclerosis, suggesting that the virus may persist in brain tissue even without causing encephalitis (2). The low prevalence of VZV in CSF is most likely reflected by the very low number of patients with symptoms compatible with chickenpox or herpes zoster (two patients, 2%).

Importantly, several investigators have reported patients with HSV encephalitis that were negative by CSF PCR (1, 4, 10). Obviously, different factors, including the time of sampling of the CSF specimens, may be critical. We have observed that HSV DNA may be more readily detectable in the later phases after the onset of symptoms and not in the very acute phases, in accord with earlier reports (1, 3). It might be speculated that especially focal lesions in the very early course do not necessarily result in viral DNA in CSF.

In conclusion, we have identified HSV-1 as an important agent of viral encephalitis in mainly pediatric patients from Syria, whereas VZV, CMV, and HHV-6 were rarely seen, and the two herpesviruses HSV-2 and HHV-7 were never detected. Seizures of the focal type and focal lesions in the computed tomography scan were significantly more frequently associated with PCR-established HSV encephalitis than with DNA-negative encephalitis.

 
We thank the technicians Helga Appel, Iris Kaffenberger, and Christine Karrenbauer for their invaluable assistance.

 
* Corresponding author. Mailing address: University of Saarland Medical School, Department of Virology, Haus 47, D-66421 Homburg/Saar, Germany. Phone: 49 6841 1623950. Fax: 49 6841 1623980. E-mail: vibgae{at}uniklinik-saarland.de.

Top Abstract Text References

 

1
1. Aurelius, E., B. Johansson, B. Skoldenberg, A. Staland, and M. Forsgren. 1991. Rapid diagnosis of herpes simplex encephalitis by nested polymerase chain reaction assay of cerebrospinal fluid. Lancet 337:189-192.[CrossRef][Medline]
2
2. Cermelli, C., R. Berti, S. S. Soldan, M. Mayne, M. D'Ambrosia, J., S. K. Ludwin, and S. Jacobson. 2003. High frequency of human herpesvirus 6 DNA in multiple sclerosis plaques isolated by laser microdissection. J. Infect. Dis. 187:1377-1387.[CrossRef][Medline]
3
3. Davies, N. W., L. J. Brown, J. Gonde, D. Irish, R. O. Robinson, A. V. Swan, J. Banatvala, R. S. Howard, M. K. Sharief, and P. Muir. 2005. Factors influencing PCR detection of viruses in cerebrospinal fluid of patients with suspected CNS infections. J. Neurol. Neurosurg. Psychiatry 76:82-87.[Abstract/Free Full Text]
4
4. Domingues, R. B., F. D. Lakeman, M. S. Mayo, and R. J. Whitley. 1998. Application of competitive PCR to cerebrospinal fluid samples from patients with herpes simplex encephalitis. J. Clin. Microbiol. 36:2229-2234.[Abstract/Free Full Text]
5
5. Ibrahim, A., M. T. Obeid, M. J. Jouma, G. A. Moasis, W. L. Al-Richiane, I. Kindermann, M. Boehm, K. Roemer, N. Mueller-Lantzsch, and B. C. Gärtner. 2005. Detection of herpes simplex virus, cytomegalovirus and Epstein-Barr virus DNA by PCR in atherosclerotic plaques and in unaffected bypass grafts. J. Clin. Virol. 32:29-32.[CrossRef][Medline]
6
6. Ibrahim, A. I., K. M. Kouwatli, and M. T. Obeid. 2000. Frequency of herpes simplex virus in Syria based on type-specific serological assay. Saudi Med. J. 21:355-360.[Medline]
7
7. Klemola, E., L. Kaariainen, R. von Essen, K. Haltia, A. Koivuniemi, and C. H. von Bonsdorff. 1967. Further studies on cytomegalovirus mononucleosis in previously healthy individuals. Acta Med. Scand. 182:311-322.[Medline]
8
8. Kolski, H., E. L. Ford-Jones, S. Richardson, M. Petric, S. Nelson, F. Jamieson, S. Blaser, R. Gold, H. Otsubo, H. Heurter, and D. MacGregor. 1998. Etiology of acute childhood encephalitis at The Hospital for Sick Children, Toronto, 1994-1995. Clin. Infect. Dis. 26:398-409.[Medline]
9
9. Koskiniemi, M., J. Rautonen, E. Lehtokoski-Lehtiniemi, and A. Vaheri. 1991. Epidemiology of encephalitis in children: a 20-year survey. Ann. Neurol. 29:492-497.[CrossRef][Medline]
10
10. Lakeman, F. D., R. J. Whitley, et al. 1995. Diagnosis of herpes simplex encephalitis: application of polymerase chain reaction to cerebrospinal fluid from brain-biopsied patients and correlation with disease. J. Infect. Dis. 171:857-863.[Medline]
11
11. McCullers, J. A., F. D. Lakeman, and R. J. Whitley. 1995. Human herpesvirus 6 is associated with focal encephalitis. Clin. Infect. Dis. 21:571-576.[Medline]
12
12. Raschilas, F., M. Wolff, F. Delatour, C. Chaffaut, T. De Broucker, S. Chevret, P. Lebon, P. Canton, and F. Rozenberg. 2002. Outcome of and prognostic factors for herpes simplex encephalitis in adult patients: results of a multicenter study. Clin. Infect. Dis. 35:254-260.[CrossRef][Medline]
13
13. Studahl, M., T. Bergström, and L. Hagberg. 1998. Acute viral encephalitis in adults—a prospective study. Scand. J. Infect. Dis. 30:215-220.[CrossRef][Medline]
14
14. Whitley, R. J., and J. W. Gnann. 2002. Viral encephalitis: familiar infections and emerging pathogens. Lancet 359:507-513.[CrossRef][Medline]
15
15. Whitley, R. J., and F. Lakeman. 1995. Herpes simplex virus infections of the central nervous system: therapeutic and diagnostic considerations. Clin. Infect. Dis. 20:414-420.[Medline]

---

Journal of Clinical Microbiology, August 2005, p. 4172-4174, Vol. 43, No. 8
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.8.4172-4174.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Ward, K. N., Leong, H. N., Thiruchelvam, A. D., Atkinson, C. E., Clark, D. A. (2007). Human Herpesvirus 6 DNA Levels in Cerebrospinal Fluid Due to Primary Infection Differ from Those Due to Chromosomal Viral Integration and Have Implications for Diagnosis of Encephalitis. J. Clin. Microbiol. 45: 1298-1304 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ibrahim, A. I. Articles by Gärtner, B. C. Search for Related Content PubMed PubMed Citation Articles by Ibrahim, A. I. Articles by Gärtner, B. C.