Erratum for van Elden et al., J. Clin. Microbiol. 41 (9) 4378-4381.
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Elden, L. J. R.
Right arrow Articles by Nijhuis, M.
Right arrow Search for Related Content
PubMed
Right arrow Articles by van Elden, L. J. R.
Right arrow Articles by Nijhuis, M.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, August 2005, p. 4308, Vol. 43, No. 8
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.8.4308.2005

ERRATUM

Applicability of a Real-Time Quantitative PCR Assay for Diagnosis of Respiratory Syncytial Virus Infection in Immunocompromised Adults

L. J. R. van Elden, A. M. van Loon, A. van der Beek, K. A. W. Hendriksen, A. I. M. Hoepelman, M. G. J. van Kraaij, P. Schipper, and M. Nijhuis

Department of Virology and Division of Acute Medicine and Infectious Diseases, Department of Internal Medicine, University Medical Center Utrecht, Utrecht, and Department of Hematology, University Medical Center Nijmegan, Nijmegan, The Netherlands

Volume 41, no. 9, p. 4378-4381, 2003. Page 4379, Table 1: The sequence of the RSA-2 primer should read "5' TTCTGCACATCATAATTAGGAGTATCAAT," and its nucleotide position should read "1220"; the sequence of the RSB-2 primer should read "5' TGATATCCAGCATCTTTAAGTATCTTTATAGTG," and its nucleotide position should read "1350"; and the sequence of the RSB probe should read "5' TTCCCTTCCTAACCTGGACATAGCATATAACATACCT," and its nucleotide position should read "1315."

Journal of Clinical Microbiology, August 2005, p. 4308, Vol. 43, No. 8
0095-1137/05/$08.00+0     doi:10.1128/JCM.43.8.4308.2005





This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by van Elden, L. J. R.
Right arrow Articles by Nijhuis, M.
Right arrow Search for Related Content
PubMed
Right arrow Articles by van Elden, L. J. R.
Right arrow Articles by Nijhuis, M.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»