Previous Article | Next Article 
Journal of Clinical Microbiology, January 2006, p. 108-118, Vol. 44, No. 1
0095-1137/06/$08.00+0 doi:10.1128/JCM.44.1.108-118.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Characterization of a Strain of Community-Associated Methicillin-Resistant Staphylococcus aureus Widely Disseminated in the United States
Fred C. Tenover,1*
Linda K. McDougal,1
Richard V. Goering,2
George Killgore,1
Steven J. Projan,3
Jean B. Patel,1 and
Paul M. Dunman4
Division
of Healthcare Quality Promotion, Centers for Disease Control and
Prevention, Atlanta, Georgia 30333,1
Department of Medical Microbiology,
Creighton University, Omaha, Nebraska 68178,2
GenomicsCambridge,
Wyeth Research, Cambridge, Massachusetts
02140,3
Department of Pathology and
Microbiology, University of Nebraska Medical Center, Omaha,
Nebraska
681984
Received 14 September 2005/
Returned for modification 20 October 2005/
Accepted 1 November 2005

ABSTRACT
A
highly stable strain of
Staphylococcus aureus with a
pulsed-field
gel electrophoresis type of USA300 and multilocus sequence
type
8 has been isolated from patients residing in diverse geographic
regions
of the United States. This strain, designated USA300-0114, is
a
major cause of skin and soft tissue infections among persons
in
community settings, including day care centers and correctional
facilities,
and among sports teams, Native Americans, men who have sex
with
men, and military recruits. The organism is typically resistant
to
penicillin, oxacillin, and erythromycin (the latter mediated
by
msrA) and carries SCC
mec type IVa. This strain is
variably
resistant to tetracycline [mediated by
tet(K)];
several recent
isolates have decreased susceptibility to
fluoroquinolones.
S. aureus USA300-0114 harbors the genes
encoding the Panton-Valentine
leucocidin toxin. DNA sequence analysis
of the direct repeat
units within the
mec determinant of 30
USA300-0114 isolates
revealed differences in only a single isolate.
Plasmid analysis
identified a common 30-kb plasmid that hybridized with
blaZ and
msrA probes and a 3.1-kb cryptic plasmid. A
4.3-kb plasmid
encoding
tet(K) and a 2.6-kb plasmid encoding
ermC were observed
in a few isolates. DNA microarray analysis
was used to determine
the genetic loci for a series of virulence
factors and genes
associated with antimicrobial resistance. Comparative
genomics
between USA300-0114 and three other
S. aureus
lineages (USA100,
USA400, and USA500) defined a set of
USA300-0114-specific genes,
which may facilitate the strain's
pathogenesis within diverse
environments.

INTRODUCTION
Staphylococcus aureus continues to be a majorcause of health
care-associated infections
(
1,
18,
19,
45,
53). Recently, strains
of
methicillin (oxacillin)-resistant
S. aureus (MRSA) have been
recovered
from infections in community settings
(
8,
11,
27,
44,
49,
64)
and among the urban
poor in San Francisco, California
(
12).
Most community MRSA
strains harbored the
lukF-PV and
lukS-PV
determinants,
which encode the Panton-Valentine leucocidin (PVL) toxin
(
20,
26,
28,
35,
43).
Using pulsed-field
gel electrophoresis (PFGE), we recently described
two major types of
community-associated MRSA, designated USA300
and USA400
(
46), both of which
typically harbor PVL. USA400
isolates were associated with the deaths
of four children in
Minnesota and North Dakota in 1999
(
6), all of whom were
treated
with cephalosporins. An isolate of the same lineage as USA400
(also
known as
S. aureus MW-2) was responsible for a series of
infections
in health care settings across Canada
(
61), infections in
Native
Americans (
31) and
among children in day care
(
33), and an outbreak
of
S. aureus infection on a maternity ward of a hospital in
New
York (
62). USA300
isolates have been recovered from a variety
of community populations,
including children (
5,
39), correctional
facility
inmates (
7,
10), participants in
sports teams (
9,
40), men who
have sex
with men (
8,
34,
42), and military
recruits (
72). Over
the
last 3 years, outbreak investigations conducted by the Centers
for
Disease Control and Prevention (CDC) in diverse geographic
locations
and with diverse patient populations often yielded
the same USA300 PFGE
pattern, designated USA300-0114, from wound
cultures and other clinical
specimens (
40). These
isolates yielded
indistinguishable macrorestriction PFGE profiles with
five restriction
endonucleases, were consistently erythromycin
resistant, clindamycin
susceptible, and D-zone test (clindamycin
induction) negative,
harbored staphylococcal cassette chromosome
mec (SCC
mec) type
IVa, and carried the genes for PVL
(
40).
S. aureus
USA300 strains
have been isolated by Hidron et al. from patients
admitted to
an urban hospital in Atlanta, Georgia
(
34), and by Chavez-Bueno
et
al. from children in Dallas, Texas
(
13). This study further
characterized
the antimicrobial susceptibility patterns and genetic
traits
of this strain by using plasmid analysis, a series of PCR
assays,
and DNA microarrays.

MATERIALS AND METHODS
Bacterial strains.
One hundred eighty-seven isolates of
S. aureus from the CDC
strain collection (from outbreak
investigations, surveillance
studies, and the
Staphylococcus
reference laboratory), identified
on the basis of catalase, coagulase,
and sugar fermentation
patterns
(
4), demonstrated the SmaI
PFGE profile identified
as USA300
(
46). These isolates
underwent antimicrobial susceptibility
testing, SCC
mec typing,
and testing for several genes encoding
toxins and virulence factors.
Thirty isolates from diverse geographic
locations in the United States
and showing variable antimicrobial
susceptibility patterns were
selected for further studies, including
DNA sequence analysis of the
mec-associated direct repeat unit
(
dru) region
(
48),
agr
grouping, and plasmid analysis. Fourteen
of the 30 isolates, including
6 that were USA300-0114, underwent
DNA microarray analysis; all 6
USA300-0114 isolates also underwent
staphylococcal protein A
(
spa) typing, and 1 USA300-0114 isolate
was analyzed by
multilocus sequence typing
(MLST).
Antimicrobial susceptibility testing.
The antimicrobial
susceptibility profiles of the isolates were determined by the broth
microdilution method with cation-adjusted Mueller-Hinton broth (Becton
Dickinson Microbiology Systems, Cockeysville, Md.), as
described in the CLSI (formerly NCCLS) publication M7-A7
(52). The antimicrobial
agents tested were clindamycin, chloramphenicol, erythromycin,
gentamicin, levofloxacin, linezolid, oxacillin, penicillin,
quinupristin-dalfopristin, rifampin, tetracycline,
trimethoprim-sulfamethoxazole, and vancomycin. Quality control strains
included S. aureus ATCC 29213, Enterococcus faecalis
ATCC 25922, and S. aureus ATCC 43300. Inducible clindamycin
resistance was determined using a disk diffusion D-zone test as
described by the Clinical and Laboratory Standards Institute
(15).
Pulsed-field gel electrophoresis.
PFGE
was performed as described previously
(46), using a
contour-clamped homogeneous electric field apparatus DR-II, DR-III, or
CHEF Mapper (Bio-Rad, Hercules, CA). Running parameters were as
follows: volts, 200 (6 V/cm); temperature, 14°C; initial
switch, 5 s; final switch, 40 s; and time,
21 h.
Gel pattern analysis.
Gels were
photographed and digitized using a FOTO/Analyst Archiver system
(Fotodyne, Inc., Hartland, WI), and saved as TIFF images for use with
BioNumerics software (Applied Maths, Kortrijk, Belgium). The reference
standard S. aureus NCTC 8325, which was included in the 1st,
7th, 14th, 20th, and last lanes of each gel, was normalized to the
global standard S. aureus NCTC 8325. Percent similarities were
calculated using Dice coefficients, and the unweighted-pair group
method using arithmetic averages was used for cluster analyses. Band
position tolerance and optimization were set at 1.25% and 0.5%,
respectively.
SCCmec typing.
SCCmec
typing was performed essentially as described by Okuma et al.
(54).
PCR assays.
PCR detection of
ermA, ermB, ermC, and msrA was
performed as described by Sutcliffe et al.
(68). The PCR primers for
tet(K) were tetKFwd, 5' TAG GGG GAA TAA TAG CAC ATT
3', and tetKRev, 5' AAT CCG CCC ATA ACA AAT A
3'. Primers for blaZ were blaZfwd, 5' GGC CCT
TAG GAT AAA CAA AAG 3', and blaZrev, 5' CAG TTC ACA TGC
CAA AGA GTT 3'. Isolates were screened via PCR for
carriage of the genes encoding staphylococcal enterotoxin A (SEA), SEB,
SEC, SED, SEE, SEH, and toxic shock syndrome toxin 1 as previously
described (45a). The
presence of the genes encoding PVL (lukS-PV and
lukF-PV) was assessed using the PCR assay described by Lina et
al.
(43).
agr grouping.
Multiplex
PCR-based agr grouping was performed using the primer sets for
agr group I, agr group II, and agr group III
described by Moore and Lindsay
(47). The primers for
agr group IV were agrIV forward, 5' CAC TTA TCA TCA
AAG AGC C 3', and agrIV reverse, 5' GTA TTT CAT CTC TTT
AAG G 3'. Cycling conditions consisted of an initial
denaturation step at 94°C for 2 min, followed by 30 cycles of
95°C for 30 s, 55°C for 30 s, and
72°C for 1 min, followed by a primer extension
period of 5 min at 72°C. The primers were validated against a
set of 16 control strains prior to use in the
study.
Plasmid analysis.
Plasmid DNA was isolated using a
modified protocol for the QIAGEN plasmid mini kit (Valencia, CA). A
loopful of bacteria from a Trypticase blood agar plate incubated
overnight at 35°C was suspended in 500 µl of cold
QIAGEN cell suspension buffer. Fifty microliters of lysostaphin (0.5
mg/ml) was added, followed by a 30-min incubation at 37°C.
Plasmid profiles were determined by agarose (0.75%) gel electrophoresis
before and after restriction of DNA with HindIII. Digoxigenin-labeled
DNA probes were generated by PCR using DNA from the following control
organisms: S. aureus RN4220 (msrA), S.
aureus RN2442 (ermC), S. aureus CDC82-7701
[tet(K)], and S. aureus 01057 (blaZ). Four
identical agarose gels containing uncut plasmid DNA from 11 isolates of
S. aureus USA300-0114 with different phenotypes and genotypes
were prepared, and the DNA was transferred to Zeta-Probe membranes by
vacuum blotting (Boekel Scientific, Feasterville, Pa.) and probed
individually using the four probes listed above as previously described
(45a).
Multilocus sequence typing and spa typing.
MLST was performed as described by
Enright et al. (23,
24). spa typing
was performed as described by Shopsin et al.
(67).
Microarray analysis.
The genetic
compositions of S. aureus pulsed-field types (PFTs)
USA100-0022, USA300-0114, USA400-0051, and USA500-0004 isolates were
determined using S. aureus Affymetrix GeneChips (Saur2a)
(Affymetrix, Santa Clara, CA), as previously described
(21); multiple isolates
of the USA300 and USA400 PFTs were analyzed. Chromosomal DNA from each
isolate was interrogated for the presence or absence of the 7,792 loci
represented on the Saur2a chip
(21). Briefly,
chromosomal DNA was purified from each isolate, fragmented, and
biotinylated at the 3' end. Then, 1.5 µg of labeled DNA
was hybridized to a GeneChip, and adjusted "present"
and "absent" determinations were made for each locus
represented on the array
(21).
Direct repeat unit sequencing.
Sequence analysis of the
mec-associated dru region was performed as described
by Goering et al. (29,
30), using the
nucleotides 5'
GTTAGCATATTACCTCTCCTTGC
3' and 5'
GCCGATTGTGCTTGATGAG
3' as forward and reverse primers, respectively. PCR
was performed with an initial denaturation step at 94°C for 2
min, followed by 30 cycles of 94°C for 1 min, 52°C for
1 min, and 72°C for 1 min. DNA sequencing was performed using
an ABI PRISM 3100-Avant genetic analyzer (Applied Biosystems, Foster
City, CA).

RESULTS
PFGE analysis.
A dendrogram of
SmaI macrorestriction fragment patterns showing
the relationship of
USA300-0114 to other isolates in the USA300
PFT and other USA PFTs is
presented in Fig.
1. USA300-0114 is
one of several PFGE patterns within the USA300 PFT. As
previously
reported, the closest PFT to USA300 is USA500, which is also
sequence
type (ST) 8 as determined by MLST
(
46). USA300 PFGE
patterns
are distinct from other MRSA PFGE patterns (e.g., USA100,
USA200,
and
USA400).
USA300-0114 characteristics.
The antimicrobial resistance
patterns of 187 oxacillin-resistant
USA300 isolates were determined by
the broth microdilution method.
The isolates were generally susceptible
to chloramphenicol (100%),
clindamycin (98%), gentamicin
(100%), linezolid (100%), quinupristin-dalfopristin
(100%),
rifampin (99%),
trimethoprim-sulfamethoxazole (100%), and vancomycin
(100%) but were
less susceptible to levofloxacin (84%) and tetracycline
(83%). On the
other hand, 97% of isolates were resistant to
erythromycin. Of these,
only three showed inducible clindamycin
resistance by use of the D-zone
test; one additional isolate
was constitutively resistant to
clindamycin. Of the 30 isolates
selected for additional testing, all
were positive by PCR for
SCC
mec type IVa. All six USA300-0114
isolates that underwent
spa typing were
spa type
YHGFMBQBLO, and the one USA300-0114
isolate
analyzed by MLST was identified as ST8.
Table
1 describes the 30 isolates selected for the additional studies. The
geographic locations (states) of isolation (when known), antimicrobial
resistance patterns, plasmid profiles, and resistance genotypes are
listed. Multiplex PCR demonstrated that all 30 isolates were
agr group I. The dru regions within the mec
determinants of the 30 isolates were sequenced. All of the isolates
were dru type 9g, except for one isolate from Colorado, which
was type 9h (Table
2).
Plasmid characterization.
Eighteen (60%) of the 30 isolates
contained 30-kb plasmids that
were similar by restriction endonuclease
analysis. Each 30-kb
plasmid hybridized with both the
blaZ and
msrA probes (Table
1).
Twenty-eight of the 30
isolates contained a 3.1-kb cryptic plasmid.
The two isolates that
lacked the 30-kb plasmid were ß-lactamase
negative and
erythromycin susceptible. Seven tetracycline-resistant
isolates each
had a 4.3-kb plasmid that hybridized with the
tet(K) probe.
Three isolates with inducible clindamycin resistance
each had a 2.6-kb
plasmid that hybridized with the
ermC probe.
Isolate 19 was
positive by PCR for
ermC and showed constitutive
clindamycin
resistance but lacked a 2.6-kb plasmid (Table
1).
The location of the
ermC determinant is presumed to be chromosomal.
Isolate 29,
which was negative for
msrA by PCR, contained a
23-kb plasmid
that hybridized only with the
blaZ
probe.
Virulence factor characterization.
All 30
isolates were positive by PCR for lukS-PV and
lukF-PV, indicating the presence of the genes encoding PVL.
All 30 were negative by PCR for the genes encoding SEA, SEB, SEC, SED,
SEE, and SEH and toxic shock syndrome toxin 1.
By use of
Affymetrix GeneChips (Saur2a), all of the six USA300-0114 isolates were
highly related, with an average of only six genes differing between any
two isolates [e.g., the presence or absence of tet(K)].
USA300-0114 isolates contained 20 of the 46 putative antimicrobial
resistance genes and 117 of the 289 putative virulence factor or
regulatory genes represented on the Saur2a chip (Table
3).
In addition to the plasmid-mediated resistance
genes noted above,
all USA300-0114 isolates carry the genes for arsenic
(
arsB and
arsC)
(
37), bacitracin
(
bacA) (
22),
cadmium (
cadD)
(
17), and
fosfomycin
(
fosB) (
71)
resistance. The strain also contains
a number of putative drug
transporters, including members of
the EmrB/QacA family of transporters
(COL-SA2413), quinolone
(
norA)
(
70), an ABC transporter
(
vga), the Bcr/CflA subfamily
of transporters (COL-SA2437),
and the putative multidrug transport
protein
(COL-SA2348).
USA300-0114 isolates contain a number of virulence
determinants, which can be broadly characterized as either cell surface
components or extracellular elements (exoenzymes, exotoxins, and
enterotoxins) (Table 3).
Regarding cell surface components, USA300-0114 isolates contained all
members of the capsule type 5 operon (cap5A to cap5P)
and numerous adhesion genes, including clumping factor B
(clfB) and clumping factor A (clfA) (Table
3). The sdr loci
encode proteins with similarity to clfA and clfB that
are involved in binding fibrinogen and bone
(69). Both sdrC
and sdrE were present, although sdrD was not.
Likewise, the extracellular matrix-binding protein homologue,
ebh (which is represented by several oligonucleotides on the
microarray), and fnbA and fnbB
(14,
32) (which encode
fibronectin-binding protein) were present. All isolates tested also
harbored the genes encoding eight LPXTG-containing proteins,
protein A (spa), the elastin-binding protein
(ebpS) (56),
accumulation-associated protein (sasG)
(60), and the
intercellular adhesin (icaA to icaD)
(16).
The
USA300-0114 isolates also contained an array of extracellular virulence
factors, including numerous exoenzymes, such as serine protease
(splA to splF)
(58), zinc
metalloproteinase aureolysin (aur)
(3), coagulase
(coa) (57), and
lipase (geh)
(41) genes. The V8
protease (sspA)
(59), cysteine protease
(sspB and sspC)
(59), and hyaluronidase
(hysA) (25)
genes were detected, in addition to four enterotoxin genes. These genes
included ent (COL-SA0886), entB (COL-SA0172)
(38), sei
(COL-SA0887), and an enterotoxin family gene (COL-SA1657). USA300-0114
also harbored a number of exotoxin genes, including exotoxin 2
(COL-SA0472), exotoxin 3 (COL-SA0468), set7, set8,
set9, set10, set11, set12,
set13, and set14. In addition, isolates contained the
genes required for
-,
-, and at least a portion of
ß-hemolysin production. PVL (lukF-PV and
lukS-PV), lukD and lukE leucocidin, and
lukF and lukM genes were also present within
USA300-0114, confirming the PCR
data.
Comparison of USA300-0114 and USA500-0004 lineages.
Using
GeneChips, we compared the composition of USA300-0114 to that of three
other MRSA PFTs (USA100, USA400, and USA500). By microarray analysis,
USA300-0114 is most closely related to USA500-0004. These two PFTs fall
into the same ribogroup, and both are ST8 by MLST and agr
group I, although the spa type of USA300-0114 differs by a
single repeat (underlined) from that of USA500-0004
(YHGFMBQBLOversus
YHGCMBQBLO,
respectively) (46).
Despite the relatedness of the two PFTs, USA300-0114 is most frequently
associated with infections in the community and USA500-0004 is most
frequently associated with infections in health care institutions
(55,
65). Thus, a genome-wide
comparison of the genetic compositions of USA300-0114 and USA500-0004
may identify genes that are unique to USA300-0114 or are associated
with community- versus health care-associated infections.
As
shown in Table 3, 131 of
the 137 putative virulence or resistance determinants within
USA300-0114 are also present within USA500-0004. However, six genes
present within USA300-0114 were absent from USA500-0004. These genes
include the msrSA locus (which is the COL annotation for the
msrA erythromycin resistance gene), two hypothetical LPXTG
motif-containing cell surface components, the PVL genes
(lukF-PV and lukS-PV), and the COL set9
exotoxin. Recognizing that genes other than defined resistance or
virulence factors may contribute to the lineage's ability to cause
disease and disseminate in community settings, we expanded our analysis
to identify all putative open reading frames (ORFs) that are present
with USA300-0114 but absent from USA500-0004. Fifty-nine
USA300-0114 genes were absent from USA500-0004 (see the supplemental
material). These genes included 22 putative ORFs with either very
limited or no amino acid similarity to characterized proteins, a
plasmid (pSR1) replication protein, and a transposase (N315-SA0062).
Interestingly, the majority of the genes that differentiate these two
lineages are bacteriophage encoded. More specifically, two hypothetical
phi ETA proteins, three bacteriophage phi PVL genes, and 22
phi N315 genes were present in USA300-0114 but missing from
USA500-0004. It is possible that one (or more) of these phage-encoded
proteins confers a selective advantage to USA300-0114 isolates in
community settings.
Comparison of USA300-0114 and USA400 lineages.
We next compared the genetic
composition of USA300-0114 to that of representative isolates of
USA400, a less frequently observed community-associated MRSA PFT
(spa type UJJJJFE, agr group
III, ST1 by MLST). There were 27 virulence or antimicrobial resistance
genes present within USA300-0114 that were missing from USA400 (Table
3). These included several
cell surface components that are involved in fibronectin binding
(fnbA, fnbB, and ebh) and three exotoxins
(MW-2 exotoxin 21 and two exotoxin 3 genes [COL-SA0478 and
COL-SA0468]). USA300-0114 also harbored 155 other genes that were
absent from USA400 (see the supplemental material). Of these 155, 106
ORFs encoded hypothetical proteins. The remaining genes included five
SaPIn2 pathogenicity island proteins, a single SaPIbov pathogenicity
island protein, a bacteriophage phi PVL antirepressor, and six
bacteriophage phi N315 proteins. Interestingly, with the exception of
the SaPIn2 components, each of these genes is also missing from USA500
isolates. Thus, it is possible that these genes encode proteins that
facilitate USA300-0114's ability to circulate and cause disease in
community settings.
Comparison of USA300-0114 and USA100 lineages.
We also compared USA300-0114 to USA100
(spa type
TJMBMDMGMK,
agr group II, ST5 by MLST), the major health care-associated
lineage in the United States
(46). There were 228
genes that were present within USA300-0114 but absent from USA100,
including 21 resistance or virulence determinants (Table
3) and 207 genes that have
not been previously linked to pathogenesis (see the supplemental
material). In comparison to USA300-0114, USA100 lacks several cell
surface adhesion genes, including fnbA, fnbB, and
ebh, all of which encode proteins that bind fibronectin. The
USA100 isolate also appears to be missing several USA300-0114
extracellular virulence factor genes, such as PVL (lukF-PV and
lukS-PV), ent, sei, and exotoxin 3 genes
(COL-SA0468 and
COL-SA0478).
USA300-0114-specific genes.
By comparing the
microarray-derived genetic composition of each PFT (USA300-0114,
USA100, USA400, and USA500-0004), we identified a number of
USA300-0114-specific genes. More specifically, a total of 20 genes were
conserved across all USA300-0114 isolates but were absent from the
other MRSA PFTs tested. None of these genes were previously recognized
S. aureus virulence determinants. These included 10
hypothetical genes, the bacteriophage phi PVL antirepressor gene
(AB009866-cds33), five bacteriophage phi N315 genes (N315-SA1802 to
N315-SA1806), the plasmid pSR1 rep gene (AAF99572), a
plasmid-associated gene (mphBM), a recombinase
(AF053772-cds1), and a SaPIbov pathogenicity island gene
(AF217235-cds17) (see the supplemental
material).

DISCUSSION
During our initial
investigations of clusters of MRSA infections
in U.S. prisons, we were
surprised that MRSA isolates with indistinguishable
PFGE patterns were
recovered from prisoners in Mississippi,
Texas, and Georgia
(
7,
10,
46). We were further
surprised to
see additional MRSA isolates with the same PFGE pattern
isolated
from a variety of athletes and sports teams
(
9,
40), military
recruits
(
72), children from
Tennessee (
5) and Texas
(
13,
39,
66),
and a large county
hospital in Atlanta (
34).
Clearly, this MRSA
strain is widely disseminated within the United
States and appears
to be a major cause of community-associated
infections.
USA300-0114 is ST8 by MLST, which differs by one or
two loci from previously described representatives of the archaic
(ST250) and Iberian (ST247) clones
(24,
63,
65). The USA300-0114
isolates also share a common spa type motif
(MBQBLO) and most likely evolved from a common
ancestor with a genotype of the early archaic strains of the 1960s
(55). All four
SCCmec types have been identified among MRSA of ST8
(23,
24,
36), although USA300-0114
is exclusively type IVa. Most USA300-0114 isolates are resistant only
to ß-lactams and macrolides, although plasmid-mediated
resistance markers, such as tetracycline and clindamycin resistance,
mediated by tet(K) and ermC, respectively, are
starting to appear.
Microarray analysis confirms that, in
general, USA300 isolates are highly related to USA500 isolates.
However, USA500 isolates are typically multiply resistant and are more
likely to cause health care-associated infections than infections in
community settings. When we compared the profiles of genes present
within USA300 but missing from USA500, the community-associated lineage
USA400, and the major health care-associated lineage USA100, several
differences became apparent. First, USA300 harbors sequences from (i) a
number of bacteriophages, including phi PVL and phi N315, (ii) the
SaPIn2 pathogenicity island, (iii) the SaPIbov pathogenicity island,
and (iv) the genes encoding a number of fibronectin-binding proteins
that are missing either totally or in part from the isolates of the
other PFTs surveyed. These factors may bekey
contributors to USA300's ability to cause infection in diverse
patient populations. For instance, despite the high degree of
relatedness between USA300 and USA500, the latter strain lacks members
of the bacteriophage phi PVL and phi N315 gene sets. These factors are
also absent from the major hospital PFT, USA100, suggesting that they
may be essential for pathogenesis in the community setting. Indeed, phi
PVL (lukF-PV and lukS-PV) genes are thought to
distinguish community from health care isolates
(2,
20,
43,
50). Moreover, a
comparison of the two community-associated MRSA PFTs, USA300 and
USA400, indicates that all of the USA400 isolates examined are missing
the fibronectin-binding proteins, fnbA, fnbB, and
ebh, as well as SaPIn2 and several but not all phi N315 genes,
suggesting that these components may contribute to the virulence of the
USA300-0114 isolates. These results also indicate that
although both community-associated MRSA lineages harbor the PVL toxin
genes (which health care-associated lineages typically do not), other
factors distinguish these lineages from health care-associated
isolates. Based on these comparisons, 20 genes or hypothetical genes
unique to USA300-0114 isolates have been identified. Other PFTs contain
some but not all of these 20 genes. It is likely that USA300 isolates
contain additional virulence loci that are not represented on the
Saur2a chip and that are yet to be elucidated.
The
microarray-based procedure used here monitored the presence or absence
of both well-studied virulence determinants (Table
3) and genes and ORFs that
have not previously been shown to influence pathogenesis directly (see
the supplemental material). It is likely that there are
unrecognized virulence and other factors
(51) in addition to
latter collection of determinants. The genes that were identified in
our analysis, including many bacteriophage-encoded proteins, may
represent a series of new virulence factors which collectively
facilitate the organism's ability to both circulate and cause infection
within diverse environmental conditions and in diverse populations.
Although 20 USA300-0114-specific and hypothetical genes have been
identified in this study, it is difficult to know whether these genes
are actively transcribed, translated, and functional or are in fact
silent. These factors may be expressed only in specific environmental
settings, such as those that are encountered during the course of
infection. Further characterization of these genes and their protein
products is expected to facilitate our understanding of the pathogenic
potential of USA300-0114 and may lead to strategies that attenuate the
strain.
In conclusion, USA300-0114 is a highly stable strain of
S. aureus that is primarily responsible for
community-associated infections in the United States. This strain
continues to evolve its antimicrobial resistance profile through
plasmid acquisition. Its natural reservoir remains an open
question.

ACKNOWLEDGMENTS
We thank Jana Swenson,
Patti Raney, Jasmine Chaitram, and David
Lonsway for assistance with
antimicrobial susceptibility testing
and Sigrid McAllister for
identification of the isolates.
Use of trade names is for
identification purposes only and does not constitute endorsement by the
Public Health Service or the U.S. Department of Health and Human
Services.

FOOTNOTES
* Corresponding
author. Mailing address: Division of Healthcare Quality Promotion
(G08), Centers for Disease Control and Prevention, 1600 Clifton Rd.,
Atlanta, GA 30333. Phone: (404) 639-3375. Fax: (404) 639-1381. E-mail:
fnt1{at}cdc.gov.

Supplemental
material for this article may be found at
http://jcm.asm.org/. 

REFERENCES
1 - Aires
de Sousa, M., H. de Lencastre, I. Santos Sanches, K. Kikuchi, K.
Totsuka, and A. Tomasz. 2000. Similarity of antibiotic
resistance patterns and molecular typing properties of
methicillin-resistant Staphylococcus aureus isolates
widely spread in hospitals in New York City and in a hospital in Tokyo,
Japan. Microb. Drug Resist.
6:253-258.[Medline]
2 - Baba,
T., F. Takeuchi, M. Kuroda, H. Yuzawa, K. Aoki, A. Oguchi, Y. Nagai, N.
Iwama, K. Asnao, T. Naimi, H. Kuroda, L. Cui, K. Yamamoto, and K.
Hiramasu. 2002. Genome and virulence determinants of
high virulence community-acquired MRSA. Lancet
359:1819-1827.[CrossRef][Medline]
3 - Banbula,
A., J. Potempa, J. Travis, C. Fernandez-Catalan, K. Mann, R. Huber, W.
Bode, and F. Medrano. 1998. Amino-acid sequence and
three-dimensional structure of the Staphylococcus aureus
metalloproteinase at 1.72 A resolution. Structure
6:1185-1193.[Medline]
4 - Bannerman,
T. L. 2003. Staphylococcus,
Micrococcus, and other catalase-positive cocci that grow
aerobically, p. 384-404. In
P. R. Murray, E. J. Baron, J. H.
Jorgensen, M. A. Pfaller, and R. H. Yolken (ed.),Manual of clinical microbiology
, 8th ed. ASM Press,
Washington,
D.C.
5 - Buckingham,
S. C., L. K. McDougal, L. D. Cathey, K.
Comeaux, A. S. Craig, S. K. Fridkin, and
F. C. Tenover. 2004. Emergence of
community-associated methicillin-resistant Staphylococcus
aureus at a Memphis, Tennessee children's hospital.Pediatr. Infect. Dis. J.
23:619-624.[Medline]
6 - Centers
for Disease Control and Prevention. 1999. Four
pediatric deaths from community-acquired methicillin-resistant
Staphylococcus aureusMinnesota and North Dakota,
1997-1999. Morb. Mortal. Wkly. Rep.
48:707-710.
7 - Centers
for Disease Control and Prevention. 2001.
Methicillin-resistant Staphylococcus aureus skin or soft
tissue infections in a state
prisonMississippi, 2000. Morb.
Mortal. Wkly. Rep.
50:919-922.[Medline]
8 - Centers
for Disease Control and Prevention. 2003. Public
health dispatch: outbreaks of community-associated
methicillin-resistant Staphylococcus aureus skin
infectionsLos Angeles County, California, 2002-2003.Morb. Mortal. Wkly. Rep.
52:88-89.[Medline]
9 - Centers
for Disease Control and Prevention. 2003.
Methicillin-resistant Staphylococcus aureus infections among
competitive sports participantsColorado, Indiana,
Pennsylvania, and Los Angeles County, 2000-2003. Morbid.
Mortal. Wkly. Rep.
52:793-795.
10 - Centers
for Disease Control and Prevention. 2003.
Methicillin-resistant Staphylococcus aureus
infections in correctional facilitiesGeorgia,
California, and Texas, 2001-2003. Morbid.
Mortal. Wkly. Rep.
52:992-996.
11 - Chambers,
H. 2001. The changing epidemiology of
Staphylococcus aureus? Emerg. Infect. Dis.
7:178-182.[Medline]
12 - Charlebois,
E. D., D. R. Bangsberg, N. J. Moss,
M. R. Moore, A. R. Moss, H. F. Chambers,
and F. Perdreau-Remington. 2002. Population-based
community prevalence of methicillin-resistant Staphylococcus
aureus in the urban poor of San Francisco. Clin. Infect.
Dis.
34:425-433.[CrossRef][Medline]
13 - Chavez-Bueno,
S., B. Bozdogan, K. Katz, K. L. Bowlware, N. Cushion, D.
Cavuoti, N. Ahmad, G. H. McCracken, Jr., and P. C.
Appelbaum. 2005. Inducible clindamycin resistance and
molecular epidemiologic trends of pediatric community-acquired
methicillin-resistant Staphylococcus aureus in Dallas, Texas.Antimicrob. Agents Chemother.
49:2283-2288.[Abstract/Free Full Text]
14 - Clarke,
S. R., L. G. Harris, R. G. Richards, and
S. J. Foster. 2002. Analysis of Ebh, a
1.1-megadalton cell wall-associated fibronectin-binding protein of
Staphylococcus aureus. Infect. Immun.
70:6680-6687.[Abstract/Free Full Text]
15 - Clinical
and Laboratory Standards Institute. 2005. Performance
standards for antimicrobial susceptibility testing. Fifteenth
informational supplement M100-S15. Clinical and Laboratory Standards
Institute, Wayne,
Pa.
16 - Cramton,
S. E., C. Gerke, N. F. Schnell, W. W.
Nichols, and F. Gotz. 1999. The intercellular adhesion
(ica) locus is present in Staphylococcus aureus and
is required for biofilm formation. Infect. Immun.
67:5427-5433.[Abstract/Free Full Text]
17 - Crupper,
S. S., V. Worrell, G. C. Stewart, and J.
J. Iandolo. 1999. Cloning and expression of
cadD, a new cadmium resistance gene of
Staphylococcus aureus. J. Bacteriol.
181:4071-4075.[Abstract/Free Full Text]
18 - Deplano,
A., W. Witte, W. J. van Leeuwen, Y. Brun, and M. J.
Struelens. 2000. Clonal dissemination of epidemic
methicillin-resistant Staphylococcus aureus in Belgium and
neighboring countries. Clin. Microbiol. Infect.
6:239-245.[CrossRef][Medline]
19 - Deresinski,
S. 2005. Methicillin-resistant Staphylococcus
aureus: an evolutionary, epidemiologic, and therapeutic odyssey.Clin. Infect. Dis.
40:526-573.[CrossRef][Medline]
20 - Dufour,
P., Y. Gillet, M. Bes, G. Lina, F. Vandenesch, D. Floret, J. Etienne,
and H. Richet. 2002. Community-acquired
methicillin-resistant Staphylococcus aureus infections in
France: emergence of a single clone that produces Panton-Valentine
leukocidin. Clin. Infect. Dis.
35:819-824.[CrossRef][Medline]
21 - Dunman,
P. M., W. Mounts, F. McAleese, F. Immermann, D. Macapagal, E.
Marsilio, L. McDougal, F. C. Tenover, P. A.
Bradford, P. J. Petersen, S. J. Projan, and E.
Murphy. 2004. Uses of Staphylococcus aureus
GeneChips in genotyping and genetic composition analysis.J. Clin. Microbiol.
42:4275-4283.[Abstract/Free Full Text]
22 - El
Ghachi, M., A. Bouhss, D. Blanot, and D. Mengin-Lecreulx.2004
. The bacA gene of Escherichia coli
encodes an undecaprenyl pyrophosphate phosphatase activity.J. Biol. Chem.
279:30106-30113.[Abstract/Free Full Text]
23 - Enright,
M. C., N. P. Day, C. E. Davies,
S. J. Peacock, and B. G. Spratt.2000
. Multilocus sequence typing for characterization of
methicillin-resistant and methicillin-susceptible clones of
Staphylococcus aureus. J. Clin.
Microbiol.
38:1008-1015.[Abstract/Free Full Text]
24 - Enright,
M. C., D. Robinson, G. Randle, E. J. Feil, H.
Grundmann, and B. G. Spratt. 2002. The
evolutionary history of methicillin-resistant Staphylococcus
aureus (MRSA). Proc. Natl. Acad. Sci. USA
99:7689-7692.
25 - Farrell,
A. M., D. Taylor, and K. T. Holland.1995
. Cloning, nucleotide sequence determination and
expression of the Staphylococcus aureus hyaluronate lyase
gene. FEMS Microbiol. Lett.
130:81-85.[Medline]
26 - Fey,
P. D., B. Said-Salim, M. E. Rupp, S. H.
Hinrichs, D. J. Boxrud, C. C. Davis, B.
N. Kreiswirth, and P. M. Schlievert. 2003.
Comparative molecular analysis of community- or hospital-acquired
methicillin-resistant Staphylococcus aureus.Antimicrob. Agents Chemother.
47:196-203.[Abstract/Free Full Text]
27 - Fridkin,
S. K., J. C. Hageman, M. Morrison, L. T.
Sanza, K. Como-Sabetti, J. A. Jernigan, K. Harriman,
L. H. Harrison, R. Lynfield, M. M. Farley, et al.2005
. Methicillin-resistant Staphylococcus aureus
disease in three communities. N. Engl. J.
Med.
352:1436-1444.[Abstract/Free Full Text]
28 - Gillet,
Y., B. Issartel, P. Vanhems, J.-C. Fournet, G. Lina, M. Bes, F.
Vandenesch, Y. Piémont, N. Brousse, D. Floret, and J.
Etienne. 2002. Association between Staphylococcus
aureus strains carrying gene for Panton-Valentine leukocidin and
highly lethal necrotising pneumonia in young immunocompetent patients.Lancet
359:753-759.[CrossRef][Medline]
29 - Goering,
R. V., D. Morrison, K. F. C. Kooper, Z.
Al-Doori, G. F. S. Edwards, and C. G.
Gemmell. 2003. Improved tracking of epidemic
methicillin-resistant Staphylococcus aureus in Scotland using
a combination of pulsed field gel electrophoresis and mec-associated dru sequences, p. 1581. Abstr. 13th Eur. Congr.Clin. Microbiol. Infect. Dis.
30 - Goering,
R. V., D. Morrison, K. F. C. Cooper, Z.
Al-Doori, G. F. S. Edwards, and C. G.
Gemmell. 2004. Usefulness of mec-associated
dru sequences inmonitoring the spread of highly clonal epidemic methicillin-resistant Staphylococcus aureus isolates in Scotland, p. 582. 14th Eur. Congr. Clin. Microbiol. Infect. Dis.
31 - Groom,
A. V., D. H. Wolsey, T. S. Naimi, K.
Smith, S. Johnson, D. Boxrud, K. A. Moore, and J.
E. Cheek. 2001. Community-acquired
methicillin-resistant Staphylococcus aureus in a rural
American Indian community. JAMA
286:1201-1205.[Abstract/Free Full Text]
32 - Grundmeier,
M., M. Hussain, P. Becker, C. Heilmann, G. Peters, and B. Sinha.2004
. Truncation of fibronectin-binding proteins in
Staphylococcus aureus strain Newman leads to deficient
adherence and host cell invasion due to loss of the cell wall anchor
function. Infect. Immun.
72:7155-7163.[Abstract/Free Full Text]
33 - Herold,
B. C., L. C. Immergluck, M. C. Maranan,
D. S. Lauderdale, R. E. Gaskin, S. Boyle-Vavra,
C. D. Leitch, and R. S. Daum.1998
. Community-acquired methicillin-resistant
Staphylococcus aureus in children with no identified
predisposing risk. JAMA
279:593-598.[Abstract/Free Full Text]
34 - Hidron,
A. I., E. V. Kourbatova, J. S. Halvosa,
B. J. Terrell, L. K. McDougal, F. C.
Tenover, H. M. Blumberg, and M. D. King.2005
. Risk factors for colonization with
methicillin-resistant Staphylococcus aureus (MRSA) in patients
admitted to an urban hospital: emergence of community-associated MRSA
nasal carriage. Clin. Infect. Dis.
41:159-166.[CrossRef][Medline]
35 - Issartel,
B., A. Tristan, S. Lechevallier, F. Bruyere, G. Lina, B. Garin, F.
Lacassin, M. Bes, F. Vandenesch, and J. Etienne. 2005.
Frequent carriage of Panton-Valentine leucocidin genes by
Staphylococcus aureus isolates from surgically drained
abscesses. J. Clin. Microbiol.
43:3203-3207.[Abstract/Free Full Text]
36 - Ito,
T., Y. Katayama, K. Asada, N. Mori, K. Tsutsuminnnnoto, C.
Tiensasitorn, and K. Hiramatsu. 2001.
Structural comparison of three types of staphylococcal cassette
chromosome mec integrated in the chromosome in
methicillin-resistant Staphylococcus aureus.Antimicrob. Agents Chemother.
45:1323-1336.[Abstract/Free Full Text]
37 - Ji,
G., and S. Silver. 1992. Reduction of arsenate to
arsenite by the ArsC protein of the arsenic resistance operon
of Staphylococcus aureus plasmid pI258. Proc. Natl.
Acad. Sci. USA
89:9474-9478.[Abstract/Free Full Text]
38 - Jones,
C. L., and S. A. Khan. 1986.
Nucleotide sequence of the enterotoxin B gene from Staphylococcus
aureus. J. Bacteriol.
166:29-33.[Abstract/Free Full Text]
39 - Kaplan,
S. L., K. G. Hulten, B. E. Gonzalez,
W. A. Hammerman, L. Lamberte, J. Versalovic, and
E. O. Mason. 2005. Three-year surveillance
of community-acquired Staphylococcus aureus infections in
children. Clin. Infect. Dis.
40:1785-1791.[CrossRef][Medline]
40 - Kazakova,
S. V., J. C. Hageman, M. K. Matava, A.
Srinivasan, L. Phelan, B. Garfinkel, T. Boo, S. McAllister, J.
Anderson, B. Jensen, D. Dodson, D. Lonsway, L. McDougal, M. Arduino,
V. J. Fraser, G. Killgore, F. C. Tenover, S. Cody,
and D. B. Jernigan. 2005. A clone of
methicillin-resistant Staphylococcus aureus among professional
football players. N. Engl. J. Med.
352:468-475.[Abstract/Free Full Text]
41 - Lee,
C. Y., and J. J. Iandolo. 1986.
Lysogenic conversion of staphylococcal lipase is caused by insertion of
the bacteriophage L54a genome into the lipase structural gene.J. Bacteriol.
166:385-391.[Abstract/Free Full Text]
42 - Lee,
N. E., M. M. Taylor, E. Bancroft, P. J.
Ruane, M. Morgan, L. McCoy, and P. A. Simon.2005
. Risk factors for community-associated
methicillin-resistant Staphylococcus aureus skin infections
among HIV-positive men who have sex with men. Clin. Infect.
Dis.
40:1529-1534.[CrossRef][Medline]
43 - Lina,
G., Y. Piemont, F. Godail-Gamot, M. Bes, M.-O. Peter, V. Gauduchon, F.
Vandenesch, and J. Etienne. 1999. Involvement of
Panton-Valentine leukocidin-producing Staphylococcus aureus in
primary skin infections and pneumonia. Clin. Infect.
Dis.
29:1128-1132.[CrossRef][Medline]
44 - Lindenmayer,
J. M., S. Schoenfeld, R. O'Grady, and J. K.
Carney. 1998. Methicillin-resistant
Staphylococcus aureus in a high school wrestling team
and the surrounding community. Arch. Intern. Med.
158:895-899.[Abstract/Free Full Text]
45 - Lowy,
F. D. 1998. Staphylococcus aureus
infections. N. Engl. J. Med.
339:520-532.[Free Full Text]
45 - McDougal,
L. K., J. B. Patel, and F. C. Tenover. 2005. Diversity
of plasmid profiles among isolates of a highly stable pulsed-field gel
electrophoresis type of community-associated methicillin-resistant
Staphylococcus aureus, p. 44. Abstr. 105th Gen. Meet. Am. Soc. Microbiol. 2005. American Society for Microbiology, Washington, D.C.
46 - McDougal,
L. K., C. D. Steward, G. E. Killgore,
J. M. Chaitram, S. K. McAllister, and F.
C. Tenover. 2003. Pulsed-field gel electrophoresis
typing of oxacillin-resistant Staphylococcus aureus isolates
from the United States: establishing a national database.J. Clin. Microbiol.
41:5113-5120.[Abstract/Free Full Text]
47 - Moore,
P. C. L., and J. A. Lindsay.2001
. Genetic variation among hospital isolates of
methicillin-sensitive Staphylococcus aureus: evidence for
horizontal transfer of virulence genes. J. Clin.
Microbiol.
39:2760-2767.[Abstract/Free Full Text]
48 - Nahvi,
M. D., J. E. Fitzgibbon, J. F. John, and
D. T. Dubin. 2001. Sequence analysis of
dru regions from methicillin-resistant Staphylococcus
aureus and coagulase-negative staphylococcal isolates.Microb. Drug Resist.
7:1-12.[CrossRef][Medline]
49 - Naimi,
T. S., K. H. LeDell, D. J. Boxrud,
A. V. Groom, C. D. Steward, S. K.
Johnson, J. M. Besser, C. O'Boyle, R. N. Danila,
J. E. Cheek, M. T. Osterholm, K.
A. Moore, and K. E. Smith. 2001.
Epidemiology and clonality of community-acquired methicillin-resistant
Staphylococcus aureus in Minnesota, 1996-1998.Clin. Infect. Dis.
33:990-996.[CrossRef][Medline]
50 - Naimi,
T. S., K. H. LeDell, K. Como-Sabetti, S.
M. Borchardt, D. J. Boxrud, J. Etienne, S. K.
Johnson, F. Vandenesch, S. Fridkin, C. O'Boyle, R. N. Danila,
and R. Lynfield. 2003. Comparison of community- and
health care-associated methicillin-resistant Staphylococcus
aureus infection. JAMA
290:2976-2984.[Abstract/Free Full Text]
51 - Narui,
K., N. Noguchi, K. Wakasugi, and M. Sasatsu. 2002.
Cloning and characterization of a novel chromosomal drug efflux gene in
Staphylococcus aureus. Biol. Pharm. Bull.
25:1533-1536.[CrossRef][Medline]
52 - National
Committee for Clinical Laboratory Standards. 2003.
Methods for dilution antimicrobial susceptibility test for bacteria
that grow aerobically, 6th ed., vol. 23, no. 2. Approved standard
M7-A6. NCCLS, Wayne,
Pa.
53 - O'Brien,
F. G., J. W. Pearman, M. Gracey, T. V.
Riley, and W. B. Grubb. 1999. Community
strain of methicillin-resistant Staphylococcus aureus involved
in a hospital outbreak. J. Clin. Microbiol.
37:2858-2862.[Abstract/Free Full Text]
54 - Okuma,
K., K. Iwakawa, J. D. Turnidge, W. B. Grubb,
J. M. Bell, F. G. O'Brien, G. W. Coombs,
J. W. Pearman, F. C. Tenover, M. Kapi, C.
Tiensasitorn, T. Ito, and K. Hiramatsu. 2002.
Dissemination of new methicillin-resistant Staphylococcus
aureus clones in the community. J. Clin.
Microbiol.
40:4280-4294.
55 - Oliveira,
D. C., A. Tomasz, and H. de Lencastre. 2001.
The evolution of pandemic clones of methicillin-resistant
Staphylococcus aureus: identification of two ancestral genetic
backgrounds and associated mec elements. Microb. Drug
Resist.
7:349-361.[CrossRef][Medline]
56 - Park,
P. W., T. J. Broekelmann, B. R. Mecham,
and R. P. Mecham. 1999. Characterization of
the elastin binding domain in the cell-surface 25-kDa elastin-binding
protein of Staphylococcus aureus (EbpS). J.
Biol. Chem.
274:2845-2850.[Abstract/Free Full Text]
57 - Phonimdaeng,
P., M. O'Reilly, P. Nowlan, A. J. Bramley, and T.
J. Foster. 1990. The coagulase of Staphylococcus
aureus 8325-4. Sequence analysis and virulence of site-specific
coagulase-deficient mutants. Mol. Microbiol.
4:393-404.[Medline]
58 - Reed,
S. B., C. A. Wesson, L. E. Liou,
W. R. Trumble, P. M. Schlievert, G. A.
Bohach, and K. W. Bayles. 2001. Molecular
characterization of a novel Staphylococcus aureus serine
protease operon. Infect. Immun.
69:1521-1527.[Abstract/Free Full Text]
59 - Rice,
K., R. Peralta, D. Bast, J. de Azavedo, and M. J.
McGavin. 2001. Description of staphylococcus serine
protease (ssp) operon in Staphylococcus aureus and
nonpolar inactivation of sspA-encoded serine protease.Infect. Immun.
69:159-169.[Abstract/Free Full Text]
60 - Roche,
F. M., M. Meehan, and T. J. Foster.2003
. The Staphylococcus aureus surface protein
SasG and its homologues promote bacterial adherence to human
desquamated nasal epithelial cells. Microbiology
149:2759-2767.[Abstract/Free Full Text]
61 - Roman,
R. S., J. Smith, M. Walker, S. Byrne, K. Ramotar, B. Dycjk,
A. Kabani, and L. E. Nicolle. 1997. Rapid
geographic spread of a methicillin-resistant Staphylococcus
aureus strain. Clin. Infect. Dis.
25:698-705.[Medline]
62 - Saiman,
L., M. O'Keefe, P. L. Graham, F. Wu, B. Said-Salim, B.
Kreiswirth, A. LaSala, P. M. Schlievert, and P.
Della-Latta. 2003. Hospital transmission of
community-acquired methicillin-resistant Staphylococcus aureus
among postpartum women. Clin. Infect. Dis.
37:1313-1319.[CrossRef][Medline]
63 - Sa-Leao,
R., I. Santos Sanches, D. Dias, I. Peres, R. M. Barros, and
H. de Lencastre. 1999. Detection of an archaic clone
of Staphylococcus aureus with low-level resistance to
methicillin in a pediatric hospital in Portugal and in international
samples: relics of a formerly widely disseminated strain?J. Clin. Microbiol.
37:1913-1920.[Abstract/Free Full Text]
64 - Salgado,
C. D., B. M. Farr, and D. P. Calfee.2003
. Community-acquired methicillin-resistant
Staphylococcus aureus: a meta-analysis of prevalence and risk
factors. Clin. Infect. Dis.
36:131-139.[CrossRef][Medline]
65 - Santos
Sanches, I., M. Ramirez, H. Troni, M. Abecassis, M. Padua, A. Tomasz,
and H. de Lencastre. 1995. Evidence for the geographic
spread of a methicillin-resistant Staphylococcus aureus clone
between Portugal and Spain. J. Clin.
Microbiol.
33:1243-1246.[Abstract]
66 - Sattler,
C., E. O. Mason, and S. L. Kaplan.2002
. Prospective comparison of risk factors and
demographic and clinical characteristics of community-acquired,
methicillin-resistant versus methicillin-susceptible Staphylococcus
aureus infection in children. Pediatr. Infect.
Dis. J.
21:910-916.[CrossRef][Medline]
67 - Shopsin,
B., M. Gomez, S. O. Montgomery, D. H. Smith, M.
Waddington, D. E. Dodge, D. A. Bost, M. Riehman, S.
Naidich, and B. N. Kreiswirth.1999
. Evaluation of protein A gene polymorphic region DNA
sequencing for typing of Staphylococcus aureus strains.J. Clin. Microbiol.
37:3556-3563.[Abstract/Free Full Text]
68 - Sutcliffe,
J., T. Grebe, A. Tait-Kamradt, and L. Wondrack. 1996.
Detection of erythromycin-resistant determinants by PCR.Antimicrob. Agents Chemother.
40:2562-2566.[Abstract]
69 - Tung,
H., B. Guss, U. Hellman, L. Persson, K. Rubin, and C. Ryden.2000
. A bone sialoprotein-binding protein from
Staphylococcus aureus: a member of the staphylococcal Sdr
family. Biochem. J.
345:611-619.
70 - Yu,
J. L., L. Grinius, and D. C. Hooper.2002
. NorA functions as a multidrug efflux protein in both
cytoplasmic membrane vesicles and reconstituted proteoliposomes.J. Bacteriol.
184:1370-1377.[Abstract/Free Full Text]
71 - Zilhao,
R., and P. Courvalin. 1990. Nucleotide sequence of the
fosB gene conferring fosfomycin resistance in
Staphylococcus epidermidis. FEMS Microbiol.
Lett.
56:267-272.[Medline]
72 - Zinderman,
C. E., B. Conner, M. A. Malakooti, J. E.
LaMar, A. Armstrong, and B. K. Bohnker.2004
. Community-acquired methicillin-resistant
Staphylococcus aureus among military recruits. Emerg.
Infect. Dis.
10:941-944.[Medline]
Journal of Clinical Microbiology, January 2006, p. 108-118, Vol. 44, No. 1
0095-1137/06/$08.00+0 doi:10.1128/JCM.44.1.108-118.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Montgomery, C. P., Boyle-Vavra, S., Daum, R. S.
(2009). The Arginine Catabolic Mobile Element Is Not Associated with Enhanced Virulence in Experimental Invasive Disease Caused by the Community-Associated Methicillin-Resistant Staphylococcus aureus USA300 Genetic Background. Infect. Immun.
77: 2650-2656
[Abstract]
[Full Text]
-
Argudin, M. A., Mendoza, M. C., Mendez, F. J., Martin, M. C., Guerra, B., Rodicio, M. R.
(2009). Clonal Complexes and Diversity of Exotoxin Gene Profiles in Methicillin-Resistant and Methicillin-Susceptible Staphylococcus aureus Isolates from Patients in a Spanish Hospital. J. Clin. Microbiol.
47: 2097-2105
[Abstract]
[Full Text]
-
Hall, T. A., Sampath, R., Blyn, L. B., Ranken, R., Ivy, C., Melton, R., Matthews, H., White, N., Li, F., Harpin, V., Ecker, D. J., McDougal, L. K., Limbago, B., Ross, T., Wolk, D. M., Wysocki, V., Carroll, K. C.
(2009). Rapid Molecular Genotyping and Clonal Complex Assignment of Staphylococcus aureus Isolates by PCR Coupled to Electrospray Ionization-Mass Spectrometry. J. Clin. Microbiol.
47: 1733-1741
[Abstract]
[Full Text]
-
Limbago, B., Fosheim, G. E., Schoonover, V., Crane, C. E., Nadle, J., Petit, S., Heltzel, D., Ray, S. M., Harrison, L. H., Lynfield, R., Dumyati, G., Townes, J. M., Schaffner, W., Mu, Y., Fridkin, S. K., for the Active Bacterial Core surveillance (ABCs),
(2009). Characterization of Methicillin-Resistant Staphylococcus aureus Isolates Collected in 2005 and 2006 from Patients with Invasive Disease: a Population-Based Analysis. J. Clin. Microbiol.
47: 1344-1351
[Abstract]
[Full Text]
-
Goodrich, J. S., Sutton-Shields, T. N., Kerr, A., Wedd, J. P., Miller, M. B., Gilligan, P. H.
(2009). Prevalence of Community-Associated Methicillin-Resistant Staphylococcus aureus in Patients with Cystic Fibrosis. J. Clin. Microbiol.
47: 1231-1233
[Abstract]
[Full Text]
-
Larsen, A. R., Stegger, M., Bocher, S., Sorum, M., Monnet, D. L., Skov, R. L.
(2009). Emergence and Characterization of Community-Associated Methicillin-Resistant Staphyloccocus aureus Infections in Denmark, 1999 to 2006. J. Clin. Microbiol.
47: 73-78
[Abstract]
[Full Text]
-
Tattevin, P., Diep, B. A., Jula, M., Perdreau-Remington, F.
(2008). Long-Term Follow-Up of Methicillin-Resistant Staphylococcus aureus Molecular Epidemiology after Emergence of Clone USA300 in San Francisco Jail Populations. J. Clin. Microbiol.
46: 4056-4057
[Abstract]
[Full Text]
-
Arias, C. A., Rincon, S., Chowdhury, S., Martinez, E., Coronell, W., Reyes, J., Nallapareddy, S. R., Murray, B. E.
(2008). MRSA USA300 Clone and VREF -- A U.S.-Colombian Connection?. NEJM
359: 2177-2179
[Full Text]
-
Seybold, U., Halvosa, J. S., White, N., Voris, V., Ray, S. M., Blumberg, H. M.
(2008). Emergence of and Risk Factors for Methicillin-Resistant Staphylococcus aureus of Community Origin in Intensive Care Nurseries. Pediatrics
122: 1039-1046
[Abstract]
[Full Text]
-
Klevens, R. M., Gorwitz, R. J., Collins, A. S.
(2008). Methicillin-Resistant Staphylococcus aureus: A Primer for Dentists. Journal of the American Dental Association
139: 1328-1337
[Abstract]
[Full Text]
-
Ma, X. X., Ito, T., Kondo, Y., Cho, M., Yoshizawa, Y., Kaneko, J., Katai, A., Higashiide, M., Li, S., Hiramatsu, K.
(2008). Two Different Panton-Valentine Leukocidin Phage Lineages Predominate in Japan. J. Clin. Microbiol.
46: 3246-3258
[Abstract]
[Full Text]
-
Veguilla, W., Peak, K. K., Luna, V. A., Roberts, J. C., Davis, C. R., Cannons, A. C., Amuso, P., Cattani, J.
(2008). Two-Year Study Evaluating the Potential Loss of Methicillin Resistance in a Methicillin-Resistant Staphylococcus aureus Culture Collection. J. Clin. Microbiol.
46: 3494-3497
[Abstract]
[Full Text]
-
Luna, V. A., Xu, Z.-Q., Eiznhamer, D. A., Cannons, A. C., Cattani, J.
(2008). Susceptibility of 170 isolates of the USA300 clone of MRSA to macrolides, clindamycin and the novel ketolide cethromycin. J Antimicrob Chemother
62: 639-640
[Full Text]
-
Goering, R. V., Shawar, R. M., Scangarella, N. E., O'Hara, F. P., Amrine-Madsen, H., West, J. M., Dalessandro, M., Becker, J. A., Walsh, S. L., Miller, L. A., van Horn, S. F., Thomas, E. S., Twynholm, M. E.
(2008). Molecular Epidemiology of Methicillin-Resistant and Methicillin-Susceptible Staphylococcus aureus Isolates from Global Clinical Trials. J. Clin. Microbiol.
46: 2842-2847
[Abstract]
[Full Text]
-
Wilson-Clay, B.
(2008). Case Report of Methicillin-Resistant Staphylococcus aureus (MRSA) Mastitis With Abscess Formation in a Breastfeeding Woman. J Hum Lact
24: 326-329
[Abstract]
-
Chua, T., Moore, C. L., Perri, M. B., Donabedian, S. M., Masch, W., Vager, D., Davis, S. L., Lulek, K., Zimnicki, B., Zervos, M. J.
(2008). Molecular Epidemiology of Methicillin-Resistant Staphylococcus aureus Bloodstream Isolates in Urban Detroit. J. Clin. Microbiol.
46: 2345-2352
[Abstract]
[Full Text]
-
Mendes, R. E., Deshpande, L. M., Castanheira, M., DiPersio, J., Saubolle, M. A., Jones, R. N.
(2008). First Report of cfr-Mediated Resistance to Linezolid in Human Staphylococcal Clinical Isolates Recovered in the United States. Antimicrob. Agents Chemother.
52: 2244-2246
[Abstract]
[Full Text]
-
Glikman, D., Siegel, J. D., David, M. Z., Okoro, N. M., Boyle-Vavra, S., Dowell, M. L., Daum, R. S.
(2008). Complex Molecular Epidemiology of Methicillin-Resistant Staphylococcus aureus Isolates From Children With Cystic Fibrosis in the Era of Epidemic Community-Associated Methicillin-Resistant S aureus. Chest
133: 1381-1387
[Abstract]
[Full Text]
-
Lawrence, L., Danese, P., DeVito, J., Franceschi, F., Sutcliffe, J.
(2008). In Vitro Activities of the Rx-01 Oxazolidinones against Hospital and Community Pathogens. Antimicrob. Agents Chemother.
52: 1653-1662
[Abstract]
[Full Text]
-
Lin, M. Y., Rezai, K., Schwartz, D. N.
(2008). Septic Pulmonary Emboli and Bacteremia Associated with Deep Tissue Infections Caused by Community-Acquired Methicillin-Resistant Staphylococcus aureus. J. Clin. Microbiol.
46: 1553-1555
[Abstract]
[Full Text]
-
Takano, T., Higuchi, W., Otsuka, T., Baranovich, T., Enany, S., Saito, K., Isobe, H., Dohmae, S., Ozaki, K., Takano, M., Iwao, Y., Shibuya, M., Okubo, T., Yabe, S., Shi, D., Reva, I., Teng, L.-J., Yamamoto, T.
(2008). Novel Characteristics of Community-Acquired Methicillin-Resistant Staphylococcus aureus Strains Belonging to Multilocus Sequence Type 59 in Taiwan. Antimicrob. Agents Chemother.
52: 837-845
[Abstract]
[Full Text]
-
Chung, H.-J., Jeon, H.-S., Sung, H., Kim, M.-N., Hong, S.-J.
(2008). Epidemiological Characteristics of Methicillin-Resistant Staphylococcus aureus Isolates from Children with Eczematous Atopic Dermatitis Lesions. J. Clin. Microbiol.
46: 991-995
[Abstract]
[Full Text]
-
Zhang, K., McClure, J.-A., Elsayed, S., Louie, T., Conly, J. M.
(2008). Novel Multiplex PCR Assay for Simultaneous Identification of Community-Associated Methicillin-Resistant Staphylococcus aureus Strains USA300 and USA400 and Detection of mecA and Panton-Valentine Leukocidin Genes, with Discrimination of Staphylococcus aureus from Coagulase-Negative Staphylococci. J. Clin. Microbiol.
46: 1118-1122
[Abstract]
[Full Text]
-
Sader, H. S., Fritsche, T. R., Jones, R. N.
(2008). Antimicrobial Activities of Ceftaroline and ME1036 Tested against Clinical Strains of Community-Acquired Methicillin-Resistant Staphylococcus aureus. Antimicrob. Agents Chemother.
52: 1153-1155
[Abstract]
[Full Text]
-
Olsen, R. J., Burns, K. M., Chen, L., Kreiswirth, B. N., Musser, J. M.
(2008). Severe Necrotizing Fasciitis in a Human Immunodeficiency Virus-Positive Patient Caused by Methicillin-Resistant Staphylococcus aureus. J. Clin. Microbiol.
46: 1144-1147
[Abstract]
[Full Text]
-
Diep, B. A., Chambers, H. F., Graber, C. J., Szumowski, J. D., Miller, L. G., Han, L. L., Chen, J. H., Lin, F., Lin, J., Phan, T. H., Carleton, H. A., McDougal, L. K., Tenover, F. C., Cohen, D. E., Mayer, K. H., Sensabaugh, G. F., Perdreau-Remington, F.
(2008). Emergence of Multidrug-Resistant, Community-Associated, Methicillin-Resistant Staphylococcus aureus Clone USA300 in Men Who Have Sex with Men. ANN INTERN MED
148: 249-257
[Abstract]
[Full Text]
-
Strommenger, B., Braulke, C., Heuck, D., Schmidt, C., Pasemann, B., Nubel, U., Witte, W.
(2008). spa Typing of Staphylococcus aureus as a Frontline Tool in Epidemiological Typing. J. Clin. Microbiol.
46: 574-581
[Abstract]
[Full Text]
-
Moellering, R. C. Jr
(2008). A 39-Year-Old Man With a Skin Infection. JAMA
299: 79-87
[Abstract]
[Full Text]
-
Larsen, A. R., Bocher, S., Stegger, M., Goering, R., Pallesen, L. V., Skov, R.
(2008). Epidemiology of European Community-Associated Methicillin-Resistant Staphylococcus aureus Clonal Complex 80 Type IV Strains Isolated in Denmark from 1993 to 2004. J. Clin. Microbiol.
46: 62-68
[Abstract]
[Full Text]
-
Witte, W., Strommenger, B., Cuny, C., Heuck, D., Nuebel, U.
(2007). Methicillin-resistant Staphylococcus aureus containing the Panton-Valentine leucocidin gene in Germany in 2005 and 2006. J Antimicrob Chemother
60: 1258-1263
[Abstract]
[Full Text]
-
Klevens, R. M., Morrison, M. A., Nadle, J., Petit, S., Gershman, K., Ray, S., Harrison, L. H., Lynfield, R., Dumyati, G., Townes, J. M., Craig, A. S., Zell, E. R., Fosheim, G. E., McDougal, L. K., Carey, R. B., Fridkin, S. K., for the Active Bacterial Core surveillance (ABCs),
(2007). Invasive Methicillin-Resistant Staphylococcus aureus Infections in the United States. JAMA
298: 1763-1771
[Abstract]
[Full Text]
-
Ruhe, J. J., Menon, A.
(2007). Tetracyclines as an Oral Treatment Option for Patients with Community Onset Skin and Soft Tissue Infections Caused by Methicillin-Resistant Staphylococcus aureus. Antimicrob. Agents Chemother.
51: 3298-3303
[Abstract]
[Full Text]
-
Jones, R. N., Nilius, A. M., Akinlade, B. K., Deshpande, L. M., Notario, G. F.
(2007). Molecular Characterization of Staphylococcus aureus Isolates from a 2005 Clinical Trial of Uncomplicated Skin and Skin Structure Infections. Antimicrob. Agents Chemother.
51: 3381-3384
[Abstract]
[Full Text]
-
Maresso, A. W., Wu, R., Kern, J. W., Zhang, R., Janik, D., Missiakas, D. M., Duban, M.-E., Joachimiak, A., Schneewind, O.
(2007). Activation of Inhibitors by Sortase Triggers Irreversible Modification of the Active Site. J. Biol. Chem.
282: 23129-23139
[Abstract]
[Full Text]
-
Rossney, A. S., Shore, A. C., Morgan, P. M., Fitzgibbon, M. M., O'Connell, B., Coleman, D. C.
(2007). The Emergence and Importation of Diverse Genotypes of Methicillin-Resistant Staphylococcus aureus (MRSA) Harboring the Panton-Valentine Leukocidin Gene (pvl) Reveal that pvl Is a Poor Marker for Community-Acquired MRSA Strains in Ireland. J. Clin. Microbiol.
45: 2554-2563
[Abstract]
[Full Text]
-
Tenover, F. C., Vaughn, R. R., McDougal, L. K., Fosheim, G. E., McGowan, J. E. Jr.
(2007). Multiple-Locus Variable-Number Tandem-Repeat Assay Analysis of Methicillin-Resistant Staphylococcus aureus Strains. J. Clin. Microbiol.
45: 2215-2219
[Abstract]
[Full Text]
-
Davis, S. L., Perri, M. B., Donabedian, S. M., Manierski, C., Singh, A., Vager, D., Haque, N. Z., Speirs, K., Muder, R. R., Robinson-Dunn, B., Hayden, M. K., Zervos, M. J.
(2007). Epidemiology and Outcomes of Community-Associated Methicillin-Resistant Staphylococcus aureus Infection. J. Clin. Microbiol.
45: 1705-1711
[Abstract]
[Full Text]
-
Goering, R. V., McDougal, L. K., Fosheim, G. E., Bonnstetter, K. K., Wolter, D. J., Tenover, F. C.
(2007). Epidemiologic Distribution of the Arginine Catabolic Mobile Element among Selected Methicillin-Resistant and Methicillin-Susceptible Staphylococcus aureus Isolates. J. Clin. Microbiol.
45: 1981-1984
[Abstract]
[Full Text]
-
Christianson, S., Golding, G. R., Campbell, J., the Canadian Nosocomial Infection Surveillance Pro, , Mulvey, M. R.
(2007). Comparative Genomics of Canadian Epidemic Lineages of Methicillin-Resistant Staphylococcus aureus. J. Clin. Microbiol.
45: 1904-1911
[Abstract]
[Full Text]
-
Elizur, A., Orscheln, R. C., Ferkol, T. W., Atkinson, J. J., Dunne, W. M. Jr, Buller, R. S., Armstrong, J. R., Mardis, E. R., Storch, G. A., Cannon, C. L.
(2007). Panton-Valentine Leukocidin-Positive Methicillin-Resistant Staphylococcus aureus Lung Infection in Patients With Cystic Fibrosis. Chest
131: 1718-1725
[Abstract]
[Full Text]
-
(2007). Severe Methicillin-Resistant Staphylococcus aureus Community-Acquired Pneumonia Associated With Influenza--Louisiana and Georgia, December 2006-January 2007. JAMA
297: 2070-2072
[Full Text]
-
Han, L. L., McDougal, L. K., Gorwitz, R. J., Mayer, K. H., Patel, J. B., Sennott, J. M., Fontana, J. L.
(2007). High Frequencies of Clindamycin and Tetracycline Resistance in Methicillin-Resistant Staphylococcus aureus Pulsed-Field Type USA300 Isolates Collected at a Boston Ambulatory Health Center. J. Clin. Microbiol.
45: 1350-1352
[Abstract]
[Full Text]
-
van der Mee-Marquet, N., Epinette, C., Loyau, J., Arnault, L., Domelier, A.-S., Losfelt, B., Girard, N., Quentin, R., and the Bloodstream Infection Study Group of the R,
(2007). Staphylococcus aureus Strains Isolated from Bloodstream Infections Changed Significantly in 2006. J. Clin. Microbiol.
45: 851-857
[Abstract]
[Full Text]
-
Hallin, M., Denis, O., Deplano, A., De Mendonca, R., De Ryck, R., Rottiers, S., Struelens, M. J.
(2007). Genetic relatedness between methicillin-susceptible and methicillin-resistant Staphylococcus aureus: results of a national survey. J Antimicrob Chemother
59: 465-472
[Abstract]
[Full Text]
-
Moroney, S. M., Heller, L. C., Arbuckle, J., Talavera, M., Widen, R. H.
(2007). Staphylococcal Cassette Chromosome mec and Panton-Valentine Leukocidin Characterization of Methicillin-Resistant Staphylococcus aureus Clones. J. Clin. Microbiol.
45: 1019-1021
[Abstract]
[Full Text]
-
Kilic, A., Li, H., Stratton, C. W., Tang, Y.-W.
(2006). Antimicrobial Susceptibility Patterns and Staphylococcal Cassette Chromosome mec Types of, as Well as Panton-Valentine Leukocidin Occurrence among, Methicillin-Resistant Staphylococcus aureus Isolates from Children and Adults in Middle Tennessee. J. Clin. Microbiol.
44: 4436-4440
[Abstract]
[Full Text]
-
Denis, O., Deplano, A., Nonhoff, C., Hallin, M., De Ryck, R., Vanhoof, R., De Mendonca, R., Struelens, M. J.
(2006). In Vitro Activities of Ceftobiprole, Tigecycline, Daptomycin, and 19 Other Antimicrobials against Methicillin-Resistant Staphylococcus aureus Strains from a National Survey of Belgian Hospitals.. Antimicrob. Agents Chemother.
50: 2680-2685
[Abstract]
[Full Text]