Erratum for Cassaing et al., J. Clin. Microbiol. 44 (3) 720-724.
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cassaing, S.
Right arrow Articles by Magnaval, J. F.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Cassaing, S.
Right arrow Articles by Magnaval, J. F.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, November 2006, p. 4295, Vol. 44, No. 11
0095-1137/06/$08.00+0     doi:10.1128/JCM.01905-06

ERRATUM

Comparison between Two Amplification Sets for Molecular Diagnosis of Toxoplasmosis by Real-Time PCR

S. Cassaing, M. H. Bessières, A. Berry, A. Berrebi, R. Fabre, and J. F. Magnaval

Service de Parasitologie-Mycologie, Centre Hospitalier Rangueil, Toulouse, France, and Service de Gynécologie-Obtétrique, Hôpital Paule de Viguier, Toulouse, France

Volume 44, no. 3, p. 720-724, 2006. Page 721, Table 1, column 2, line 3 from bottom: "5'TCGTCTCGTCTGGATCGAAT" should read 5'-TCGTCTCGTCTGGATCGCAT."

Journal of Clinical Microbiology, November 2006, p. 4295, Vol. 44, No. 11
0095-1137/06/$08.00+0     doi:10.1128/JCM.01905-06





This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cassaing, S.
Right arrow Articles by Magnaval, J. F.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Cassaing, S.
Right arrow Articles by Magnaval, J. F.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»