Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Stürenburg, E. Articles by Müller, S. Search for Related Content PubMed PubMed Citation Articles by Stürenburg, E. Articles by Müller, S.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, March 2006, p. 909-915, Vol. 44, No. 3
0095-1137/06/$08.00+0     doi:10.1128/JCM.44.3.909-915.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Detection and Genotyping of SHV ß-Lactamase Variants by Mass Spectrometry after Base-Specific Cleavage of In Vitro-Generated RNA Transcripts

Enno Stürenburg,^1* Niels Storm,^2, Ingo Sobottka,¹ Matthias A. Horstkotte,¹ Stefanie Scherpe,¹ Martin Aepfelbacher,¹ and Susanne Müller²

Institut für Infektionsmedizin, Universitätsklinikum Hamburg-Eppendorf, Martinistrasse 52, 20246 Hamburg, Germany,¹ SEQUENOM GmbH, Mendelssohnstrasse 15D, 22761 Hamburg, Germany²

Received 11 August 2005/ Returned for modification 3 October 2005/ Accepted 6 January 2006

Top Abstract Introduction Materials and Methods Results Discussion References

 
Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) after base-specific cleavage of PCR-amplified and in vitro-transcribed bla_SHV genes was used for the identification and genotyping of SHV ß-lactamases. For evaluation, bla_SHV stretches of 21 clinical Enterobacteriaceae isolates were PCR amplified using T7 promoter-tagged forward and reverse primers, respectively. In vitro transcripts were generated with T7 RNA and DNA polymerase in the presence of modified analogues replacing either CTP or UTP. Using RNase A, the in vitro transcripts were base-specifically cleaved at every "T" or "C" position. Resulting cleavage products were analyzed by MALDI-TOF MS, generating a characteristic signal pattern based on the fragment masses. All 21 individual SHV genes were identified unambiguously using reference sequences, and the results were in perfect concordance with those obtained by fluorescent dideoxy sequencing, which represents the current standard method. As multiple point mutations can be detected in a single assay and newly emerged mutations which are not yet described in public databases can be identified too, MALDI-TOF MS appears to be an ideal tool for analysis of sequence polymorphisms in resistance-associated gene loci.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Extended-spectrum beta-lactamases (ESBLs) are important enzymes that cause resistance to extended-spectrum cephalosporins in the widespread pathogens Klebsiella, Escherichia, Proteus, and Enterobacter (1, 27, 28); rarely in other members of the family Enterobacteriaceae; and sporadically in nonfermentating gram-negative bacilli such as Pseudomonas and Acinetobacter spp. (38, 39). ESBLs constitute a group of plasmid-mediated serine beta-lactamases, which can be divided into those enzymes that evolved via point mutations (single-nucleotide polymorphisms [SNPs]) of genes for plasmid-mediated TEM and SHV penicillinase and the CTX-M types, which have arisen by chromosomal gene escape from Kluyvera spp. (5, 14, 32, 37). Owing to the worldwide distribution and a sharp increase in prevalence, this resistance trait has become a global public health problem, with many outbreaks having occurred during the last years (24). Successful detection of the ESBL mechanism is important for timely selection of the appropriate antimicrobial treatment as well as to establish hygienic precautions to prevent further spread of the strain involved.

A variety of easy-to-carry-out tests, mostly based on synergy testing between clavulanic acid and an expanded-spectrum cephalosporin, have been introduced in recent years (6, 9, 15-17, 20, 35). Despite considerable efforts at improvement, phenotypic ESBL tests still remain a problem because of the heterogeneity of the enzymes, their variable activity against potential substrates (31, 33-35), their coexistence with other beta-lactamases (31, 35), and the confounding factors that modify their expression (e.g., the "inoculum effect") (7, 36). Furthermore, phenotype-based resistance tests fail to identify which gene variant is generating the resistance and if it is a single isolated case or the result of a pandemic spread.

Detection of ESBLs at the genetic level represents a promising alternative, which provides all these data. Genotyping is entirely independent of the degree of gene expression and independent of substrate affinity by the strains involved. Sequencing is the most widely accepted post-PCR processing method for genotyping purposes, with the capability of discovering new sequence polymorphisms differing by only a single nucleotide (4). Additionally, a number of competing post-PCR techniques for fast identification have been developed during the past few years. For example, PCR-restriction fragment length polymorphism analysis (2, 18, 23), fluorescence-labeled oligonucleotide probes used on a LightCycler instrument (25), and DNA microarrays (12) have been proposed to identify some of the relevant point mutations. However, the major drawback of all of the current assays is that they are not able to identify previously unknown sequence variations.

An innovative genotyping method is analysis of nucleic acids cleaved at specific bases by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) (26, 30). Using the data acquisition speed and the accuracy of current mass spectrometry systems, the new concept is able to detect known and previously unknown sequence variations, thus providing an ideal tool for genotypic characterization of ESBLs. Here we present the application of this new biochemistry for discovering SNPs in the SHV ß-lactamase gene.

For the new assay, two PCRs were performed. One reaction introduced a T7 promoter tag in the forward strand of the amplification product. The other PCR introduced the T7 promoter tag in the reverse strand of the product. PCR amplification was followed by in vitro transcription. Each PCR product was split into two cleavage reactions (T-specific cleavage and C-specific cleavage). Replacement of either CTP or UTP by their analog deoxynucleoside triphosphates (dCTP/dTTP) during transcription enables base-specific cleavage in each of the four reactions during the subsequent RNase A treatment. The base specificity of the cleavage reaction is based on the fact that deoxy bases in the RNA prevent the RNase A from cutting in the respective positions. Thus, the fragments are going to be cleaved only in the non-deoxy C/U position and hence the cleaved fragments will end in C or U. The resulting cleavage products were measured by MALDI-TOF MS, generating a characteristic signal pattern based on the fragment masses (Fig. 1).

View larger version (18K): [in this window] [in a new window]

FIG. 1. Overview of the novel assay for comparative sequence analysis by base-specific RNA cleavage reaction. Promoter sequences of T7 RNA polymerase are tagged at the PCR primers adjacent to the target region. For each sequence stretch of interest, two PCRs are performed. One reaction introduces the T7 promoter tag in the forward strand of the PCR product, whereas the other PCR introduces the T7 promoter tag in the reverse strand. (For simplification, only the "forward reactions" are pictured.) For post-PCR processing, each PCR product is split into two transcription reactions (one with dCTP the other with dTTP in the enzyme mix). RNase A normally cleaves after C and U. The replacement of these with dC or dT, respectively, means that cleavage will only happen after the RNA base that has not been replaced. This generates base specificity. Resulting cleavage products are measured by MALDI-TOF MS, generating a characteristic signal pattern based on the fragment masses.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Oligonucleotides (high-purity, salt-free quality) were purchased from MWG Biotech (Ebersberg, Germany).

PCR primer sequences. For analysis of the forward strand, each forward PCR primer carries a T7 promoter site attached to the 5' end of the gene-specific primer sequence (underlined) and each reverse PCR primer carries a 10-mer tag. For analysis of the reverse strand, each forward PCR primer carries a 10-mer tag and each reverse PCR primer carries a T7 promoter site. The sequences of the primers used are as follows: amp01-F-T7, CAGTAATACGACTCACTATAGGGAGAAGGCTCGTAGGCATGATAGAAATGG; amp03-F-T7, CAGTAATACGACTCACTATAGGGAGAAGGCTGAACTGAATGAGGCGCTT; amp01-R-10mer, AGGAAGAGAGTCCCGCAGATAAATCACC; amp02-R-10mer, AGGAAGAGAGAAGCGCCTCATTCAGTTC; amp01-F-10mer, AGGAAGAGAGCGTAGGCATGATAGAAATGG; amp03-F-10mer, AGGAAGAGAGGAACTGAATGAGGCGCTT; amp01-R-T7, CAGTAATACGACTCACTATAGGGAGAAGGCTTCCCGCAGATAAATCACC; amp02-R-T7, CAGTAATACGACTCACTATAGGGAGAAGGCTAAGCGCCTCATTCAGTTC. PCR product of amplicon 1 was generated between primer amp01-F-T7 and amp01-R-10mer for forward strand reactions. Product for reverse strand analysis was amplified with amp01-R-T7 together with amp01-F-10mer. Amplicon 1 was divided into two shorter amplicons (2 and 3) for comparative analysis. Amplicon 2 was amplified with analog combinations of primers of the amp01-F and amp02-R groups. Amplicon 3 was amplified with analog combinations of primers of the amp03-F and amp01-R groups.

Bacterial strains. Clinical strains had been isolated at the Microbiology Laboratory of the University Hospital Hamburg-Eppendorf (Germany). Bacterial strain identification and phenotypic antibiotic resistance testing were performed by standard procedures of the CLSI (formerly NCCLS) (8, 21), with Klebsiella pneumoniae ATCC 700603 as a reference strain.

DNA preparation/extraction. One loop of bacterial cells was dissolved in 250 µl of buffer P1, and the plasmid DNA was extracted according to the protocol provided with the QIAGEN Plasmid Mini kit (QIAGEN, Hilden, Germany).

PCR. Twenty-five-microliter amplification mixtures contained 1x PCR buffer [Tris-HCl, KCl, (NH₄)₂SO₄, MgCl₂ (pH 8.7); final MgCl₂ concentration of 1.5 mM], a 200 µM concentration of each desoxynucleoside triphosphate (Roche Diagnostics, Penzberg, Germany), 0.5 U of HotStar Taq polymerase (QIAGEN, Hilden, Germany), 10 pmol of each forward and reverse primer (MWG Biotech, Ebersberg, Germany), and 25 ng of bacterial DNA (1-ng/µl final concentration). The temperature profile consisted of 45 cycles of denaturation (94°C, 20 s), annealing (amplicon 1, 52.2°C; amplicon 2, 66.8°C; amplicon 3, 61.5°C; 30 s), and extension (72°C, 60 s) after an initial step of HotStar Taq activation (94°C, 15 min). PCRs were performed in a Thermocycler Mastercycler gradient (Eppendorf, Hamburg, Germany).

Dephosphorylation. Shrimp alkaline phosphatase (SAP) (0.3 U) (Sequenom, Hamburg, Germany) was added to 5-µl aliquots of each PCR to dephosphorylate unincorporated dNTPs. The samples were incubated for 20 min at 37°C. The enzyme was heat inactivated for 5 min at 85°C.

RNA transcription/RNase A cleavage. Base-specific cleavage is obtained by incorporating either dCTP or dTTP in the transcripts. RNA transcription/RNase A cleavage was performed by incubation of 2.0 µl PCR/SAP product and 5.0 µl of either a C- or a T-specific transcription/cleavage cocktail (Sequenom, Hamburg, Germany), a mixture consisting of 22 U T7 RNA and DNA polymerase, 1 mM ribonucleosides, 2.5 mM of either dCTP or dTTP, 0.09 mg/ml RNase A, 3.14 mM dithiothreitol, and 0.64x T7 polymerase buffer, at 37°C for 3 h.

Sample conditioning and sample transfer. Each sample was diluted by adding 20 µl double-distilled water. Then, using a dimple plate, 6 mg of Clean Resin (Sequenom, Hamburg, Germany) was added to each reaction mixture and the mixture was incubated for 10 min with gentle rotation. After centrifugation (3,200 x g, 5 min) to spin down the resin, sample aliquots of 15 nl were dispensed robotically onto a 384-element silicon chip preloaded with matrix (SpectroCHIP; Sequenom, Hamburg, Germany).

MALDI-TOF MS analysis. Mass spectra were acquired using a MassARRAY mass spectrometer (Bruker Daltonic-Sequenom GmbH). Only positive ions were analyzed, and 5 x 20 single-shot spectra were accumulated per sample. Analysis of all mass spectra was performed with the MassARRAY Discovery-RT software version 1.2.3 (Sequenom, Hamburg, Germany). This module collects and summarizes data from all four cleavage reactions. Combinatorial algorithms are used to identify point mutations based on the detection of additional and missing signals in the signal pattern.

Top Abstract Introduction Materials and Methods Results Discussion References

 
The potential of the described method for SHV typing was explored by the analysis of bla_SHV genes of 21 different clinical strains. Public database bla_SHV reference sequences (n = 37) were used to construct in silico cleavage patterns (Table 1). The regions used for calculation of the reference spectra (amino acid positions 44 to 267) cover 82% of the amino acid substitution positions published to date (n = 45) (11). Based on this computer simulation, universal bla_SHV PCR primers were designed to amplify three amplicons representing target sequences from three different gene positions (amplicon 1 [666 bp], corresponding to amino acid positions 44 to 267; amplicon 2 [391 bp], positions 44 to 173; and amplicon 3 [293 bp], positions 173 to 267) that would result in unique MALDI-TOF mass spectra. For exemplification, in silico discriminatory peak patterns of the C-specific cleavage products that originated from amplicon 1 of several representative SHV type strains in a mass range of between 1,500 and 5,300 Da are shown in Table 1. According to the simulation, each SHV type can be distinguished from all other SHV types on the basis of multiple additional or missing mass signals.

View this table: [in this window] [in a new window]

TABLE 1. Ranking of base-specific blaSHV DNA cleavage mass patternsa according to the number of identical and nonidentical mass peaks relative to the mass spectrum of the blaSHV consensus sequence

SNP patterns for the real samples were resolved with the aid of the MassARRAY Discovery-RT software package. The location and nature of sequence changes were detected and determined based on the changes of cleavage pattern signals. All 21 individual SHV genes were identified unambiguously. The results were concordant with those obtained by fluorescent dideoxy sequencing, the current standard method (Fig. 2). Therefore, with the strains processed in the presented study, the novel method reached 100% accurate identification of bla_{SHV ESBL} and bla_{SHV non-ESBL} genes in clinical isolates. Examples are shown in Fig. 3, which represents an overlay of three T-specific RNase A cleavage reactions of different K. pneumoniae ESBL strains. An arrow and asterisk mark the additional and missing discriminative mass signals.

View larger version (61K): [in this window] [in a new window]

FIG. 2. Compilation and comparison of SNPs found in 21 real samples of blaSHV genes. Dashed lines, no mutation detectable; open squares, heterozygously mutant; solid squares, homozygously mutant; a, mutant signal only detectable in the short fragment; b, mutant signal only weakly expressed. Columns representing SNP positions that lead to amino acid changes are highlighted in light gray. An asterisk indicates that definite diagnosis of which SHV variant is present is impossible due to heterozygosity at multiple SNPs. Thus, only the amino acid changes carried by the organism are specified. Eclo, Enterobacter cloacae; Eco, E. coli; Kpn, K. pneumoniae; SEQ, conventional fluorescence-based sequencing using capillaries. A checkmark indicates that the mutation was confirmed.

View larger version (17K): [in this window] [in a new window]

FIG. 3. T-specific cleavage reactions applied to a C/T324 polymorphism of the blaSHV gene, analyzed in three different individuals (Kpn68, K. pneumoniae ESBL strain 68; Kpn98, K. pneumoniae ESBL strain 98; and Kpn122, K. pneumoniae ESBL strain 122). Shown is a subview of the full spectrum. The asterisk and arrow mark the wild type (at 2,942.8 Da) and mutant (2,926.8 Da) discriminative mass signals, respectively.

In contrast to the expectation that limiting the PCR product size to less than 500 bp would produce the most robust genotyping data, we successfully acquired highly discriminating mass spectra with all three amplicons. Cleavage reactions of amplicon 2 (391 bp) and 3 (293 bp) resulted in an easily distinguishable peak pattern even in the presence of multiple point mutations as is regularly seen in the bla_SHV gene. Amplicon 1 (666 bp) also produced differentiable cleavage products, and even longer sequence stretches than that seen in the current study seem possible. Even with the subset of linked mutations that were very closely spaced (e.g., 3 bp between G/A⁷⁰⁰ and G/A⁷⁰³), a clear and easy to distinguish fragment pattern could be accomplished by using the novel technique.

Clinical samples frequently contain mixtures of wild-type and mutant DNA. The most common example of such heterozygosis is an ESBL-producing K. pneumoniae strain in which the individual strain contains both the gene bla_SHV-1, which may be either chromosomally or plasmid mediated, and a bla_{SHV ESBL} gene that is normally encoded on an uncharacterized low-copy-number plasmid. The potential of the described method for detection of heterozygous samples is shown in Fig. 3. The upper spectrum shows the characteristic pattern of fragment masses for a homozygous C sample. A new, unique signal at m/z = 2,926.8 Da appears due to loss of the cleavage site if a heterozygous sample is analyzed (lower spectrum). The intensity of the unique signal increases if the sample is homozygous T (middle spectrum). Thus, accurate discrimination of coincident bla_SHV alleles is possible regardless of the probably variable amounts of template DNA available from clinical isolates.

However, in some special instances MALDI analysis may be a mixed blessing. First, one should bear in mind that MALDI analysis will only allow investigation of SNP alleles. Reconstructing the genotype (alleles for multiple SNPs on the same gene) from a mixture of two DNAs is rarely possible. Thus, for a couple of K. pneumoniae strains, in which there is heterozygosity at multiple SNPs (in Fig. 2 marked with asterisks), MALDI-TOF analysis can only inform you as to which amino acid changes you are dealing with; however, it cannot definitely state which SHV variant is present.

Second, because the amplification does not span the whole length of the bla_SHV gene, our protocol cannot always differentiate between all possible SHV variants. For example, the bla_SHV-1v5 allele is only one nucleotide different from bla_SHV-11v3 (11). This nucleotide change is T/A⁹² and was missed in our protocol. Other examples are easily predictable: the difference between one possible SHV-2a and one possible SHV-2 variant will be T/A⁹², and the difference between one possible SHV-5 and one possible SHV-12 variant will be T/A⁹² too. While such variants have not been reported, it does not mean that they do not exist. Thus, since our protocol does not take into consideration T/A⁹², it is possible that it will not discriminate between all possible SHV-5/12 and -2/2a pairs.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Assays for multiplex determination of single-nucleotide mutations following PCR have a wide range of applications not only in human molecular genetics but also increasingly in bacterial functional genomics. One such application is the genotyping of SHV ß-lactamases that confer resistance to extended-spectrum cephalosporins. Of the numerous post-PCR methods devised in the past, the most widely used are hybridization-based assays including fluorescence-labeled oligonucleotide probes on a LightCycler instrument (25) or DNA microarrays (12), as well as PCR restriction analysis (2, 18, 23) and automated DNA sequencing (4). In this paper, we have introduced an improved method for comparative sequence analysis via base-specific cleavage of in vitro-transcribed RNA (29). Similar approaches have previously been used to detect new mutations in Escherichia coli as well as to identify different Mycobacterium species (13, 19)

The family of SHV ß-lactamases is continuously evolving, which means new, not yet described variations have to be expected in each analysis. It is important to detect these unknown variations accurately because they may represent newly emerged resistance types. Since currently established molecular detection methods rely on fixed probe/restriction site sequences, it is a challenge to cope with new variations. The hybridization-based approaches and PCR restriction analysis are burdened with the fact that any further mutation of phenotypic relevance must cumbersomely be implemented into the scheme of the method by incorporation of new oligonucleotide probes or by searching for a new restriction site. In contrast, the experimental settings of the MALDI-TOF method are universal enough to detect new single-nucleotide polymorphisms without any adaptation of the protocol (13, 29).

Although previous work suggested that shorter cleavage products should be more amenable to mass spectrometric analysis (10, 29), in our experiments an amplicon of 666 bp could be analyzed by this method, which might reduce the total number of amplicons necessary to analyze a given target sequence. Recently it has been shown that it is even possible to analyze several short amplicons together in one multiplexed reaction (10). In contrast, fluorescent DNA sequencing typically requires DNA stretches no larger than 400 to 500 bp for accurate reads. Moreover, the MALDI-TOF assay is considerably more sensitive than DNA sequencing in the detection of heterozygous samples (3, 29). Therefore, detection of mutations in the mixed samples typical of K. pneumoniae ESBL strains is easily possible with the MALDI-TOF assay, whereas fluorescent sequencing can have variable sensitivity and specificity in detecting heterozygotes because of the inconsistency of base calling at these sites (22).

In summary, the MALDI-TOF assay is a four-step (PCR, transcription, RNA cleavage, and MALDI-TOF MS analysis), single-tube procedure that does not require optimization for different substrates; hence, a single protocol may be used. However, the technology requires special and quite expensive pieces of post-PCR equipment (a 96-head automatic pipettor, a 24-pin nano-dispenser, and a MALDI-TOF mass spectrometer), which are not yet part of the standard equipment found in research and diagnostic laboratories at this time. Leaving aside the expense of buying the set of required instruments, the MALDI-TOF method is even cheaper to run than conventional sequencing using both strands: The average cost for MALDI analysis (including the PCRs) is about $3.59 per amplicon.

The procedure is automated, detects mutations in fragments up to 1 kb in length, and, although DNA extraction, PCR amplification, RNA transcription, and RNase A cleavage require similar time frames as processing steps in conventional sequencing, same-day turnaround times can be achieved. The assay is an ideal tool for identifying sequence variations, such as single-base substitutions, insertions, and deletions. The assay offers particularly high sensitivity for detection of mutations in mixed samples. The assay is robust, and the data are highly reproducible.

 
* Corresponding author. Present address: LADR GmbH, Labormedizinisches Versorgungszentrum Geesthacht, Lauenburger Straße 67, 21502 Geesthacht, Germany. Phone: 49 4152 803 120. Fax: 49 4152 803 383. E-mail: stuerenburg{at}ladr.de.

Present address: BioGlobe GmbH, Grandweg 64, 22529 Hamburg, Germany.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Albertini, M. T., C. Benoit, L. Berardi, Y. Berrouane, A. Boisivon, P. Cahen, C. Cattoen, Y. Costa, P. Darchis, E. Deliere, D. Demontrond, F. Eb, F. Golliot, G. Grise, A. Harel, J. L. Koeck, M. P. Lepennec, C. Malbrunot, M. Marcollin, S. Maugat, M. Nouvellon, B. Pangon, S. Ricouart, M. Roussel-Delvallez, A. Vachee, A. Carbonne, L. Marty, and V. Jarlier. 2002. Surveillance of methicillin-resistant Staphylococcus aureus (MRSA) and Enterobacteriaceae producing extended-spectrum beta-lactamase (ESBLE) in Northern France: a five-year multicentre incidence study. J. Hosp. Infect. 52:107-113.[CrossRef][Medline]
2
2. Arlet, G., G. Brami, D. Decrere, A. Flippo, O. Galtolot, P. H. Lagrange, and A. Philippon. 1995. Molecular characterization by PCR-restriction fragment length polymorphism of TEM ß-lactamases. FEMS Microbiol. Lett. 134:1498-1500.
3
3. Böcker, S. 2003. SNP and mutation discovery using base-specific cleavage and MALDI-TOF mass spectrometry. Bioinformatics 19:i44-i53.[Abstract]
4
4. Bradford, P. A. 1999. Automated thermal cycling is superior to traditional methods for nucleotide sequencing of bla_SHV genes. Antimicrob. Agents Chemother. 43:2960-2963.[Abstract/Free Full Text]
5
5. Bradford, P. A. 2001. Extended-spectrum ß-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev. 14:933-951.[Abstract/Free Full Text]
6
6. Brown, D. F., J. Andrews, A. King, and A. P. MacGowan. 2000. Detection of extended-spectrum beta-lactamases with Etest and double-disc potentiation methods. J. Antimicrob. Chemother. 46:327-328.[Free Full Text]
7
7. Burgess, D. S., and R. G. Hall. 2004. In vitro killing of parenteral beta-lactams against standard and high inocula of extended-spectrum beta-lactamase and non-ESBL producing Klebsiella pneumoniae. Diagn. Microbiol. Infect. Dis. 49:41-46.[CrossRef][Medline]
8
8. CLSI. 2005. Performance standards for antimicrobial susceptibility testing, 15th informational supplement (M100-S15). CLSI, Wayne, Pa.
9
9. Cormican, M. G., S. A. Marshall, and R. N. Jones. 1996. Detection of extended-spectrum ß-lactamase (ESBL)-producing strains by the Etest ESBL screen. J. Clin. Microbiol. 34:1880-1884.[Abstract]
10
10. Ehrich, M., S. Böcker, and D. van den Boom. 24 February 2005, posting date. Multiplexed discovery of sequence polymorphisms using base-specific cleavage and MALDI-TOF MS. Nucleic Acids Res. 33:e38. [Online.] doi:10.1093/nar/gni038.[Abstract/Free Full Text]
11
11. Ford, P. J., and M. B. Avison. 2004. Evolutionary mapping of the SHV ß-lactamase and evidence for two separate IS26-dependent bla_SHV mobilization events from the Klebsiella pneumoniae chromosome. J. Antimicrob. Chemother. 54:69-75.[Abstract/Free Full Text]
12
12. Grimm, V., S. Ezaki, M. Susa, C. Knabbe, R. D. Schmid, and T. T. Bachmann. 2004. Use of DNA microarrays for rapid genotyping of TEM beta-lactamases that confer resistance. J. Clin. Microbiol. 42:3766-3774.[Abstract/Free Full Text]
13
13. Honisch, C., A. Raghunathan, C. R. Cantor, B. O. Palsson, and D. van den Boom. 2004. High-throughput mutation detection underlying adaptive evolution of Escherichia coli K-12. Genome Res. 14:2495-2502.[Abstract/Free Full Text]
14
14. Jacoby, G. A., and L. S. Munoz-Price. 2005. The new ß-lactamases. N. Engl. J. Med. 352:380-391.[Free Full Text]
15
15. Jarlier, V., M. H. Nicolas, G. Fournier, and A. Philippon. 1988. Extended broad-spectrum beta-lactamases conferring transferable resistance to newer beta-lactam agents in Enterobacteriaceae: hospital prevalence and susceptibility patterns. Rev. Infect. Dis. 10:867-878.[Medline]
16
16. Katsanis, G. P., J. Spargo, M. J. Ferraro, L. Sutton, and G. A. Jacoby. 1994. Detection of Klebsiella pneumoniae and Escherichia coli strains producing extended-spectrum ß-lactamases. J. Clin. Microbiol. 32:691-696.[Abstract/Free Full Text]
17
17. Laffineur, K., Y. De Gheldre, V. Berhin, Y. Avesani, and Y. Glupczynski. 2003. Evaluation of three different Etest strips for the detection of extended-spectrum ß-lactamases (ESBL) in various Enterobacteriaceae species, abstr. D-203. Program Abstr. 43rd Intersci. Conf. Antimicrob. Agents Chemother.
18
18. Lee, S. H., J. Y. Kim, S. K. Lee, W. Jin, S. G. Kang, and K. J. Lee. 2000. Discriminatory detection of extended-spectrum beta-lactamases by restriction fragment length dimorphism-polymerase chain reaction. Lett. Appl. Microbiol. 31:307-312.[CrossRef][Medline]
19
19. Lefmann, M., C. Honisch, S. Böcker, N. Storm, F. von Wintzingerode, C. Schlötelburg, A. Moter, D. van den Boom, and U. B. Göbel. 2004. Novel mass spectrometry-based tool for genotypic identification of mycobacteria. J. Clin. Microbiol. 42:339-346.[Abstract/Free Full Text]
20
20. Leverstein-van Hall, M. A., A. C. Fluit, A. Paauw, A. T. A. Box, S. Brisse, and J. Verhoef. 2002. Evaluation of the Etest ESBL and the BD Phoenix, VITEK 1, and VITEK 2 automated instruments for detection of extended-spectrum beta-lactamases in multiresistant Escherichia coli and Klebsiella spp. J. Clin. Microbiol. 40:3703-3711.[Abstract/Free Full Text]
21
21. NCCLS. 2003. Performance standards for antimicrobial disk susceptibility tests: approved standard, 8th ed. NCCLS document M2-A8. National Committee for Clinical Laboratory Standards, Wayne, Pa.
22
22. Nickerson, D., V. Tobe, and S. Taylor. 1997. PolyPhred: automating the detection and genotyping of single nucleotide substitutions using fluorescence-based resequencing. Nucleic Acids Res. 25:2745-2751.[Abstract/Free Full Text]
23
23. Nuesch-Inderbinen, M. T., H. Hachler, and F. H. Kayser. 1996. Detection of genes coding for extended-spectrum SHV beta-lactamases in clinical isolates by a molecular genetic method, and comparison with the E test. Eur. J. Clin. Microbiol. Infect. Dis. 15:398-402.[CrossRef][Medline]
24
24. Paterson, D. L. 2001. Extended-spectrum beta-lactamases: the European experience. Curr. Opin. Infect. Dis. 14:697-701.[Medline]
25
25. Randegger, C. C., and H. Hächler. 2001. Real-time PCR and melting curve analysis for reliable and rapid detection of SHV extended-spectrum ß-lactamases. Antimicrob. Agents Chemother. 45:1730-1736.[Abstract/Free Full Text]
26
26. Rodi, C. P., B. Darnhofer-Patel, P. Stanssens, M. Zabeau, and D. van den Boom. 2002. A strategy for rapid discovery of disease markers using the MassARRAY system. BioTechniques 32:S62-S69.
27
27. Sirot, J., M. H. Nicolas-Chanoine, H. Chardon, J. L. Avril, C. Cattoen, J. C. Croix, H. Dabernat, T. Fosse, J. C. Ghnassia, E. Lecaillon, A. Marmonier, M. Roussel-Delvallez, C. J. Soussy, A. Trevoux, F. Vandenesch, C. Dib, N. Moniot-Ville, and Y. Rezvani. 2002. Susceptibility of Enterobacteriaceae to beta-lactam agents and fluoroquinolones: a 3-year survey in France. Clin. Microbiol. Infect. 8:207-213.[CrossRef][Medline]
28
28. Spanu, T., F. Luzzaro, M. Perilli, G. Amicosante, A. Toniolo, G. Fadda, et al. 2002. Occurrence of extended-spectrum ß-lactamases in members of the family Enterobacteriaceae in Italy: implications for resistance to ß-lactams and other antimicrobial drugs. Antimicrob. Agents Chemother. 46:196-202.[Abstract/Free Full Text]
29
29. Stanssens, P., M. Zabeau, G. Meersseman, G. Remes, Y. Gansemans, N. Storm, R. Hartmer, C. Honisch, C. P. Rodi, S. Böcker, and D. van den Boom. 2004. High-throughput MALDI-TOF discovery of genomic sequence polymorphisms. Genome Res. 14:133.
30
30. Storm, N., B. Darnhofer-Demar, D. van den Boom, and C. P. Rodi. 2002. MALDI-TOF mass spectrometry-based SNP genotyping. Methods Mol. Biol. 212:241-262.
31
31. Stürenburg, E., M. Lang, M. A. Horstkotte, R. Laufs, and D. Mack. 2004. Evaluation of the MicroScan ESBL plus confirmation panel for detection of extended-spectrum ß-lactamases in clinical isolates of oxyimino-cephalosporin-resistant Gram-negative bacteria. J. Antimicrob. Chemother. 54:870-875.[Abstract/Free Full Text]
32
32. Stürenburg, E., and D. Mack. 2003. Extended-spectrum ß-lactamases: implications for the clinical microbiology laboratory. J. Infect. 47:273-295.[CrossRef][Medline]
33
33. Stürenburg, E., I. Sobottka, H. H. Feucht, D. Mack, and R. Laufs. 2003. Comparison of BD Phoenix and VITEK2 automated antimicrobial susceptibility test systems for extended-spectrum beta-lactamase detection in Escherichia coli and Klebsiella species clinical isolates. Diagn. Microbiol. Infect. Dis. 45:29-34.[CrossRef][Medline]
34
34. Stürenburg, E., I. Sobottka, R. Laufs, and D. Mack. 2004. Evaluation of a new screen agar for detection and presumptive identification of Enterobacteriaceae producing extended-spectrum beta-lactamases. Diagn. Microbiol. Infect. Dis. 51:51-55.
35
35. Stürenburg, E., I. Sobottka, D. Noor, R. Laufs, and D. Mack. 2005. Evaluation of a new cefepime-clavulanate ESBL Etest to detect extended-spectrum ß-lactamases in an Enterobacteriaceae strain collection. J. Antimicrob. Chemother. 54:134-138.
36
36. Thomson, K. S., and E. S. Moland. 2001. Cefepime, piperacillin-tazobactam, and the inoculum effect in tests with extended-spectrum ß-lactamase-producing Enterobacteriaceae. Antimicrob. Agents Chemother. 45:3548-3554.[Abstract/Free Full Text]
37
37. Tzouvelekis, L. S., E. Tzelepi, P. T. Tassios, and N. J. Legakis. 2000. CTX-M-type beta-lactamases: an emerging group of extended-spectrum enzymes. Int. J. Antimicrob. Agents 14:137-142.[CrossRef][Medline]
38
38. Vahaboglu, H., F. Coskunkan, O. Tansel, R. Ozturk, N. Sahin, I. Koksal, B. Kocazeybek, M. Tatman-Otkun, H. Leblebicioglu, M. A. Ozinel, H. Akalin, S. Kocagoz, and V. Korten. 2001. Clinical importance of extended-spectrum beta-lactamase (PER-1-type)-producing Acinetobacter spp. and Pseudomonas aeruginosa strains. J. Med. Microbiol. 50:642-645.[Abstract/Free Full Text]
39
39. Vahaboglu, H., R. Öztürk, H. Aygün, F. Coskunkan, A. Yaman, A. Kaygusuz, H. Leblebicioglu, I. Balik, K. Aydin, and M. Otkun. 1997. Widespread detection of PER-1-type extended-spectrum ß-lactamases among nosocomial Acinetobacter and Pseudomonas aeruginosa isolates in Turkey: a nationwide multicenter study. Antimicrob. Agents Chemother. 41:2265-2269.[Abstract]

---

Journal of Clinical Microbiology, March 2006, p. 909-915, Vol. 44, No. 3
0095-1137/06/$08.00+0     doi:10.1128/JCM.44.3.909-915.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Stürenburg, E. Articles by Müller, S. Search for Related Content PubMed PubMed Citation Articles by Stürenburg, E. Articles by Müller, S.