This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oliver, S. L.
Right arrow Articles by Lambden, P. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oliver, S. L.
Right arrow Articles by Lambden, P. R.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, March 2006, p. 992-998, Vol. 44, No. 3
0095-1137/06/$08.00+0     doi:10.1128/JCM.44.3.992-998.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Genotype 1 and Genotype 2 Bovine Noroviruses Are Antigenically Distinct but Share a Cross-Reactive Epitope with Human Noroviruses

S. L. Oliver,1* C. A. Batten,2 Y. Deng,2 M. Elschner,3 P. Otto,3 A. Charpilienne,4 I. N. Clarke,2 J. C. Bridger,1 and P. R. Lambden2

Department of Pathology and Infectious Diseases, Royal Veterinary College, 4 Royal College Street, Camden, London, NW1 0TU, United Kingdom,1 Molecular Microbiology Group, University Medical School, Southampton General Hospital, Southampton SO16 6YD, United Kingdom,2 Friedrich-Loeffler-Institute, Federal Research Institute for Animal Health, Institute of Bacterial Infections and Zoonoses, Naumburger Strasse 96a, 07743 Jena, Germany,3 Unité Mixte de Recherche, CNRS 2472-INRA 1157, Virologie Moléculaire et Stucturale, 1 avenue de la Terrasse, 91198 Gif-sur-Yvette, France4

Received 30 September 2005/ Returned for modification 2 December 2005/ Accepted 23 December 2005


arrow
ABSTRACT
 
The bovine enteric caliciviruses Bo/Jena/1980/DE and Bo/Newbury2/1976/UK represent two distinct genotypes within a new genogroup, genogroup III, in the genus Norovirus of the family Caliciviridae. In the present study, the antigenic relatedness of these two genotypes was determined for the first time to enable the development of tests to detect and differentiate between both genotypes. Two approaches were used. First, cross-reactivity was examined by enzyme-linked immunosorbent assay (ELISA) using recombinant virus-like particles (VLPs) and convalescent-phase sera from calves infected with either Jena (genotype 1) or Newbury2 (genotype 2). Second, cross-reactivity was examined between the two genotypes with a monoclonal antibody, CM39, derived using Jena VLPs. The two genotypes, Jena and Newbury2, were antigenically distinct with little or no cross-reactivity by ELISA to the heterologous VLPs using convalescent calf sera that had homologous immunoglobulin G titers of log10 3.1 to 3.3. CM39 reacted with both Jena and heterologous Newbury2 VLPs. The CM39 epitope was mapped to nine amino acids (31PTAGAQIAA39) in the Jena capsid protein, which was not fully conserved for Newbury2 (31PTAGAPVAA39). Molecular modeling showed that the CM39 epitope was located within the NH2-terminal arm inside the virus capsid. Surprisingly, CM39 also reacted with VLPs from two genogroup II/3 human noroviruses by ELISA and Western blotting. Thus, although the bovine noroviruses Jena and Newbury2 corresponded to two distinct antigenic types or serotypes, they shared at least one cross-reactive epitope. These findings have relevance for epidemiological studies to determine the prevalence of bovine norovirus serotypes and to develop vaccines to bovine noroviruses.


arrow
INTRODUCTION
 
Viruses resembling caliciviruses were first reported in association with calf diarrhea in the United Kingdom in 1978 and in Germany in 1980 (1, 15, 40). Studies in experimental cattle showed that viruses from both countries were enteric pathogens, but further characterization of these viruses was hampered by the lack of a cell culture system and the lack of genomic information (7, 14). Recently, genomic data have been obtained from the two viruses, Bo/Newbury2/1976/UK and Bo/Jena/1980/DE, identified originally (9, 25, 31). Both have genomes of 7.3 kb organized into three open reading frames and have been classified in a new genogroup, genogroup III, of the noroviruses, in the family Caliciviridae (3, 9, 25, 31).

There were clear differences between the genomes of Jena and Newbury2. Analysis of the polymerase, capsid, and ORF3 genes placed each virus in a different genetic cluster or genotype with only 68% amino acid identity in their complete capsid proteins. Further isolates of the genotype 1 (Jena) or genotype 2 (Newbury2) bovine noroviruses have been identified from the United Kingdom, The Netherlands, and United States (30, 31, 34, 37, 39), confirming the existence of the two distinct genotypes. Viruses within a genotype had 91 to 99% amino acid identity in their complete capsid proteins (17, 30, 31, 34). The majority of the amino acid variation was in the protruding or P-domains of the capsid proteins. This raised the question of the antigenic relatedness between the two bovine norovirus genotypes and whether serological methods that detect one would detect the other.

Reverse transcription-PCR (RT-PCR), based on the polymerase gene, has been used as the predominant diagnostic method for bovine noroviruses (30, 34, 37, 39). This led to their recognition and highlighted the need to determine the exact role of bovine noroviruses in the calf diarrhea syndrome. The capsid genes of genotype 1 viruses have been identified less commonly than the genotype 2 viruses (17, 30, 31, 34, 39). Of the 26 complete capsid genes currently available for bovine noroviruses from GenBank, only 5 were genotype 1, with the remaining 21 genotype 2. Data are required on the prevalence of bovine noroviruses in cattle populations, the prevalence of the two genotypes, and the role of both in disease. To date, only two genotypes have been identified in genogroup III bovine noroviruses.

The prevalence of genotype 1 and 2 bovine noroviruses is most easily studied using serological methods to detect antigen and antibody. Serological methods for the Jena virus have been developed based on recombinant virus-like particles (VLPs) used as antigen to detect serum immunoglobulin G (IgG) or used to generate polyclonal antisera to detect virus antigen by enzyme-linked immunosorbent assay (ELISA) (11). More recently, serological methods were also developed for the Newbury2 virus (S. L. Oliver, E. Asobayire, A. Charpilliene, J. Cohen, and J. C. Bridger, submitted for publication). However, the considerable differences in the predicted amino acid compositions of the capsid proteins of genotype 1 and 2 bovine noroviruses suggested that serologically based tests would not detect both genotypes and their antibodies, but this remained to be proven.

Using two approaches, the present study determined the antigenic relationship of the two bovine norovirus genotypes to enable the development of tests to detect and differentiate both genotypes. First, to establish whether genotype 1 and 2 bovine noroviruses represent two serotypes, the cross-reactivities of convalescent antisera from calves experimentally infected with either Jena, Newbury2, or the Newbury2-like virus Dumfries were examined by ELISA using recombinant VLPs generated from Jena and Newbury2. Second, the cross-reactivity of a monoclonal antibody derived using Jena VLPs was determined with the ultimate aim to develop a cross-reactive ELISA specific for genogroup III bovine noroviruses.


arrow
MATERIALS AND METHODS
 
Viruses and antisera. Convalescent antisera to three bovine noroviruses were used: Bo/Newbury2/1976/UK, identified in southern England (40), Bo/Jena/1980/DE, identified in Germany, and Bo/Dumfries/1994/UK, identified in Dumfries, Scotland (31). Convalescent antisera to the genotype 1 bovine norovirus Jena were obtained from colostrum-deprived calves 14 days after oral inoculation with Jena virus. Convalescent antisera to the genotype 2 bovine noroviruses were obtained 22 days after a single oral inoculation of gnotobiotic calves with Newbury2 virus (7) or 14 days after a single inoculation of a colostrum-deprived calf with Dumfries virus (kindly provided by David Snodgrass, Biobest). Bovine antisera raised to Newbury1 virus and the bovine rotavirus UK were used as negative controls (6, 7). Newbury1 virus is an unclassified calicivirus with ≤21% amino acid identity in its complete capsid protein with Jena and Newbury2 (S. L. Oliver, E. Asobayire, A. M. Dastjerdi, and J. C. Bridger, submitted for publication).

Production of VLPs and GST-capsid fusion proteins from bovine and human noroviruses. Jena and Newbury2 VLPs were prepared as described elsewhere (11; Oliver, Asobayire, Charpilliene, et al., submitted). VLPs for the genogroup I human norovirus Hu/Southampton/1991/UK and the genogroup II human noroviruses Hu/RBH/1993/UK, Hu/Lordsdale/1993/UK, and Hu/Leeds/1990/UK were prepared as previously described (12, 32). VLPs for the following human noroviruses were gifts: Hu/Norwalk/1968/US (Mary Estes, Baylor College of Medicine, Texas), Hu/Hawaii/1971/US, Hu/SnowMountain/1976/US, and Hu/DesertShield395/1990/SA (Kim Green, NIH, Maryland), and Hu/Toronto/1991/CAN (Stephan Monroe, CDC, Georgia). Glutathione S-transferase (GST)-capsid fusion proteins were generated from the capsid genes for the genogroup III bovine norovirus Jena and the genogroup I human noroviruses Southampton, Norwalk, and Desert Shield plus the genogroup II human noroviruses Hawaii, Snow Mountain, Toronto, RBH, Lordsdale, and Leeds. These were cloned into the pGex 4T1 vector (Amersham Biosciences UK Ltd., United Kingdom) and used to transform Escherichia coli. Protein synthesis was induced by isopropyl-ß-D-thiogalactopyranoside (100 mM), and the cultures were incubated overnight at 25°C. The majority of the protein was expressed as inclusion bodies, as determined by electron microscopy. GST-capsid fusion proteins were purified from the inclusion bodies using Bugbuster (Novagen, Merck Biosciences Ltd., United Kingdom) following the manufacturer's instructions.

Detection of bovine norovirus IgG by ELISA. Maxisorb plates (Nunc) were coated with 5 µg/ml of VLP antigen in carbonate buffer, pH 9.6, overnight at 4°C. Antigens used were CsCl-purified Jena and Newbury2 VLPs plus supernatants from wild-type baculovirus-infected Sf9 cells (mock antigen). Plates were blocked with 2% nonfat dried skimmed milk in phosphate-buffered saline (PBS) and washed with PBST (PBS plus 0.05% Tween 20 [Sigma-Aldrich Company Ltd., United Kingdom]) between each step. Antisera from the experimental calves were diluted from 1:50 in twofold dilution series in 1% nonfat dried skimmed milk in PBST, dispensed into wells previously coated with VLPs or mock antigen, and incubated at room temperature for 1 h. After washing, a 1:10,000 dilution of rabbit anti-bovine IgG-horseradish peroxidase conjugate (Sigma-Aldrich Company Ltd., United Kingdom) in PBST plus 1% nonfat dried skimmed milk was added and incubated for 1 h at room temperature. Peroxidase activity was detected using 3,3',5,5'-tetramethylbenzidine as substrate (Sigma-Aldrich Company Ltd., United Kingdom), and the absorbance was measured at 450 nm. Serum titers were calculated by linear regression using Prism 4 (GraphPad Software). Cutoff values were determined as twice the mean net absorbance value at 450 nm (absorbance with test antigen minus absorbance with mock antigen at each dilution) of the wells without the test serum.

Production of monoclonal antibodies to Jena VLPs. Prior to immunization with Jena VLPs, BALB/c mice were shown not to have preexisting antibodies to the Jena capsid protein by ELISA, Western blotting, and radioimmunoprecipitation assay (RIPA). Mice were primed intraperitoneally with 50 µg of purified Jena VLPs in Freund's complete adjuvant followed by two intraperitoneal injections of Jena VLPs in Freund's incomplete adjuvant at 14-day intervals. A final intravenous injection of Jena VLPs was administered 3 days prior to hybridoma production. Spleen cells isolated from the mice were fused in polyethylene glycol 4000 (Gibco BRL, United Kingdom) to BALB/c P3-NS-1 plasmacytoma cells. Hybrid cells were seeded into 96-well trays containing peritoneal macrophages from CD-1 mice in hypoxanthine-aminopterin-thymidine medium (RPMI 1640, 20% fetal bovine serum, 1% 200 mM L-glutamine, 1% sodium pyruvate, 0.2% gentamicin, 2% hypoxanthine-aminopterin-thymidine [50x], 1% penicillin-streptomycin). Cell culture supernatants from hybridomas that showed reactivity to Jena VLPs by ELISA were cloned by terminal dilution, and their supernatants were harvested for further analysis.

Specificity by ELISA of the monoclonal antibody CM39 to bovine and human norovirus VLPs and GST-fusion capsid proteins. Polyvinyl 96-well plates (INC Labs) were coated with VLPs or GST-fusion proteins in carbonate buffer, pH 9.6, at 2 µg/ml. Plates were incubated overnight in a humid environment at 4°C. Plates were washed with PBST between each step. Plates were blocked with 5% nonfat dried skimmed milk in PBS for 30 min at 37°C, and then a 1:5 dilution of the hybridoma supernatant containing the monoclonal antibody CM39 in PBST plus 1% nonfat dried skimmed milk was added and incubated for 90 min at 37°C. A 1:3,000 dilution of goat anti-mouse polyvalent antibody conjugated to horseradish peroxidase (Sigma-Aldrich Company Ltd., United Kingdom) diluted in PBS plus 1% nonfat dried skimmed milk was added to the plates and incubated for a further 90 min at 37°C. Peroxidase activity was detected using 0.1% sodium acetate (pH 6.0)-0.1% tetramethylbenzidine-0.01% H2O2, and the absorbance was measured at 450 nm.

SDS-PAGE and immunostaining of capsid proteins. The bovine and human norovirus capsid proteins expressed in vitro as VLPs or GST-fusion proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using 12.5% polyacrylamide gels with the discontinuous buffer method (22). Capsid proteins were electroblotted to nitrocellulose membranes in transfer buffer (Tris-HCl, 25 mM; glycine, 192 mM; SDS, 0.1%; methanol, 20%) using a Trans-Blot SD semidry blotter (Bio-Rad Laboratories Ltd., United Kingdom). Membranes were incubated at 37°C in blocking solution of TBS (NaCl, 0.5 M; Tris-HCl, 20 mM [pH 7.5]) containing 0.05% Tween 20 plus 5% skimmed milk powder. Subsequent incubations were performed at room temperature. Membranes were washed twice with blocking solution and once with TBS and then incubated for 16 h with the hybridoma supernatant of CM39 monoclonal antibody diluted 1:20 in blocking solution containing 10% normal goat serum. After washing, membranes were incubated with a 1:1,000 dilution of goat anti-mouse IgG conjugated to alkaline phosphatase (Sigma-Aldrich Company Ltd., United Kingdom). Alkaline phosphatase activity was detected using a bromo-chloro-indolyl-phosphate-nitroblue tetrazolium salt (Sigma-Aldrich Company Ltd., United Kingdom).

In vitro transcription and translation of complete and partial Jena capsid proteins. The complete Jena capsid protein plus four C-terminal-truncated capsid fragments were used to locate the region where the CM39 monoclonal antibody bound. The template used for in vitro transcription of the complete capsid protein was a full-length capsid gene cloned into pRSETA (Invitrogen Ltd., United Kingdom). PCR amplicons derived from this construct were used for the four fragments, F1 to F4, of the capsid protein. The forward primer (5'-GATCTCGATCCCGCGAAATT-3') was located in the pRSETA vector sequence just upstream of the T7 promoter region. The antisense primers used to generate the four fragments were JVF3R (5'-TTA5871GAGTGGTTCCAAGCAAATCG5851-3'), JVF4R (5'-TTA5759ATTGGTGAGACTGTAAACTGG5738-3'), JVF5R (5'-TTA5670AATCAGGGCTTGGACAGGTT5650-3'), and JVF6R (5'-TTA5500GCACGGACATCCATTATCAC5480-3'). The nucleotide coordinates for the oligonucleotides are from the full-length genomic sequence of the Jena virus with the premature termination codon at the 5' end of each oligonucleotide. In vitro translation was performed with 0.1 µg to 1 µg of purified DNA (Genelute Miniprep or Midiprep; Sigma) using a T7 RNA polymerase-coupled rabbit reticulocyte lysate system (TNT; Promega, United Kingdom) following the manufacturer's instructions for reaction volumes of 50 µl containing [35S]methionine. The reaction mixtures were incubated for 2 h at 30°C and then separated by SDS-PAGE. The gels were placed in salicylate solution (1 M sodium salicylate, 50% methanol) for 30 min at room temperature to enhance the signal obtained by autoradiography. Gels dried under vacuum onto chromatography paper were exposed to Kodak XAR-5 film overnight at –70°C in an autoradiography cassette prior to development of the film.

RIPA. In vitro transcription-translation reaction mixtures plus undiluted antisera or the CM39 monoclonal antibody in RIPA buffer (10 mM Tris-HCl [pH 7.5], 1 mM EDTA, 0.15 mM NaCl, 0.1% SDS, 0.5% Empigen BB [N-dodecyl-N,N-dimethylglycine], 0.1 mM phenylmethylsulfonyl fluoride) were incubated for 1 h at 37°C. To adsorb immune complexes, goat anti-mouse IgG attached to agarose beads (Sigma-Aldrich Company Ltd., United Kingdom) was added to the reaction mixtures and then incubated for 2 h at room temperature. The beads were washed three times in RIPA buffer and once in PBS. Immune complexes were solubilized with sample dissociating buffer and then separated by SDS-PAGE, and the gels were prepared for autoradiography as described previously.

Epitope analysis. To map the epitope recognized by the monoclonal antibody CM39, a solid-phase peptide array consisting of 48 overlapping dodecapeptides offset by three amino acids was synthesized commercially on a series of solid-phase pegs (Mimotopes Ltd., UK). The peptides spanned 153 amino acids for the NH2-terminal region of the Jena capsid protein. Epitope analysis was performed in accordance with the manufacturer's protocol. Peptides in a 96-well polyvinyl plate were submerged with precoat buffer (2% bovine serum albumin, 0.1% Tween 20, and 0.1% sodium azide in PBS) for 1 h at room temperature and then incubated overnight at 4°C with the CM39 hybridoma supernatant diluted 1:5 in precoat buffer. The peptides were washed with PBS between each step. A goat anti-mouse polyvalent antibody conjugated to horseradish peroxidase (Sigma-Aldrich Company Ltd., United Kingdom) diluted to 1:3,000 in PBS containing 1% normal goat serum, 0.1% Tween 20, and 0.1% sodium caseinate was added, and then the mixture was incubated for 1 h at room temperature. Peroxidase activity was detected using 0.05% 2,2'-azinobis(3-ethylbenzthiazolinesulfonic acid) dissolved in substrate buffer (0.1 M Na2HPO4, 0.08 M citric acid, pH 4.0, and 0.01% H2O2), and the absorbance was measured at 405 nm.

Molecular modeling. A homology model of the Newbury2 capsid protein was generated using the Swiss-Model server (http://swissmodel.expasy.org/). Coordinates for the quaternary structure of the five-fold axis of symmetry for the X-ray crystallography structure of Norwalk virus (PDB accession number 1ihm) were obtained from the Macromolecular Structure Database (http://pqs.ebi.ac.uk/). To show the location of the Jena epitope sequence (31PTAGAQIAA39) in the monomer of the Newbury2 capsid protein (epitope sequence 31PTAGAPVAA39 for the Newbury2 capsid protein) and the five-fold axis of symmetry of the Norwalk virus, image files were generated using the software program VMD 1.8.2 (19). Pov-ray for Windows was used to generate ray traced images for all of the structures. An amino acid alignment of the Norwalk and Newbury2 capsid proteins showed that the Norwalk virus sequence 35PVAGSSTAV43 was equivalent to the 31PTAGAPVAA39 sequence of Newbury2. The domains of the Newbury2 capsid protein equivalent to those of Norwalk virus were taken as amino acids 1 to 45 for the NH2-terminal domain, 46 to 218 for the S domain, 219 to 272 and 396 to 522 for the P1 domain, and 273 to 395 for the P2 domain.


arrow
RESULTS
 
Cross-reactivity between Bo/Jena/1980/DE and Bo/Newbury2/1976/UK by ELISA using convalescent calf antisera. The two viruses, Jena (genotype 1) and Newbury2 (genotype 2), were antigenically distinct. There was undetectable or low cross-reactivity with the heterologous antigen and convalescent antisera from six calves inoculated with either Jena or Newbury2 (Table 1). Mean log10 IgG titers to the homologous antigens were between 3.1 ({sigma} = 0.0) and 3.3 ({sigma} = 0.9), over 1,000-fold higher than those with the heterologous antigens. Preinoculation sera from calves inoculated with Jena and Newbury2 and antisera from calves infected with Newbury1 and the bovine rotavirus strain UK showed no reactivity with either antigen (log10 < 1.7). The lack of cross-reactivity between the two genotypes was confirmed with antiserum to the Newbury2-like virus Bo/Dumfries/1994/UK.


View this table:
[in this window]
[in a new window]
 
TABLE 1. IgG titers by ELISA using Jena or Newbury2 VLPs with antisera from calves infected with the bovine noroviruses Jena, Newbury2, or Dumfries or with Newbury1 or bovine rotavirus UK

Cross-reactivity between Bo/Jena/1980/DE and Bo/Newbury2/1976/UK with the monoclonal antibody CM39. Monoclonal antibody CM39, derived using Jena VLPs, reacted with the homologous Jena VLPs and a GST-Jena capsid fusion protein in the Western blot assay, RIPA, and ELISAs (Fig. 1 and Table 2). Monoclonal antibody CM39 cross-reacted strongly with Newbury2 by Western blotting and ELISA, showing the presence of a common epitope in the genotype 1 and 2 bovine noroviruses. The position of the CM39 recognition sequence was located by RIPA to the NH2-terminal 149 amino acids of the Jena capsid protein. All four proteins, F1 to F4, of the expected molecular masses were precipitated by CM39, including the shortest protein, F4 (Fig. 2).


Figure 1
View larger version (8K):
[in this window]
[in a new window]
 
FIG. 1. Reactivity by Western blotting of the monoclonal antibody CM39 with the capsid proteins from VLPs of the two genotypes of bovine noroviruses, Jena (genotype 1) and Newbury2 (genotype 2), and the human genogroup II noroviruses Lordsdale (genotype 4) and Toronto (genotype 3).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Reactivity of the monoclonal antibody CM39 to norovirus capsid proteins expressed as VLPs, GST fusion proteins or radiolabelled proteins and detected using ELISA, western blot or RIPA


Figure 2
View larger version (34K):
[in this window]
[in a new window]
 
FIG. 2. Autoradiograph showing the complete and partial fragments (F1 to F4) of the Jena capsid protein that were precipitated with the monoclonal antibody CM39 using RIPA. The gray bars below the autoradiograph show the length in amino acids and the predicted molecular mass of the complete capsid protein of Jena plus the C-terminal-truncated fragments generated by transcription-translation. The arrowheads show the expected migration for the complete and partial fragments of the Jena capsid protein. Internal translations from initiation codons within the vector produced proteins of higher-than-expected molecular masses.

The epitope responsible for the Jena and Newbury2 cross-reactivity was successfully mapped to a region between amino acids 28 and 42 of the capsid protein. Of 48 dodecamers, offset by 3 amino acids, which were generated for 153 amino acids spanning the NH2-terminal region of the Jena capsid protein, 6 showed reactivity with the monoclonal antibody CM39. Peptides 10 (28PVEPTAGAQIAA39) and 11 (31PTAGAQIAAPTA42) showed the highest levels of reactivity, with the reactivity of the other peptides just above background levels (Fig. 3). Visual inspection of the two overlapping peptides defined the epitope as nine amino acid residues, 31PTAGAQIAA39, in the Jena sequence. Homology models of the bovine norovirus capsid proteins showed that the CM39 epitope was located in the NH2-terminal arm of the capsid protein (Fig. 4A). The 31PTAGAQIAA39 sequence was unique to the Jena norovirus. Newbury2 had two amino acid substitutions, Q36->P and I37->V, yet cross-reacted in the ELISA and Western blot assay, suggesting that amino acids P36 and V37 were not critical contact residues within the antibody-binding site. This might be explained by the linear conformation formed by residues P31 to A35, A38, and A39 of the CM39 epitope (Fig. 4B). In addition, the predicted solvent accessibility of these residues was virtually identical for Jena and Newbury2 (not shown). A macromolecular model of the five-fold axis of symmetry for the Norwalk virus showed that the epitope would be located on the inside of the virion (Fig. 4C and D). The presence of partly formed VLPs, often seen by electron microscopy (data not shown), explained the reactivity of the monoclonal antibody CM39 with VLPs.


Figure 3
View larger version (18K):
[in this window]
[in a new window]
 
FIG. 3. Immunoreactivity by ELISA of the monoclonal antibody CM39 with 48 dodecapeptides generated from 153 amino acids at the NH2 terminal of the Jena capsid protein.


Figure 4
View larger version (74K):
[in this window]
[in a new window]
 
FIG. 4. Molecular models showing the location in the capsid protein of the epitope (31PTAGAQIAA39; purple space fill) recognized by the monoclonal antibody CM39. (A) Homology model of the Newbury2 capsid protein generated using Swiss-Model. Green, NH2-terminal amino acids; yellow, S domain; red, P1 domain; blue, P2 domain. (B) The CM39 epitope showing the location of the Q36->P and I37->V amino acid substitutions (yellow) in the Newbury2 protein compared to Jena and the linear conformation of amino acids P31 to A35 and A38 and A39 (purple). P31 and A39 correspond to the NH2 and COOH termini of the CM39 epitope sequence. (C and D) The five-fold axis of symmetry of the human genogroup I norovirus Norwalk viewed from the top (C) or side (D), showing the likely location of the bovine norovirus epitope for CM39.

Cross-reactivity between bovine and human noroviruses using monoclonal antibody CM39. Monoclonal antibody CM39 did not cross-react by ELISA with VLPs from three genogroup I human noroviruses of genotypes 1 to 3 and a GST-fusion protein of the genogroup I/genotype 2 Southampton virus capsid (Table 2). The lack of cross-reactivity correlated with three to six amino acid substitutions in the human norovirus sequences compared with the Jena amino acid sequence. Monoclonal antibody CM39 also did not cross-react with VLPs for four of six genogroup II human noroviruses of genotypes 1, 2, 4, and 7. The lack of cross-reactivity correlated with two to four amino acid substitutions compared to Jena. However, CM39 cross-reacted with VLPs from two genogroup II/genotype 3 human noroviruses, Toronto and RBH viruses, albeit to a lesser extent than with Jena and Newbury2 VLPs. Cross-reactivity occurred with two or three amino acid substitutions and was confirmed by Western blotting for Toronto virus and by ELISA using the GST-RBH capsid fusion protein.

These results showed that the CM39 epitope tolerated certain types of amino acid substitution but retained critical contact residues at the first (P), third (A), fourth (G), eighth (A), and ninth (A) amino acids. The consensus sequence (1PT/VAGA/SQ/P/AI/VAA9; conserved residues are underlined) of the nine-amino-acid epitope for the four cross-reactive capsid proteins had amino acid substitutions that were either small neutral (valine and/or alanine) or small uncharged, polar (proline or serine) residues (Table 2). The capsid proteins from the cross-reactive and unreactive human noroviruses had a valine at the second position in the CM39 epitope, which was unlikely to affect cross-reactivity. Cross-reactivity was abrogated for the human genogroup II human noroviruses if there was a serine substitution at the sixth amino acid or alanine plus at least one additional substitution at the third, seventh, or ninth amino acid in the epitope sequence.


arrow
DISCUSSION
 
The present study showed, for the first time, that the two genotypes of genogroup III noroviruses correspond to two distinct antigenic types, or serotypes, by ELISA with convalescent antisera. However, the two genotypes shared a common epitope located within the NH2-terminal arm of the capsid protein identified by cross-reactivity of the monoclonal antibody CM39 with both Jena and Newbury2. Surprisingly, the CM39 also detected a cross-reactive epitope in some human genogroup II noroviruses.

The correlation between genomic sequence differences and the lack of antigenic cross-reactivity with convalescent antisera supported the phylogenetic subdivision of genotype 1 (Jena) and genotype 2 (Newbury2) bovine noroviruses. This mirrored the situation for the genotypes within genogroup I and II human noroviruses. Human noroviruses were initially demonstrated to be antigenically distinct using immuno-electron microscopy (23, 24, 29). Subsequent studies demonstrated that genotypes were antigenically distinct within the human norovirus genogroups by ELISA using convalescent antisera with VLPs (5, 13, 28). Correlation of genotype with serotype was further endorsed when rabbits were vaccinated with human norovirus VLPs, with which a clear antigenic distinction between norovirus genotypes was demonstrated (20). However, some human convalescent antisera showed cross-reactivity between genotypes (5, 13, 28), which might be the consequence of preexposure to different human norovirus genotypes. The present study demonstrated the advantage of using cattle kept under controlled conditions to prevent preexposure to noroviruses, forming the basis of a norovirus diarrhea model to investigate antigenic relationships and immune responses after infection.

The ability to discriminate between infections caused by the two bovine norovirus serotypes will allow the antibody prevalence of each serotype to be determined in cattle populations. The Newbury2-like viruses (genotype 2) have been the predominant genotype identified to date by RT-PCR in the United Kingdom, The Netherlands, and North America (31, 34, 37-39). The Jena-like genotype (genotype 1) has been rarely detected by RT-PCR in these countries. However, genotype 1 antibodies were ubiquitous in German cattle, with 99.1% of cattle having Jena IgG, and Jena virus was detected by ELISA (11). The results of the present paper will allow studies to be undertaken to establish the antibody prevalences of both serotypes and establish whether there are differences in prevalences in different countries.

To assess the role of both bovine noroviruses in diarrheic cattle, ELISA-based tests are needed that will detect virions of both serotypes and handle large numbers of samples, similar to the tests available for group A rotaviruses (2, 26, 27). Current assays for bovine noroviruses use RT-PCR and are typically based on the polymerase gene, which can detect both genotypes (31, 34, 38, 39). However, handling large numbers of samples by RT-PCR is laborious. In addition, chimeric bovine noroviruses have been identified, leading to the misdiagnosis of capsid type (serotype) using RT-PCR based on polymerase primers (17, 30, 39). The finding that monoclonal antibody CM39 was cross-reactive to both serotypes was promising for the development of a broadly reactive ELISA. Disappointingly, an antigen ELISA could not be developed, as CM39 did not detect Jena virions in fecal samples from experimental calves when used in conjunction with a polyclonal rabbit antiserum to Jena VLPs (unpublished observation), which was used successfully in an ELISA to detect Jena virions in fecal samples (11). In contrast to human genogroup I and II noroviruses, only two genotypes (serotypes) of bovine noroviruses have been detected in the United Kingdom, mainland Europe, and the United States (31, 34, 38, 39). The amino acid identities of the capsid P-domain within each bovine norovirus genotype are high (17, 31, 39), making it likely that viruses within each genotype will be cross-reactive with polyclonal antisera. Thus, until a suitable monoclonal antibody is found, it will be feasible to use ELISAs to each serotype based on polyclonal antisera.

The lack of reactivity of CM39 to native virions in fecal samples might be explained by the location of the epitope at the NH2-terminal domain on the inner surface of the native virions. Despite the hidden nature of the epitope in native virions and VLPs, CM39 showed reactivity by ELISA, Western blotting, and RIPA to in vitro-expressed capsid proteins of the bovine noroviruses. Such reactivity might be explained by the presence of incomplete VLPs seen by electron microscopy, allowing the epitope to be exposed on monomers, dimers, and other macromolecular structures of the capsid protein or, in the case of RIPA and the GST-capsid fusion proteins, linearization of the capsid protein.

The cross-reactivity of CM39 between the two bovine norovirus serotypes suggested that some or all of the amino acids P31 to A35, A38, and A39 in the CM39 epitope were critical contact residues, as there were two amino acids substitutions, Q36->P and I37->V, in the Newbury2 capsid protein. Homology models of the Jena and Newbury2 capsid proteins could explain the nature of the epitope. Amino acids residues 36 and 37 formed part of an {alpha}-helix, which brought residues P31 to A35, A38, and A39 together in a linear conformation that could be retained during ELISA or Western blotting of the Jena and Newbury2 capsid proteins. In addition, the amino acid substitutions did not affect, to any great extent, the predicted solvent accessibility for residues P31 to A35, A38, and A39, as they remained virtually identical for Jena and Newbury2. Thus, the contact between the critical residues for the epitope and the antigen-binding site of the monoclonal antibody CM39 would be retained.

The demonstration, for the first time, of a cross-reactive epitope between human and bovine noroviruses showed that, although the level of reactivity was reduced, up to three amino acid substitutions could be tolerated. This defined the critical contact residues to at least five (P31, A33, G34, A38, and A39) of the nine amino acids in the CM39 epitope. Similar to CM39, monoclonal antibodies 1B4 and 1F6, which were generated to the Mexico-like, genogroup II/genotype 3 human norovirus NV36, both bound a cross-reactive epitope that tolerated up to four amino acid substitutions (41, 42). We predict that 1B4 and 1F6 will bind to bovine noroviruses, because the epitope sequence of NV36 (36QQNIIDPWIMN46) had four amino acid substitutions compared with the sequence (44QVNPIDPWIFA54; the conserved amino acids are underlined) for the capsid proteins of Jena and Newbury2 that were favorable to maintain cross-reactivity. Other monoclonal antibodies also showed cross-reactivity between human norovirus genotypes (8, 16, 18, 21). Such cross-reactive monoclonal antibodies are likely to be an artificial phenomenon, as they have been derived from capsid proteins delivered parenterally with a potent adjuvant. The convalescent antisera from the experimental calves in the present study did not contain significant levels of cross-reactive antibodies between Jena and Newbury2, even though strong cross-reactivity was shown with monoclonal CM39.

Outbreaks of calf diarrhea cause significant economic losses in the United Kingdom (36). Enteropathogens are not found in approximately 30% of calf diarrhea samples, but noroviruses are not routinely tested for (4, 33, 35). Future studies are required to determine whether both bovine noroviruses are prevalent in cattle populations and whether bovine noroviruses contribute significantly to outbreaks of calf diarrhea. The results from the present study will allow these studies to proceed. If both bovine norovirus serotypes are associated with bovine diarrhea, the results from the present study suggest that both will be required in a dam vaccine to achieve passive protection.


arrow
ACKNOWLEDGMENTS
 
This work was supported by Wellcome Trust grant number 0659233.


arrow
FOOTNOTES
 
* Corresponding author. Present address: Department of Pediatrics, Division of Infectious Diseases, Stanford University School of Medicine, Grant Building Room S366, 300 Pasteur Drive, Stanford, CA 94305. Phone: (650) 725-6555. Fax: (650) 725-9828. E-mail: sloliver{at}stanford.edu. Back


arrow
REFERENCES
 
    1
  1. Almeida, J. D., C. R. Craig, and T. E. Hall. 1978. Multiple viruses present in the faeces of a scouring calf. Vet. Rec. 102:170-171.[Medline]
  2. 2
  3. Al Yousif, Y., J. Anderson, C. Chard-Bergstrom, A. Bustamante, M. Muenzenberger, K. Austin, and S. Kapil. 2001. Evaluation of a latex agglutination kit (Virogen Rotatest) for detection of bovine rotavirus in fecal samples. Clin. Diagn. Lab. Immunol. 8:496-498.
  4. 3
  5. Ando, T., J. S. Noel, and R. L. Fankhauser. 2000. Genetic classification of "Norwalk-like viruses." J. Infect. Dis. 181(Suppl. 2):S336-S348.
  6. 4
  7. Andrews, A. H. 2000. Calf enteritis—new information from NADIS. UK Vet. 5:30-34.
  8. 5
  9. Belliot, G., J. S. Noel, J. F. Li, Y. Seto, C. D. Humphrey, T. Ando, R. I. Glass, and S. S. Monroe. 2001. Characterization of capsid genes, expressed in the baculovirus system, of three new genetically distinct strains of "Norwalk-like viruses". J. Clin. Microbiol. 39:4288-4295.[Abstract/Free Full Text]
  10. 6
  11. Bridger, J. C., and J. F. Brown. 1984. Antigenic and pathogenic relationships of three bovine rotaviruses and a porcine rotavirus. J. Gen. Virol. 65:1151-1158.[Abstract/Free Full Text]
  12. 7
  13. Bridger, J. C., G. A. Hall, and J. F. Brown. 1984. Characterization of a calici-like virus (Newbury agent) found in association with astrovirus in bovine diarrhea. Infect. Immun. 43:133-138.[Abstract/Free Full Text]
  14. 8
  15. Brinker, J. P., N. R. Blacklow, M. K. Estes, C. L. Moe, K. J. Schwab, and J. E. Herrmann. 1998. Detection of Norwalk virus and other genogroup 1 human caliciviruses by a monoclonal antibody, recombinant-antigen-based immunoglobulin M capture enzyme immunoassay. J. Clin. Microbiol. 36:1064-1069.[Abstract/Free Full Text]
  16. 9
  17. Dastjerdi, A. M., J. Green, C. I. Gallimore, D. W. Brown, and J. C. Bridger. 1999. The bovine Newbury agent 2 is genetically more closely related to human SRSVs than to animal caliciviruses. Virology 254:1-5.[CrossRef][Medline]
  18. 10
  19. Dastjerdi, A. M., D. R. Snodgrass, and J. C. Bridger. 2000. Characterisation of the bovine enteric calici-like virus, Newbury agent 1. FEMS Microbiol. Lett. 192:125-131.[CrossRef][Medline]
  20. 11
  21. Deng, Y., C. A. Batten, B. L. Liu, P. R. Lambden, M. Elschner, H. Gunther, P. Otto, P. Schnurch, W. Eichhorn, W. Herbst, and I. N. Clarke. 2003. Studies of epidemiology and seroprevalence of bovine noroviruses in Germany. J. Clin. Microbiol. 41:2300-2305.[Abstract/Free Full Text]
  22. 12
  23. Dingle, K. E., P. R. Lambden, E. O. Caul, and I. N. Clarke. 1995. Human enteric Caliciviridae: the complete genome sequence and expression of virus-like particles from a genetic group II small round structured virus. J. Gen. Virol. 76:2349-2355.[Abstract/Free Full Text]
  24. 13
  25. Farkas, T., S. A. Thornton, N. Wilton, W. Zhong, M. Altaye, and X. Jiang. 2003. Homologous versus heterologous immune responses to Norwalk-like viruses among crew members after acute gastroenteritis outbreaks on 2 US Navy vessels. J. Infect. Dis. 187:187-193.[CrossRef][Medline]
  26. 14
  27. Günther, H., and P. Otto. 1987. Diarrhea in young calves. 7. "Zackenvirus" (Jena agent 117/80)—a new diarrhea pathogen in calves. Arch. Exp. Veterinarmed. 41:934-938.[Medline]
  28. 15
  29. Günther, H., P. Otto, and P. Heilmann. 1984. Diarrhea in young calves. 6. Determination of the pathogenicity of a bovine coronavirus and an unidentified icosahedral virus. Arch. Exp. Veterinarmed. 38:781-792.[Medline]
  30. 16
  31. Hale, A. D., T. N. Tanaka, N. Kitamoto, M. Ciarlet, X. Jiang, N. Takeda, D. W. Brown, and M. K. Estes. 2000. Identification of an epitope common to genogroup 1 "Norwalk-like viruses." J. Clin. Microbiol. 38:1656-1660.[Abstract/Free Full Text]
  32. 17
  33. Han, M. G., J. R. Smiley, C. Thomas, and L. J. Saif. 2004. Genetic recombination between two genotypes of genogroup III bovine noroviruses (BoNVs) and capsid sequence diversity among BoNVs and Nebraska-like bovine enteric caliciviruses. J. Clin. Microbiol. 42:5214-5224.[Abstract/Free Full Text]
  34. 18
  35. Herrmann, J. E., N. R. Blacklow, S. M. Matsui, T. L. Lewis, M. K. Estes, J. M. Ball, and J. P. Brinker. 1995. Monoclonal antibodies for detection of Norwalk virus antigen in stools. J. Clin. Microbiol. 33:2511-2513.[Abstract]
  36. 19
  37. Humphrey, W., A. Dalke, and K. Schulten. 1996. VMD: visual molecular dynamics. J. Mol. Graph. 14:33-38.[CrossRef][Medline]
  38. 20
  39. Jiang, X., W. M. Zhong, T. Farkas, P. W. Huang, N. Wilton, E. Barrett, D. Fulton, R. Morrow, and D. O. Matson. 2002. Baculovirus expression and antigenic characterization of the capsid proteins of three Norwalk-like viruses. Arch. Virol. 147:119-130.[CrossRef][Medline]
  40. 21
  41. Kitamoto, N., T. Tanaka, K. Natori, N. Takeda, S. Nakata, X. Jiang, and M. K. Estes. 2002. Cross-reactivity among several recombinant calicivirus virus-like particles (VLPs) with monoclonal antibodies obtained from mice immunized orally with one type of VLP. J. Clin. Microbiol. 40:2459-2465.[Abstract/Free Full Text]
  42. 22
  43. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.[CrossRef][Medline]
  44. 23
  45. Lewis, D. C. 1990. Three serotypes of Norwalk-like virus demonstrated by solid-phase immune electron microscopy. J. Med. Virol. 30:77-81.[Medline]
  46. 24
  47. Lin, Y. P., K. Nicholas, F. R. Ball, B. McLaughlin, and F. R. Bishai. 1991. Detection of Norwalk-like virus and specific antibody by immune-electron microscopy with colloidal gold immune complexes. J. Virol. Methods 35:237-253.[CrossRef][Medline]
  48. 25
  49. Liu, B. L., P. R. Lambden, H. Gunther, P. Otto, M. Elschner, and I. N. Clarke. 1999. Molecular characterization of a bovine enteric calicivirus: relationship to the Norwalk-like viruses. J. Virol. 73:819-825.[Abstract/Free Full Text]
  50. 26
  51. Lucchelli, A., S. Y. Kang, M. K. Jayasekera, A. V. Parwani, D. H. Zeman, and L. J. Saif. 1994. A survey of G6 and G10 serotypes of group A bovine rotaviruses from diarrheic beef and dairy calves using monoclonal antibodies in ELISA. J. Vet. Diagn. Investig. 6:175-181.[Abstract/Free Full Text]
  52. 27
  53. Maes, R. K., D. L. Grooms, A. G. Wise, C. Han, V. Ciesicki, L. Hanson, M. L. Vickers, C. Kanitz, and R. Holland. 2003. Evaluation of a human group a rotavirus assay for on-site detection of bovine rotavirus. J. Clin. Microbiol. 41:290-294.[Abstract/Free Full Text]
  54. 28
  55. Noel, J. S., T. Ando, J. P. Leite, K. Y. Green, K. E. Dingle, M. K. Estes, Y. Seto, S. S. Monroe, and R. I. Glass. 1997. Correlation of patient immune responses with genetically characterized small round-structured viruses involved in outbreaks of nonbacterial acute gastroenteritis in the United States, 1990 to 1995. J. Med. Virol. 53:372-383.[CrossRef][Medline]
  56. 29
  57. Okada, S., S. Sekine, T. Ando, Y. Hayashi, M. Murao, K. Yabuuchi, T. Miki, and M. Ohashi. 1990. Antigenic characterization of small, round-structured viruses by immune electron microscopy. J. Clin. Microbiol. 28:1244-1248.[Abstract/Free Full Text]
  58. 30
  59. Oliver, S. L., D. W. Brown, J. Green, and J. C. Bridger. 2004. A chimeric bovine enteric calicivirus: evidence for genomic recombination in genogroup III of the Norovirus genus of the Caliciviridae. Virology 326:231-239.[CrossRef][Medline]
  60. 31
  61. Oliver, S. L., A. M. Dastjerdi, S. Wong, L. El Attar, C. Gallimore, D. W. Brown, J. Green, and J. C. Bridger. 2003. Molecular characterization of bovine enteric caliciviruses: a distinct third genogroup of noroviruses (Norwalk-like viruses) unlikely to be of risk to humans. J. Virol. 77:2789-2798.[Abstract/Free Full Text]
  62. 32
  63. Pelosi, E., P. R. Lambden, E. O. Caul, B. Liu, K. Dingle, Y. Deng, and I. N. Clarke. 1999. The seroepidemiology of genogroup 1 and genogroup 2 Norwalk-like viruses in Italy. J. Med. Virol. 58:93-99.[CrossRef][Medline]
  64. 33
  65. Reynolds, D. J., J. H. Morgan, N. Chanter, P. W. Jones, J. C. Bridger, T. G. Debney, and K. J. Bunch. 1986. Microbiology of calf diarrhoea in southern Britain. Vet. Rec. 119:34-39.[Abstract]
  66. 34
  67. Smiley, J. R., A. E. Hoet, M. Traven, H. Tsunemitsu, and L. J. Saif. 2003. Reverse transcription-PCR assays for detection of bovine enteric caliciviruses (BEC) and analysis of the genetic relationships among BEC and human caliciviruses. J. Clin. Microbiol. 41:3089-3099.[Abstract/Free Full Text]
  68. 35
  69. Snodgrass, D. R., H. R. Terzolo, D. Sherwood, I. Campbell, J. D. Menzies, and B. A. Synge. 1986. Aetiology of diarrhoea in young calves. Vet. Rec. 119:31-34.[Abstract]
  70. 36
  71. Stott, A. W., and G. Gunn. 1995. The costs of bovine enteritis in suckled calves. Scottish Agric. Econ. Rev. 1995:83-88.
  72. 37
  73. van der Poel, W. H., H. R. van der, F. Verschoor, H. Gelderblom, J. Vinje, and M. P. Koopmans. 2003. Epidemiology of Norwalk-like virus infections in cattle in The Netherlands. Vet. Microbiol. 92:297-309.[CrossRef][Medline]
  74. 38
  75. van der Poel, W. H., J. Vinje, H. R. van der, M. I. Herrera, A. Vivo, and M. P. Koopmans. 2000. Norwalk-like calicivirus genes in farm animals. Emerg. Infect. Dis. 6:36-41.[Medline]
  76. 39
  77. Wise, A. G., S. S. Monroe, L. E. Hanson, D. L. Grooms, D. Sockett, and R. K. Maes. 2004. Molecular characterization of noroviruses detected in diarrheic stools of Michigan and Wisconsin dairy calves: circulation of two distinct subgroups. Virus Res. 100:165-177.[CrossRef][Medline]
  78. 40
  79. Woode, G. N., and J. C. Bridger. 1978. Isolation of small viruses resembling astroviruses and caliciviruses from acute enteritis of calves. J. Med. Microbiol. 11:441-452.[Abstract/Free Full Text]
  80. 41
  81. Yoda, T., Y. Suzuki, Y. Terano, K. Yamazaki, N. Sakon, T. Kuzuguchi, H. Oda, and T. Tsukamoto. 2003. Precise characterization of norovirus (Norwalk-like virus)-specific monoclonal antibodies with broad reactivity. J. Clin. Microbiol. 41:2367-2371.[Abstract/Free Full Text]
  82. 42
  83. Yoda, T., Y. Terano, Y. Suzuki, K. Yamazaki, I. Oishi, E. Utagawa, A. Shimada, S. Matsuura, M. Nakajima, and T. Shibata. 2000. Characterization of monoclonal antibodies generated against Norwalk virus GII capsid protein expressed in Escherichia coli. Microbiol. Immunol. 44:905-914.[Medline]


Journal of Clinical Microbiology, March 2006, p. 992-998, Vol. 44, No. 3
0095-1137/06/$08.00+0     doi:10.1128/JCM.44.3.992-998.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Reuter, G., Pankovics, P., Egyed, L. (2009). Detection of genotype 1 and 2 bovine noroviruses in Hungary. Vet Rec. 165: 537-538 [Full Text]  
  • Almanza, H., Cubillos, C., Angulo, I., Mateos, F., Caston, J. R., van der Poel, W. H. M., Vinje, J., Barcena, J., Mena, I. (2008). Self-Assembly of the Recombinant Capsid Protein of a Swine Norovirus into Virus-Like Particles and Evaluation of Monoclonal Antibodies Cross-Reactive with a Human Strain from Genogroup II. J. Clin. Microbiol. 46: 3971-3979 [Abstract] [Full Text]  
  • Bull, R. A., Tanaka, M. M., White, P. A. (2007). Norovirus recombination. J. Gen. Virol. 88: 3347-3359 [Abstract] [Full Text]  
  • Shiota, T., Okame, M., Takanashi, S., Khamrin, P., Takagi, M., Satou, K., Masuoka, Y., Yagyu, F., Shimizu, Y., Kohno, H., Mizuguchi, M., Okitsu, S., Ushijima, H. (2007). Characterization of a Broadly Reactive Monoclonal Antibody against Norovirus Genogroups I and II: Recognition of a Novel Conformational Epitope. J. Virol. 81: 12298-12306 [Abstract] [Full Text]  
  • Oliver, S. L., Wood, E., Asobayire, E., Wathes, D. C., Brickell, J. S., Elschner, M., Otto, P., Lambden, P. R., Clarke, I. N., Bridger, J. C. (2007). Serotype 1 and 2 Bovine Noroviruses Are Endemic in Cattle in the United Kingdom and Germany. J. Clin. Microbiol. 45: 3050-3052 [Abstract] [Full Text]  
  • Ward, V. K., McCormick, C. J., Clarke, I. N., Salim, O., Wobus, C. E., Thackray, L. B., Virgin, H. W. IV, Lambden, P. R. (2007). Recovery of infectious murine norovirus using pol II-driven expression of full-length cDNA. Proc. Natl. Acad. Sci. USA 104: 11050-11055 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oliver, S. L.
Right arrow Articles by Lambden, P. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oliver, S. L.
Right arrow Articles by Lambden, P. R.