Previous Article | Next Article ![]()
Journal of Clinical Microbiology, March 2006, p. 992-998, Vol. 44, No. 3
0095-1137/06/$08.00+0 doi:10.1128/JCM.44.3.992-998.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Department of Pathology and Infectious Diseases, Royal Veterinary College, 4 Royal College Street, Camden, London, NW1 0TU, United Kingdom,1 Molecular Microbiology Group, University Medical School, Southampton General Hospital, Southampton SO16 6YD, United Kingdom,2 Friedrich-Loeffler-Institute, Federal Research Institute for Animal Health, Institute of Bacterial Infections and Zoonoses, Naumburger Strasse 96a, 07743 Jena, Germany,3 Unité Mixte de Recherche, CNRS 2472-INRA 1157, Virologie Moléculaire et Stucturale, 1 avenue de la Terrasse, 91198 Gif-sur-Yvette, France4
Received 30 September 2005/ Returned for modification 2 December 2005/ Accepted 23 December 2005
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
There were clear differences between the genomes of Jena and Newbury2. Analysis of the polymerase, capsid, and ORF3 genes placed each virus in a different genetic cluster or genotype with only 68% amino acid identity in their complete capsid proteins. Further isolates of the genotype 1 (Jena) or genotype 2 (Newbury2) bovine noroviruses have been identified from the United Kingdom, The Netherlands, and United States (30, 31, 34, 37, 39), confirming the existence of the two distinct genotypes. Viruses within a genotype had 91 to 99% amino acid identity in their complete capsid proteins (17, 30, 31, 34). The majority of the amino acid variation was in the protruding or P-domains of the capsid proteins. This raised the question of the antigenic relatedness between the two bovine norovirus genotypes and whether serological methods that detect one would detect the other.
Reverse transcription-PCR (RT-PCR), based on the polymerase gene, has been used as the predominant diagnostic method for bovine noroviruses (30, 34, 37, 39). This led to their recognition and highlighted the need to determine the exact role of bovine noroviruses in the calf diarrhea syndrome. The capsid genes of genotype 1 viruses have been identified less commonly than the genotype 2 viruses (17, 30, 31, 34, 39). Of the 26 complete capsid genes currently available for bovine noroviruses from GenBank, only 5 were genotype 1, with the remaining 21 genotype 2. Data are required on the prevalence of bovine noroviruses in cattle populations, the prevalence of the two genotypes, and the role of both in disease. To date, only two genotypes have been identified in genogroup III bovine noroviruses.
The prevalence of genotype 1 and 2 bovine noroviruses is most easily studied using serological methods to detect antigen and antibody. Serological methods for the Jena virus have been developed based on recombinant virus-like particles (VLPs) used as antigen to detect serum immunoglobulin G (IgG) or used to generate polyclonal antisera to detect virus antigen by enzyme-linked immunosorbent assay (ELISA) (11). More recently, serological methods were also developed for the Newbury2 virus (S. L. Oliver, E. Asobayire, A. Charpilliene, J. Cohen, and J. C. Bridger, submitted for publication). However, the considerable differences in the predicted amino acid compositions of the capsid proteins of genotype 1 and 2 bovine noroviruses suggested that serologically based tests would not detect both genotypes and their antibodies, but this remained to be proven.
Using two approaches, the present study determined the antigenic relationship of the two bovine norovirus genotypes to enable the development of tests to detect and differentiate both genotypes. First, to establish whether genotype 1 and 2 bovine noroviruses represent two serotypes, the cross-reactivities of convalescent antisera from calves experimentally infected with either Jena, Newbury2, or the Newbury2-like virus Dumfries were examined by ELISA using recombinant VLPs generated from Jena and Newbury2. Second, the cross-reactivity of a monoclonal antibody derived using Jena VLPs was determined with the ultimate aim to develop a cross-reactive ELISA specific for genogroup III bovine noroviruses.
| MATERIALS AND METHODS |
|---|
|
|
|---|
21% amino acid identity in its complete capsid protein with Jena and Newbury2 (S. L. Oliver, E. Asobayire, A. M. Dastjerdi, and J. C. Bridger, submitted for publication). Production of VLPs and GST-capsid fusion proteins from bovine and human noroviruses. Jena and Newbury2 VLPs were prepared as described elsewhere (11; Oliver, Asobayire, Charpilliene, et al., submitted). VLPs for the genogroup I human norovirus Hu/Southampton/1991/UK and the genogroup II human noroviruses Hu/RBH/1993/UK, Hu/Lordsdale/1993/UK, and Hu/Leeds/1990/UK were prepared as previously described (12, 32). VLPs for the following human noroviruses were gifts: Hu/Norwalk/1968/US (Mary Estes, Baylor College of Medicine, Texas), Hu/Hawaii/1971/US, Hu/SnowMountain/1976/US, and Hu/DesertShield395/1990/SA (Kim Green, NIH, Maryland), and Hu/Toronto/1991/CAN (Stephan Monroe, CDC, Georgia). Glutathione S-transferase (GST)-capsid fusion proteins were generated from the capsid genes for the genogroup III bovine norovirus Jena and the genogroup I human noroviruses Southampton, Norwalk, and Desert Shield plus the genogroup II human noroviruses Hawaii, Snow Mountain, Toronto, RBH, Lordsdale, and Leeds. These were cloned into the pGex 4T1 vector (Amersham Biosciences UK Ltd., United Kingdom) and used to transform Escherichia coli. Protein synthesis was induced by isopropyl-ß-D-thiogalactopyranoside (100 mM), and the cultures were incubated overnight at 25°C. The majority of the protein was expressed as inclusion bodies, as determined by electron microscopy. GST-capsid fusion proteins were purified from the inclusion bodies using Bugbuster (Novagen, Merck Biosciences Ltd., United Kingdom) following the manufacturer's instructions.
Detection of bovine norovirus IgG by ELISA. Maxisorb plates (Nunc) were coated with 5 µg/ml of VLP antigen in carbonate buffer, pH 9.6, overnight at 4°C. Antigens used were CsCl-purified Jena and Newbury2 VLPs plus supernatants from wild-type baculovirus-infected Sf9 cells (mock antigen). Plates were blocked with 2% nonfat dried skimmed milk in phosphate-buffered saline (PBS) and washed with PBST (PBS plus 0.05% Tween 20 [Sigma-Aldrich Company Ltd., United Kingdom]) between each step. Antisera from the experimental calves were diluted from 1:50 in twofold dilution series in 1% nonfat dried skimmed milk in PBST, dispensed into wells previously coated with VLPs or mock antigen, and incubated at room temperature for 1 h. After washing, a 1:10,000 dilution of rabbit anti-bovine IgG-horseradish peroxidase conjugate (Sigma-Aldrich Company Ltd., United Kingdom) in PBST plus 1% nonfat dried skimmed milk was added and incubated for 1 h at room temperature. Peroxidase activity was detected using 3,3',5,5'-tetramethylbenzidine as substrate (Sigma-Aldrich Company Ltd., United Kingdom), and the absorbance was measured at 450 nm. Serum titers were calculated by linear regression using Prism 4 (GraphPad Software). Cutoff values were determined as twice the mean net absorbance value at 450 nm (absorbance with test antigen minus absorbance with mock antigen at each dilution) of the wells without the test serum.
Production of monoclonal antibodies to Jena VLPs. Prior to immunization with Jena VLPs, BALB/c mice were shown not to have preexisting antibodies to the Jena capsid protein by ELISA, Western blotting, and radioimmunoprecipitation assay (RIPA). Mice were primed intraperitoneally with 50 µg of purified Jena VLPs in Freund's complete adjuvant followed by two intraperitoneal injections of Jena VLPs in Freund's incomplete adjuvant at 14-day intervals. A final intravenous injection of Jena VLPs was administered 3 days prior to hybridoma production. Spleen cells isolated from the mice were fused in polyethylene glycol 4000 (Gibco BRL, United Kingdom) to BALB/c P3-NS-1 plasmacytoma cells. Hybrid cells were seeded into 96-well trays containing peritoneal macrophages from CD-1 mice in hypoxanthine-aminopterin-thymidine medium (RPMI 1640, 20% fetal bovine serum, 1% 200 mM L-glutamine, 1% sodium pyruvate, 0.2% gentamicin, 2% hypoxanthine-aminopterin-thymidine [50x], 1% penicillin-streptomycin). Cell culture supernatants from hybridomas that showed reactivity to Jena VLPs by ELISA were cloned by terminal dilution, and their supernatants were harvested for further analysis.
Specificity by ELISA of the monoclonal antibody CM39 to bovine and human norovirus VLPs and GST-fusion capsid proteins. Polyvinyl 96-well plates (INC Labs) were coated with VLPs or GST-fusion proteins in carbonate buffer, pH 9.6, at 2 µg/ml. Plates were incubated overnight in a humid environment at 4°C. Plates were washed with PBST between each step. Plates were blocked with 5% nonfat dried skimmed milk in PBS for 30 min at 37°C, and then a 1:5 dilution of the hybridoma supernatant containing the monoclonal antibody CM39 in PBST plus 1% nonfat dried skimmed milk was added and incubated for 90 min at 37°C. A 1:3,000 dilution of goat anti-mouse polyvalent antibody conjugated to horseradish peroxidase (Sigma-Aldrich Company Ltd., United Kingdom) diluted in PBS plus 1% nonfat dried skimmed milk was added to the plates and incubated for a further 90 min at 37°C. Peroxidase activity was detected using 0.1% sodium acetate (pH 6.0)-0.1% tetramethylbenzidine-0.01% H2O2, and the absorbance was measured at 450 nm.
SDS-PAGE and immunostaining of capsid proteins. The bovine and human norovirus capsid proteins expressed in vitro as VLPs or GST-fusion proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using 12.5% polyacrylamide gels with the discontinuous buffer method (22). Capsid proteins were electroblotted to nitrocellulose membranes in transfer buffer (Tris-HCl, 25 mM; glycine, 192 mM; SDS, 0.1%; methanol, 20%) using a Trans-Blot SD semidry blotter (Bio-Rad Laboratories Ltd., United Kingdom). Membranes were incubated at 37°C in blocking solution of TBS (NaCl, 0.5 M; Tris-HCl, 20 mM [pH 7.5]) containing 0.05% Tween 20 plus 5% skimmed milk powder. Subsequent incubations were performed at room temperature. Membranes were washed twice with blocking solution and once with TBS and then incubated for 16 h with the hybridoma supernatant of CM39 monoclonal antibody diluted 1:20 in blocking solution containing 10% normal goat serum. After washing, membranes were incubated with a 1:1,000 dilution of goat anti-mouse IgG conjugated to alkaline phosphatase (Sigma-Aldrich Company Ltd., United Kingdom). Alkaline phosphatase activity was detected using a bromo-chloro-indolyl-phosphate-nitroblue tetrazolium salt (Sigma-Aldrich Company Ltd., United Kingdom).
In vitro transcription and translation of complete and partial Jena capsid proteins. The complete Jena capsid protein plus four C-terminal-truncated capsid fragments were used to locate the region where the CM39 monoclonal antibody bound. The template used for in vitro transcription of the complete capsid protein was a full-length capsid gene cloned into pRSETA (Invitrogen Ltd., United Kingdom). PCR amplicons derived from this construct were used for the four fragments, F1 to F4, of the capsid protein. The forward primer (5'-GATCTCGATCCCGCGAAATT-3') was located in the pRSETA vector sequence just upstream of the T7 promoter region. The antisense primers used to generate the four fragments were JVF3R (5'-TTA5871GAGTGGTTCCAAGCAAATCG5851-3'), JVF4R (5'-TTA5759ATTGGTGAGACTGTAAACTGG5738-3'), JVF5R (5'-TTA5670AATCAGGGCTTGGACAGGTT5650-3'), and JVF6R (5'-TTA5500GCACGGACATCCATTATCAC5480-3'). The nucleotide coordinates for the oligonucleotides are from the full-length genomic sequence of the Jena virus with the premature termination codon at the 5' end of each oligonucleotide. In vitro translation was performed with 0.1 µg to 1 µg of purified DNA (Genelute Miniprep or Midiprep; Sigma) using a T7 RNA polymerase-coupled rabbit reticulocyte lysate system (TNT; Promega, United Kingdom) following the manufacturer's instructions for reaction volumes of 50 µl containing [35S]methionine. The reaction mixtures were incubated for 2 h at 30°C and then separated by SDS-PAGE. The gels were placed in salicylate solution (1 M sodium salicylate, 50% methanol) for 30 min at room temperature to enhance the signal obtained by autoradiography. Gels dried under vacuum onto chromatography paper were exposed to Kodak XAR-5 film overnight at 70°C in an autoradiography cassette prior to development of the film.
RIPA. In vitro transcription-translation reaction mixtures plus undiluted antisera or the CM39 monoclonal antibody in RIPA buffer (10 mM Tris-HCl [pH 7.5], 1 mM EDTA, 0.15 mM NaCl, 0.1% SDS, 0.5% Empigen BB [N-dodecyl-N,N-dimethylglycine], 0.1 mM phenylmethylsulfonyl fluoride) were incubated for 1 h at 37°C. To adsorb immune complexes, goat anti-mouse IgG attached to agarose beads (Sigma-Aldrich Company Ltd., United Kingdom) was added to the reaction mixtures and then incubated for 2 h at room temperature. The beads were washed three times in RIPA buffer and once in PBS. Immune complexes were solubilized with sample dissociating buffer and then separated by SDS-PAGE, and the gels were prepared for autoradiography as described previously.
Epitope analysis. To map the epitope recognized by the monoclonal antibody CM39, a solid-phase peptide array consisting of 48 overlapping dodecapeptides offset by three amino acids was synthesized commercially on a series of solid-phase pegs (Mimotopes Ltd., UK). The peptides spanned 153 amino acids for the NH2-terminal region of the Jena capsid protein. Epitope analysis was performed in accordance with the manufacturer's protocol. Peptides in a 96-well polyvinyl plate were submerged with precoat buffer (2% bovine serum albumin, 0.1% Tween 20, and 0.1% sodium azide in PBS) for 1 h at room temperature and then incubated overnight at 4°C with the CM39 hybridoma supernatant diluted 1:5 in precoat buffer. The peptides were washed with PBS between each step. A goat anti-mouse polyvalent antibody conjugated to horseradish peroxidase (Sigma-Aldrich Company Ltd., United Kingdom) diluted to 1:3,000 in PBS containing 1% normal goat serum, 0.1% Tween 20, and 0.1% sodium caseinate was added, and then the mixture was incubated for 1 h at room temperature. Peroxidase activity was detected using 0.05% 2,2'-azinobis(3-ethylbenzthiazolinesulfonic acid) dissolved in substrate buffer (0.1 M Na2HPO4, 0.08 M citric acid, pH 4.0, and 0.01% H2O2), and the absorbance was measured at 405 nm.
Molecular modeling. A homology model of the Newbury2 capsid protein was generated using the Swiss-Model server (http://swissmodel.expasy.org/). Coordinates for the quaternary structure of the five-fold axis of symmetry for the X-ray crystallography structure of Norwalk virus (PDB accession number 1ihm) were obtained from the Macromolecular Structure Database (http://pqs.ebi.ac.uk/). To show the location of the Jena epitope sequence (31PTAGAQIAA39) in the monomer of the Newbury2 capsid protein (epitope sequence 31PTAGAPVAA39 for the Newbury2 capsid protein) and the five-fold axis of symmetry of the Norwalk virus, image files were generated using the software program VMD 1.8.2 (19). Pov-ray for Windows was used to generate ray traced images for all of the structures. An amino acid alignment of the Norwalk and Newbury2 capsid proteins showed that the Norwalk virus sequence 35PVAGSSTAV43 was equivalent to the 31PTAGAPVAA39 sequence of Newbury2. The domains of the Newbury2 capsid protein equivalent to those of Norwalk virus were taken as amino acids 1 to 45 for the NH2-terminal domain, 46 to 218 for the S domain, 219 to 272 and 396 to 522 for the P1 domain, and 273 to 395 for the P2 domain.
| RESULTS |
|---|
|
|
|---|
= 0.0) and 3.3 (
= 0.9), over 1,000-fold higher than those with the heterologous antigens. Preinoculation sera from calves inoculated with Jena and Newbury2 and antisera from calves infected with Newbury1 and the bovine rotavirus strain UK showed no reactivity with either antigen (log10 < 1.7). The lack of cross-reactivity between the two genotypes was confirmed with antiserum to the Newbury2-like virus Bo/Dumfries/1994/UK.
|
|
|
|
P and I37
V, yet cross-reacted in the ELISA and Western blot assay, suggesting that amino acids P36 and V37 were not critical contact residues within the antibody-binding site. This might be explained by the linear conformation formed by residues P31 to A35, A38, and A39 of the CM39 epitope (Fig. 4B). In addition, the predicted solvent accessibility of these residues was virtually identical for Jena and Newbury2 (not shown). A macromolecular model of the five-fold axis of symmetry for the Norwalk virus showed that the epitope would be located on the inside of the virion (Fig. 4C and D). The presence of partly formed VLPs, often seen by electron microscopy (data not shown), explained the reactivity of the monoclonal antibody CM39 with VLPs.
|
|
These results showed that the CM39 epitope tolerated certain types of amino acid substitution but retained critical contact residues at the first (P), third (A), fourth (G), eighth (A), and ninth (A) amino acids. The consensus sequence (1PT/VAGA/SQ/P/AI/VAA9; conserved residues are underlined) of the nine-amino-acid epitope for the four cross-reactive capsid proteins had amino acid substitutions that were either small neutral (valine and/or alanine) or small uncharged, polar (proline or serine) residues (Table 2). The capsid proteins from the cross-reactive and unreactive human noroviruses had a valine at the second position in the CM39 epitope, which was unlikely to affect cross-reactivity. Cross-reactivity was abrogated for the human genogroup II human noroviruses if there was a serine substitution at the sixth amino acid or alanine plus at least one additional substitution at the third, seventh, or ninth amino acid in the epitope sequence.
| DISCUSSION |
|---|
|
|
|---|
The correlation between genomic sequence differences and the lack of antigenic cross-reactivity with convalescent antisera supported the phylogenetic subdivision of genotype 1 (Jena) and genotype 2 (Newbury2) bovine noroviruses. This mirrored the situation for the genotypes within genogroup I and II human noroviruses. Human noroviruses were initially demonstrated to be antigenically distinct using immuno-electron microscopy (23, 24, 29). Subsequent studies demonstrated that genotypes were antigenically distinct within the human norovirus genogroups by ELISA using convalescent antisera with VLPs (5, 13, 28). Correlation of genotype with serotype was further endorsed when rabbits were vaccinated with human norovirus VLPs, with which a clear antigenic distinction between norovirus genotypes was demonstrated (20). However, some human convalescent antisera showed cross-reactivity between genotypes (5, 13, 28), which might be the consequence of preexposure to different human norovirus genotypes. The present study demonstrated the advantage of using cattle kept under controlled conditions to prevent preexposure to noroviruses, forming the basis of a norovirus diarrhea model to investigate antigenic relationships and immune responses after infection.
The ability to discriminate between infections caused by the two bovine norovirus serotypes will allow the antibody prevalence of each serotype to be determined in cattle populations. The Newbury2-like viruses (genotype 2) have been the predominant genotype identified to date by RT-PCR in the United Kingdom, The Netherlands, and North America (31, 34, 37-39). The Jena-like genotype (genotype 1) has been rarely detected by RT-PCR in these countries. However, genotype 1 antibodies were ubiquitous in German cattle, with 99.1% of cattle having Jena IgG, and Jena virus was detected by ELISA (11). The results of the present paper will allow studies to be undertaken to establish the antibody prevalences of both serotypes and establish whether there are differences in prevalences in different countries.
To assess the role of both bovine noroviruses in diarrheic cattle, ELISA-based tests are needed that will detect virions of both serotypes and handle large numbers of samples, similar to the tests available for group A rotaviruses (2, 26, 27). Current assays for bovine noroviruses use RT-PCR and are typically based on the polymerase gene, which can detect both genotypes (31, 34, 38, 39). However, handling large numbers of samples by RT-PCR is laborious. In addition, chimeric bovine noroviruses have been identified, leading to the misdiagnosis of capsid type (serotype) using RT-PCR based on polymerase primers (17, 30, 39). The finding that monoclonal antibody CM39 was cross-reactive to both serotypes was promising for the development of a broadly reactive ELISA. Disappointingly, an antigen ELISA could not be developed, as CM39 did not detect Jena virions in fecal samples from experimental calves when used in conjunction with a polyclonal rabbit antiserum to Jena VLPs (unpublished observation), which was used successfully in an ELISA to detect Jena virions in fecal samples (11). In contrast to human genogroup I and II noroviruses, only two genotypes (serotypes) of bovine noroviruses have been detected in the United Kingdom, mainland Europe, and the United States (31, 34, 38, 39). The amino acid identities of the capsid P-domain within each bovine norovirus genotype are high (17, 31, 39), making it likely that viruses within each genotype will be cross-reactive with polyclonal antisera. Thus, until a suitable monoclonal antibody is found, it will be feasible to use ELISAs to each serotype based on polyclonal antisera.
The lack of reactivity of CM39 to native virions in fecal samples might be explained by the location of the epitope at the NH2-terminal domain on the inner surface of the native virions. Despite the hidden nature of the epitope in native virions and VLPs, CM39 showed reactivity by ELISA, Western blotting, and RIPA to in vitro-expressed capsid proteins of the bovine noroviruses. Such reactivity might be explained by the presence of incomplete VLPs seen by electron microscopy, allowing the epitope to be exposed on monomers, dimers, and other macromolecular structures of the capsid protein or, in the case of RIPA and the GST-capsid fusion proteins, linearization of the capsid protein.
The cross-reactivity of CM39 between the two bovine norovirus serotypes suggested that some or all of the amino acids P31 to A35, A38, and A39 in the CM39 epitope were critical contact residues, as there were two amino acids substitutions, Q36
P and I37
V, in the Newbury2 capsid protein. Homology models of the Jena and Newbury2 capsid proteins could explain the nature of the epitope. Amino acids residues 36 and 37 formed part of an
-helix, which brought residues P31 to A35, A38, and A39 together in a linear conformation that could be retained during ELISA or Western blotting of the Jena and Newbury2 capsid proteins. In addition, the amino acid substitutions did not affect, to any great extent, the predicted solvent accessibility for residues P31 to A35, A38, and A39, as they remained virtually identical for Jena and Newbury2. Thus, the contact between the critical residues for the epitope and the antigen-binding site of the monoclonal antibody CM39 would be retained.
The demonstration, for the first time, of a cross-reactive epitope between human and bovine noroviruses showed that, although the level of reactivity was reduced, up to three amino acid substitutions could be tolerated. This defined the critical contact residues to at least five (P31, A33, G34, A38, and A39) of the nine amino acids in the CM39 epitope. Similar to CM39, monoclonal antibodies 1B4 and 1F6, which were generated to the Mexico-like, genogroup II/genotype 3 human norovirus NV36, both bound a cross-reactive epitope that tolerated up to four amino acid substitutions (41, 42). We predict that 1B4 and 1F6 will bind to bovine noroviruses, because the epitope sequence of NV36 (36QQNIIDPWIMN46) had four amino acid substitutions compared with the sequence (44QVNPIDPWIFA54; the conserved amino acids are underlined) for the capsid proteins of Jena and Newbury2 that were favorable to maintain cross-reactivity. Other monoclonal antibodies also showed cross-reactivity between human norovirus genotypes (8, 16, 18, 21). Such cross-reactive monoclonal antibodies are likely to be an artificial phenomenon, as they have been derived from capsid proteins delivered parenterally with a potent adjuvant. The convalescent antisera from the experimental calves in the present study did not contain significant levels of cross-reactive antibodies between Jena and Newbury2, even though strong cross-reactivity was shown with monoclonal CM39.
Outbreaks of calf diarrhea cause significant economic losses in the United Kingdom (36). Enteropathogens are not found in approximately 30% of calf diarrhea samples, but noroviruses are not routinely tested for (4, 33, 35). Future studies are required to determine whether both bovine noroviruses are prevalent in cattle populations and whether bovine noroviruses contribute significantly to outbreaks of calf diarrhea. The results from the present study will allow these studies to proceed. If both bovine norovirus serotypes are associated with bovine diarrhea, the results from the present study suggest that both will be required in a dam vaccine to achieve passive protection.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Antimicrob. Agents Chemother. | Clin. Microbiol. Rev. |
|---|---|
| Clin. Vaccine Immunol. | ALL ASM JOURNALS |
|---|