JCM Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ruiz-Garbajosa, P.
Right arrow Articles by Willems, R. J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ruiz-Garbajosa, P.
Right arrow Articles by Willems, R. J. L.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, June 2006, p. 2220-2228, Vol. 44, No. 6
0095-1137/06/$08.00+0     doi:10.1128/JCM.02596-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Multilocus Sequence Typing Scheme for Enterococcus faecalis Reveals Hospital-Adapted Genetic Complexes in a Background of High Rates of Recombination

Patricia Ruiz-Garbajosa,1* Marc J. M. Bonten,2,3 D. Ashley Robinson,4 Janetta Top,2,3 Sreedhar R. Nallapareddy,5 Carmen Torres,6 Teresa M. Coque,1 Rafael Cantón,1 Fernando Baquero,1 Barbara E. Murray,5 Rosa del Campo,1 and Rob J. L. Willems2,3

Servicio de Microbiología, Hospital Universitario Ramón y Cajal, Madrid, Spain,1 Eijkman-Winkler Institute for Microbiology, Infectious Diseases and Inflammation,2 Division of Acute Internal Medicine and Infectious Diseases, University Medical Center Utrecht, Utrecht, The Netherlands,3 Department of Microbiology and Immunology, New York Medical College, Valhalla, New York,4 Center for the Study of Emerging and Reemerging Pathogens, University of Texas, Houston, Texas,5 Departamento de Agricultura y Alimentación, Universidad de La Rioja, Logroño, Spain6

Received 14 December 2005/ Returned for modification 1 February 2006/ Accepted 28 March 2006


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A multilocus sequence typing (MLST) scheme based on seven housekeeping genes was used to investigate the epidemiology and population structure of Enterococcus faecalis. MLST of 110 isolates from different sources and geographic locations revealed 55 different sequence types that grouped into four major clonal complexes (CC2, CC9, CC10, and CC21) by use of eBURST. Two of these clonal complexes, CC2 and CC9, are particularly fit in the hospital environment, as CC2 includes the previously described BVE clonal complex identified by an alternative MLST scheme and CC9 includes exclusively isolates from hospitalized patients. Identical alleles were found in genetically diverse isolates with no linkage disequilibrium, while the different MLST loci gave incongruent phylogenetic trees. This demonstrates that recombination is an important mechanism driving genetic variation in E. faecalis and suggests an epidemic population structure for E. faecalis. Our novel MLST scheme provides an excellent tool for investigating local and short-term epidemiology as well as global epidemiology, population structure, and genetic evolution of E. faecalis.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Although classically considered a commensal of the gastrointestinal tracts of humans and animals rather than a specialized human pathogen, enterococci have become extremely relevant in hospital-acquired infections. Their ability to acquire specific genetic traits, such as virulence and antibiotic resistance determinants that could increase their fitness in such a complex ecosystem, has been recognized (18). The paradigm of this evolutionary development is the emergence and spread of vancomycin-resistant enterococci (VRE) (20).

Among enterococcal species, Enterococcus faecalis is responsible for most human infections in both community and hospital settings. Though resistance to vancomycin and penicillins is very rare, E. faecalis seems to harbor a broader repertoire of potential virulence traits than E. faecium (34). However, little is known about the relationship between the population structure and global epidemiology of E. faecalis. Different molecular typing methods have been developed to analyze E. faecalis epidemiology (3, 11, 19, 36, 37, 40). Pulsed-field gel electrophoresis (PFGE) is considered a practical "gold standard" due to its high discriminatory abilities (3, 37), but the most important limitation of PFGE is its low interlaboratory reproducibility and its unsuitability for both global and long-term epidemiology studies or for phylogenetic or population structure studies.

For many different bacterial species, the most appropriate technique for global and long-term epidemiology studies is multilocus sequence typing (MLST) (38). MLST provides an unambiguous nomenclature for genotypes, and clones and data are easily stored in databases that can be exchanged between different laboratories via the Internet (1). For E. faecium, the development of an MLST scheme has been critical in the understanding of global epidemiology, genetic evolution, and population structure (14, 41). A previous MLST scheme based on three highly variable antigen-encoding genes (salA, ace, and efaA) and six housekeeping genes was used to study a collection of 21 E. faecalis isolates involved in outbreaks or harboring unusual antibiotic resistances (22).

In the present work, we describe a novel MLST scheme for E. faecalis based on seven housekeeping genes that is used to study a large collection (110 strains) of E. faecalis isolates from different sources and geographic areas. Our results indicate that this scheme can be proposed as a new and reliable reference typing scheme, as it allows short-term and long-term epidemiological studies of E. faecalis and its population biology.

(Part of this work has been presented at the 44th Interscience Conference on Antimicrobial Agents and Chemotherapy, 2004 [Washington, D.C.], and at the Second International American Society for Microbiology-Federation of European Microbiological Societies Conference on Enterococci, 2005 [Helsingør, Denmark].)


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Bacterial isolates and species identification. A total of 110 E. faecalis isolates from different host origins and geographic locations were selected (Table 1). To compare the discriminatory powers of MLST and PFGE, we selected a set of 40 of the total isolates originating from both blood cultures (28) and fecal samples (12). Species identification of E. faecalis was performed by PCR using primers specific for both the D-alanine ligase (ddl) gene and the efaA gene (3).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Molecular characteristics of the E. faecalis isolates included in this work

 
MLST scheme. Initially, internal fragments from 12 housekeeping genes were amplified and sequenced. Based on PCR and sequencing robustness, low ratios of nonsynonymous to synonymous mutations, and a high Simpson's index of diversity (D) of the individual loci and of the combinations of the seven genes, a final combination of the following seven genes with dispersed locations on the chromosome (minimal distance between loci, 137 kb) was selected: gdh (glucose-6-phosphate dehydrogenase), gyd (glyceraldehyde-3-phosphate dehydrogenase), pstS (phosphate ATP binding cassette transporter), gki (putative glucokinase), aroE (shikimate 5-dehydrogenase), xpt (shikimate 5-dehydrogenase), and yiqL (acetyl-coenzyme A acetyltransferase) (Table 2).


View this table:
[in this window]
[in a new window]
 
TABLE 2. Genetic diversity found in E. faecalis MLST loci

 
Internal fragments from the final set of seven genes were amplified by PCR with the following sets of primers: gdh-1, GGCGCACTAAAAGATATGGT, and gdh-2, CCAAGATTGGGCAACTTCGTCCCA; gyd-1, CAAACTGCTTAGCTCCAATGGC, and gyd-2, CATTTCGTTGTCATACCAAGC; pstS-1, CGGAACAGGACTTTCGC, and pstS-2, ATTTACATCACGTTCTACTTGC; gki-1, GATTTTGTGGGAATTGGTATGG, and gki-2, ACCATTAAAGCAAAATGATCGC; aroE-1, TGGAAAACTTTACGGAGACAGC, and aroE-2, GTCCTGTCCATTGTTCAAAAGC; xpt-1, AAAATGATGGCCGTGTATTAGG, and xpt-2, AACGTCACCGTTCCTTCACTTA; and yqiL-1, CAGCTTAAGTCAAGTAAGTGCCG, and yqiL-2, GAATATCCCTTCTGCTTGTGCT.

PCR conditions for all amplification reactions were as follows: initial denaturation at 94°C for 5 min; 30 cycles at 94°C for 30 s, 52°C for 30 s, and 72°C for 1 min; and final extension at 72°C for 7 min. Reactions were performed in 25-µl volumes using Taq polymerase SphaeroQ (Leiden, The Netherlands). PCR products were purified with a kit from QIAGEN, Inc. (Hilden, Germany), and sequenced with PCR forward and reverse primers, an ABI PRISM Big Dye cycle sequencing ready reaction kit (Perkin-Elmer, Applied Biosystems, Foster City, Calif.), and an ABI 3700 DNA sequencer (Perkin-Elmer).

Allele and sequence type assignment. For each locus, a distinct allele number was assigned to every different sequence, in accordance with the E. faecalis MLST database (http://efaecalis.mlst.net/). Allelic profile or sequence type (ST) was assigned in the order gdh, gyd, pstS, gki, aroE, xpt, and yqiL to a total of seven integers corresponding to the allele numbers at the seven loci. STs were assigned to isolates in such a way that the same ST names were kept as much as possible for the same strains analyzed by this and the previously published scheme (22).

Computer analysis of MLST data. The relatedness between the different STs was investigated using BioNumerics software (version 4.0; Applied Maths, Sint-Martens-Latem, Belgium) by the unweighted-pair group method with arithmetic averages (UPGMA) and the categorical coefficient of similarity. Clusters of related STs differing in not more than in two of the seven loci that were thought to be descendants from a common ancestor were grouped into clonal complexes (CCs) by using eBURST (http://www.mlst.net) (9). Predicted founders of a CC were STs with the highest numbers of single-locus variants. A singleton was defined as an ST that is not grouped into a CC, and a singleton clone was defined as a singleton represented by more than one isolate. The allelic profiles were also clustered by using a categorical coefficient and the minimum spanning tree module within the BioNumerics software package (Applied Maths) (29). As with eBURST, the minimum spanning tree was used to infer patterns of evolutionary descent under the principle of parsimony, where identical alleles in different genotypes are thought to have evolved from a common ancestor instead of by convergent evolution.

Ratios of nonsynonymous to synonymous nucleotide substitutions were calculated using START (http://www.mlst.net). The MEGA program (version 2.1; http://www.megasoftware.net) (16) was used to calculate the number of variable nucleotide sites. The index of association (Ia) (32) was used to measure the linkage disequilibrium between alleles at the seven housekeeping genes with the program available at the MLST website (http://www.mlst.net). The Ia was defined as the observed variance (Vobs) in the distribution of allelic mismatches in all pairwise comparisons of the allelic profiles divided by the expected variance in a freely recombining population minus one. The significance of Ia was estimated by comparing the Vobs obtained from the actual data with the maximum variance (Vmax) calculated from 1,000 data sets under the assumption of the random association of loci. Significant linkage disequilibrium was established if the Vobs obtained with the actual data set was greater than the Vmax with any of the 1,000 randomized data sets; otherwise, there was no evidence of a departure from linkage equilibrium.

Pulsed-field gel electrophoresis. Chromosomal DNA was prepared as previously described (37) and digested with SmaI. Electrophoresis was carried out with a contour-clamped homogeneous electric field DR-II apparatus (Bio-Rad, La Jolla, Calif.) with a 1.2% agarose gel with 0.5x Tris-borate-EDTA, and the following settings were applied: 1 to 35 s, 6 V/cm2, and 24 h. Results were interpreted according to the criteria proposed by Tenover et al. (35).

Simpson's index of diversity and confidence interval. To compare the discriminatory powers of PFGE and MLST, Simpson's index of diversity (D) with 95% confidence intervals (95% CI) was calculated for a set of 40 strains (12, 15). A D value close to 0 indicated that there was little diversity as shown by the typing method, whereas a D value close to 1 indicated a high diversity as shown by the typing method (15).

Statistical analysis. Statistically significant association between hospital or community-derived origin of isolates and genetic clustering was calculated by the chi-square test (Epi-Info, version 6; Centers for Disease Control and Prevention, Atlanta, GA). A P value of <0.05 was considered to be statistically significant.

Gene tree congruence analysis. To assess the impact of recombination on the population structure of E. faecalis in more detail, the topologies of the seven MLST gene trees were compared using the Shimodaira-Hasegawa (SH) test (31). Briefly, a set of distantly related isolates was obtained by selecting presumed founders of CCs and all singletons. A total of 33 isolates was selected and used in the SH test. Maximum-likelihood (ML) trees for each MLST gene of the 33 isolates were obtained under a general time-reversible model, with a proportion of invariant sites and rate heterogeneity among sites assuming a discrete gamma distribution with eight categories (the GTR+I+G model). PAUP*4.0b10 was used to obtain the ML trees by using a neighbor-joining starting tree followed by tree bisection reconnection branch swapping (33). For a given gene, the SH test compares the difference in log likelihoods of competing tree topologies. A null distribution of differences in log likelihoods was obtained by 1,000 replicates of nonparametric bootstrapping of reestimated log likelihoods. We conducted 107 SH tests for each MLST gene, comparing the 7 MLST gene trees and 100 random trees separately generated for each of the MLST genes. In a clonal population, different genes have similar tree topologies and fit other gene trees better than they fit random trees. With recombination, different genes may have different tree topologies and may fit random trees better than they fit other gene trees.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Allelic variation in E. faecalis. Among the 110 isolates investigated, the numbers of different alleles ranged from 8 (gyd) to 24 (gki and pstS) (Table 2). Similarly, the proportions of variable sites present in the selected housekeeping genes varied from 2% (gyd) to 4.8% (gki). Most polymorphisms resulted in synonymous substitutions, and the low ratios of nonsynonymous to synonymous substitutions indicated a very limited role for diversifying selection on these loci (Table 2).

Discriminatory ability of MLST compared to PFGE. The Simpson's index of diversity (D) with 95% CI was determined to compare the discriminatory powers of PFGE and MLST with a set of 40 isolates typed by both methods (Table 3). Both PFGE and MLST techniques distinguished 29 different genotypes when the PFGE criteria used to define closely related isolates were differences in two to three bands, as previously published (35). The ability of PFGE to discriminate clones (D = 97.3%; 95% CI, 95 to 99.7%) was similar to that of MLST (D = 97.1%; 95% CI, 94.5 to 99.6%) since the 95% CI values overlapped. If PFGE data were analyzed on the basis of indistinguishable banding patterns, 37 different PFGE patterns were obtained, with a slightly higher discriminatory power of 99.4 (95% CI, 98.6 to 100%). This difference was not statistically significant since 95% CIs overlapped.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Comparison between MLST STs and PFGE types of a set of 40 strains

 
Good correlation was obtained between MLST and PFGE results; however, a perfect match between both techniques was not always observed. In total, 7.5% of the strains with indistinguishable PFGE patterns had different STs, while 5% of the strains with identical STs showed different PFGE patterns.

Relatedness of E. faecalis isolates. The 110 isolates were resolved into 55 STs, of which 37 were represented by a single isolate. The types most frequently found were ST16 (13 isolates), ST9 (10 isolates), ST6 (8 isolates), ST17 (6 isolates), ST26 (4 isolates), and ST21 (4 isolates). The UPGMA method was used to construct a dendrogram from the matrix of pairwise allelic differences between the 55 STs of all 110 isolates (Fig. 1), showing a highly divergent population. eBURST was used to divide the isolates into clonal complexes, and in addition a minimum spanning tree based on allelic profiles was constructed. Both eBURST (data not shown) and the minimum spanning tree (Fig. 2) resolved the 55 STs into four major clonal complexes, 10 minor clonal complexes, and 19 singletons not belonging to CCs. The four major CCs were designated CC9 (19 isolates), CC21 (9 isolates), CC2 (11 isolates), and CC10 (3 isolates). Only in CC9 and CC21 could a founder ST be assigned. Seven out of 19 singleton STs were represented by more than one isolate and could be assigned singleton clones, ST16 (13 isolates) being the largest.


Figure 1
View larger version (29K):
[in this window]
[in a new window]
 
FIG. 1. Dendrogram showing the relatedness among the 55 STs of E. faecalis by use of UPGMA from the matrix of pairwise differences in the allelic profiles. The following data are included: ST; numbers of isolates with the same ST; host origin (HO, isolate from a hospital outbreak; HC, clinical sample from a hospitalized human; HF, fecal sample from a hospitalized human; CF, fecal sample from a healthy volunteer; AS, fecal sample from a healthy animal; AC, clinical sample from an animal; M, miscellaneous group, which included isolates from sewage, laboratory strains, and unknown origin); resistance (BLA+, beta-lactamase-producing isolate); numbers of isolates with indicated allelic profiles; and countries of origin (ARG, Argentina; BEL, Belgium; GRC, Greece; IND, India; LEB, Lebanon; NLD, The Netherlands; POR, Portugal; SP, Spain; THA, Thailand; USA, United States). Numbers in the columns under the spanner "Host origin" represent numbers of isolates. Numbers in the columns under the spanner "Resistance" represent numbers of isolates with indicated resistance patterns; letters in the same columns represent host origin abbreviations.

 

Figure 2
Figure 2
View larger version (52K):
[in this window]
[in a new window]
 
FIG. 2. Clustering of 55 STs by use of the minimum spanning tree. Colors indicate isolation sources (A) or resistance phenotypes (B). Each circle represents an ST, and the type number is indicated in the circle. The area of each circle corresponds to the number of isolates. Thick, short, solid lines connect single-locus variants, thin, longer, solid lines connect double-locus variants, black dotted lines connect STs which differ in three loci, and gray dotted lines connect STs that differ in more than three loci. Pie charts indicate ST distribution. Clonal complexes are indicated.

 
Epidemiology of clonal complexes. In general, host specificity was not observed among the different bacterial lineages, since human and animal isolates that originated in distant regions were uniformly distributed among the clonal complexes (Fig. 2A). ST16 is a remarkable example of spread in different compartments, with 13 isolates from Spain and The Netherlands, including isolates from clinical infections (1) and intestinal colonization of hospital patients (6) or healthy volunteers (3), as well as animal isolates (3). Despite this apparent lack of strict host specificity, the fact that 30/89 (34%) isolates colonizing or infecting hospitalized patients from four countries in different continents and only 2/33 (6%) non-hospital-derived isolates (P = 0.002) grouped in CC2 and CC9 suggests that CC2 and CC9 can be considered hospital-adapted complexes which have spread worldwide. Moreover, all (except one) of the hospital outbreak isolates, which were VRE (including the sequenced E. faecalis V583 strain) and vancomycin-susceptible enterococci, were confined to these complexes.

VRE in general were found in multiple genetic backgrounds (ST5, ST19, ST23, ST31, and ST32), illustrating the importance of horizontal transfer of glycopeptide resistance (Fig. 2B). Beta-lactamase-producing (Bla+) isolates were recovered from five separate outbreaks; two of them, E228 (TX0614) and HH22 (TX0921), corresponded to CC2, previously designated the BVE complex (22), while HG6280 (TX0630) and WH425 (TX0635) corresponded to CC9, previously designated the ACB clone (Fig. 2B) (22). One Bla+ isolate (TX0645) was classified as ST10 and clustered in CC10 together with a fecal isolate from a calf and a human clinical isolate.

Although high-level resistance to gentamicin was found in isolates from different epidemiological sources, it was most frequently detected among hospital isolates belonging to CC9 and the singleton clone ST16.

Influence of recombination on the population structure of E. faecalis. To assess whether genetic diversity in E. faecalis was caused primarily by mutation or recombination, associations between alleles at different loci were quantified by calculating the Ia (32). Clonal populations, where mutations predominate in generating genetic variation, show significant associations (linkage disequilibrium) between alleles at different loci. Nonclonal populations, where recombination predominates, show low degrees of association between alleles at different loci. Significant linkage disequilibrium was detected when the entire strain set (110 isolates) or the STs (55 STs) were included in the analysis (Ia = 2.54, Vobs = 2.87, and Vmax = 0.84 and Ia = 1.05, Vobs = 1.23, and Vmax = 0.81, respectively). However, this entire strain set includes closely related STs within CCs that might have diversified clonally over the short term. When the Ia was calculated for 33 more distantly related STs (1 ST from each complex and all singletons), there was no evidence for linkage disequilibrium (Ia = 0.42, Vobs = 0.64, Vmax = 0.92). Visual inspection of the MLST allelic profiles revealed that for each locus identical alleles were distributed among distantly related isolates.

Additionally, the extent of congruence between the topologies of the seven different MLST gene trees was determined. If rates of recombination are low, the topologies of the trees are similar, while the different gene trees show no significant congruence with high rates of recombination. Thirty-three strains, one from each complex and all singletons, were included in this analysis. The results indicated that all 42 pairwise comparisons of the seven MLST loci were incongruent (Table 4). Furthermore, in almost all cases, the random tree was a better fit to the gene of investigation than to the most incongruent MLST gene. We conclude that a high rate of recombination in E. faecalis has diminished the phylogenetic signal in the housekeeping gene trees.


View this table:
[in this window]
[in a new window]
 
TABLE 4. Log likelihood for ML trees for each reference loci and for this tree as a fit to the data from the other locia

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A new reference typing scheme for E. faecalis, which allows the study of local hospital outbreaks as well as long-term epidemiology and global comparisons of isolates, is provided. This new MLST scheme differs from other recently published E. faecalis MLST schemes (21, 22) by including seven housekeeping genes instead of six, no virulence genes, and more loci (three instead of one) in common with the E. faecium MLST scheme. For the gdh gene, a slightly different region was chosen in this scheme compared to the previous MLST schemes to match the gdh locus of the E. faecium MLST scheme (14). The seven selected housekeeping genes showed a high degree of resolution, and none of the loci were under diversifying selective pressure, as demonstrated by the low ratios of nonsynonymous to synonymous mutations. This new MLST scheme allows both evolutionary and population structure analyses and also enables the study of E. faecalis-E. faecium interspecies recombination. It is true that the incorporation of virulence genes, as described in the previous E. faecalis MLST schemes (21, 22), may improve epidemiological resolution. Nevertheless, selection on these genes may also obscure patterns of evolutionary descent in phylogenetic studies. Furthermore, adding rapidly evolving genes, like virulence genes, identifying microvariation may lead to a scheme that is too discriminatory for long-term and global epidemiology, since it may reduce the capability of grouping isolates with common features (e.g., hospital-adapted clones) from different time periods and continents in common globally distributed lineages. Therefore, we have chosen to include only metabolic housekeeping genes representing the core genome in this new MLST scheme.

The discriminatory abilities of MLST and PFGE were statistically similar in this study, although as reported for other bacterial species, there was not a perfect correlation between PFGE and MLST (8, 23, 26).

The application of the MLST scheme proposed in this work also has provided the first insight into the population structure of E. faecalis. Extensive MLST studies of the closely related enterococcal species E. faecium revealed clustering of isolates into distinct host-specific lineages and identified a distinct genetic subpopulation, designated CC17, containing the vast majority of hospital outbreaks and clinical isolates that have spread globally during the last two decades (41). In contrast, E. faecalis obtained from different epidemiological sources (hospitalized patients, community, and animals) frequently shared identical STs and grouped together in common complexes. Despite this alleged random dispersion of human clinical, surveillance, and animal isolates, two of the major complexes (CC2 and CC9) contained almost exclusively hospital-derived isolates, suggesting they were well adapted to persist in the hospital environment. Indeed, the previously published BVE clone (22), corresponding to CC2, included clinically important E. faecalis isolates such as V583 (25), MMH594, or the first known Bla+ isolate (HH22) (21, 30). Also, the ACB clonal complex (22), equivalent to CC9, underscored the widespread distribution of these hospital-adapted CCs. Previous molecular typing of other E. faecalis isolates by using amplified fragment length polymorphism also suggested the existence of hospital-adapted genetic complexes (40).

Progression towards hospital adaptation is probably a multistep cumulative process where a particular genotype acquires resistance and virulence colonization determinants, dependent on the availability of adaptive mechanisms in the local gene pool. This results in an enhancement of fitness in the hospital environment, increasing the likelihood of persistence and thus further allowing acquisition of more-adaptive mechanisms. These processes of adaptation require highly efficient mechanisms for genetic exchange and may lead to a nonclonal population structure. Nonclonality in E. faecalis was demonstrated by the complete absence of congruence between housekeeping loci and was further illustrated by the fact that ML trees based on the seven MLST housekeeping genes were no more similar to each other than they were to trees of random topology. This demonstrates that in E. faecalis frequent horizontal DNA exchange has eliminated the phylogenetic signal in each housekeeping gene. Nonclonal populations also show weak associations between alleles at different loci or even total linkage equilibrium. Despite the suggested high levels of recombination in E. faecalis, linkage disequilibrium was found when the entire strain set was analyzed. Such observations are not uncommon in recombining populations because the sample of bacterial isolates often includes many closely related genotypes. The linkage disequilibrium that is detected in these samples is temporary and restricted to these closely related genotypes. In E. faecalis, the emergence and diversification of the adaptive clones CC2 and CC9 have led to departure from linkage equilibrium. No linkage disequilibrium was found when a subset of isolates was analyzed without including multiple isolates from within CCs. This phenomenon is characteristic of an epidemic population structure (10, 13).

In E. faecalis, a large variety of conjugative plasmids and conjugative transposons are involved in genetic transfer of resistance and virulence determinants, which might also facilitate hospital adaptation in CC2 and CC9 (2). Studies of transferable elements that carry the vanB vancomycin resistance gene have suggested genetic exchange of chromosomal fragments up to 90 to 250 kb that could include housekeeping genes (4, 5, 27). While large-sized fragments can be exchanged through composite conjugative transposons, natural transformation of E. faecalis cannot be excluded, although, to our knowledge, it has never been documented. The genome sequence of E. faecalis harbors at least eight genes encoding putative competence proteins (25). The mechanisms of genetic exchange involved in these high rates of recombination in E. faecalis remain to be determined.

The first data resulting from the application of MLST to explore the population structure of E. faecalis reveal an epidemic structure where recombination plays an important role and two major hospital-adapted CCs have emerged. However, more studies are needed to improve our understanding of the population biology and the mechanisms involved in horizontal genetic transfer and recombination in E. faecalis. With this MLST scheme, comparison of population structures of different enterococcal species is becoming a reachable objective that should provide new insight into the evolutionary history of this important group of bacteria.


    ACKNOWLEDGMENTS
 
This work was supported by Red Temática de Investigación REIPI from the Spanish Ministry of Health (C03/14) and by University Medical Center Utrecht, Utrecht, The Netherlands. P. Ruiz-Garbajosa was the recipient of a Post-Formación Sanitaria Especializada Contract from the Spanish Ministry of Health and a research grant from SEIMC (Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica).

This publication made use of the Multi Locus Sequence Typing website (http://www.mlst.net) at Imperial College, London, United Kingdom, developed by Man-Suen Chan and David Aanensen and funded by the Wellcome Trust. Finally, we thank A. Oliver, G. Bou, W. Gaastra, and L. Peixe for providing us with E. faecalis strains.


    FOOTNOTES
 
* Corresponding author. Mailing address: Servicio de Microbiología, Hospital Universitario Ramón y Cajal, Ctra. de Colmenar Km 9.100, Madrid 28034, Spain. Phone: 913368330. Fax: 913368809. E-mail: pruizg.hrc{at}salud.madrid.org. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Aanensen, D. M., and B. G. Spratt. 2005. The multilocus sequence typing network: mlst.net. Nucleic Acids Res. 33:W728-W733.[Abstract/Free Full Text]
  2. Clewell, D. B., and G. M. Dunny. 2002. Conjugation and genetic exchange in enterococci, p. 265-300. In M. S. Gilmore, D. B. Clewell, P. Courvalin, G. M. Dunny, B. E. Murray, and L. B. Rice (ed.), The enterococci: pathogenesis, molecular biology, and antibiotic resistance. ASM Press, Washington, D.C.
  3. Coque, T. M., P. Seetulsingh, K. V. Singh, and B. E. Murray. 1998. Application of molecular techniques to the study of nosocomial infections caused by enterococci, p. 469-493. In N. Woodford and A. Johnson (ed.), Methods in molecular medicine, vol. 15. Molecular bacteriology: protocols and clinical applications. Humana Press, Totowa, N.J.
  4. Dahl, K. H., E. W. Lundblad, T. P. Rokenes, O. Olsvik, and A. Sundsfjord. 2000. Genetic linkage of the vanB2 gene cluster to Tn5382 in vancomycin-resistant enterococci and characterization of two novel insertion sequences. Microbiology 146:1469-1479.[Abstract/Free Full Text]
  5. Dahl, K. H., and A. Sundsfjord. 2003. Transferable vanB2 Tn5382-containing elements in fecal streptococcal strains from veal calves. Antimicrob. Agents Chemother. 47:2579-2583.[Abstract/Free Full Text]
  6. del Campo, R., P. Ruiz-Garbajosa, M. P. Sanchez-Moreno, F. Baquero, C. Torres, R. Cantón, and T. M. Coque. 2003. Antimicrobial resistance in recent fecal enterococci from healthy volunteers and food handlers in Spain: genes and phenotypes. Microb. Drug Resist. 9:47-60.[Medline]
  7. del Campo, R., C. Tenorio, M. Zarazaga, R. Gómez-Lus, F. Baquero, and C. Torres. 2001. Detection of a single vanA-containing Enterococcus faecalis clone in hospitals in different regions in Spain. J. Antimicrob. Chemother. 48:746-747.[Free Full Text]
  8. Enright, M. C., N. P. Day, C. E. Davies, S. J. Peacock, and B. Spratt. 2000. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J. Clin. Microbiol. 38:1008-1015.[Abstract/Free Full Text]
  9. Feil, E. J., B. C. Li, D. M. Aanensen, W. P. Hanage, and B. G. Spratt. 2004. eBURST: inferring patterns of evolutionary descent among clusters of related bacterial genotypes from multilocus sequence typing data. J. Bacteriol. 186:1518-1530.[Abstract/Free Full Text]
  10. Feil, E. J., and B. G. Spratt. 2001. Recombination and the population structures of bacterial pathogens. Annu. Rev. Microbiol. 55:561-590.[CrossRef][Medline]
  11. Gordillo, M. E., K. V. Singh, and B. E. Murray. 1993. Comparison of ribotyping and pulsed-field gel electrophoresis for subspecies differentiation of strains of Enterococcus faecalis. J. Clin. Microbiol. 31:1570-1574.[Abstract/Free Full Text]
  12. Grundmann, H., S. Hori, and G. Tanner. 2001. Determining confidence intervals when measuring genetic diversity and the discriminatory abilities of typing methods for microorganisms. J. Clin. Microbiol. 39:4190-4192.[Abstract/Free Full Text]
  13. Holmes, E. C., R. Urwin, and M. C. Maiden. 1999. The influence of recombination on the population structure and evolution of the human pathogen Neisseria meningitidis. Mol. Biol. Evol. 16:741-749.[Abstract]
  14. Homan, W. L., D. Tribe, S. Poznanski, M. Li, G. Hogg, E. Spalburg, J. D. Van Embden, and R. J. Willems. 2002. Multilocus sequence typing scheme for Enterococcus faecium. J. Clin. Microbiol. 40:1963-1971.[Abstract/Free Full Text]
  15. Hunter, P. R., and M. A. Gaston. 1988. Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity. J. Clin. Microbiol. 26:2465-2466.[Abstract/Free Full Text]
  16. Kumar, S., K. Tamura, and M. Nei. 1994. MEGA: molecular evolutionary genetics analysis software for microcomputers. Comput. Appl. Biosci. 10:189-191.[Abstract/Free Full Text]
  17. Maciá, M. D., C. Juan, A. Oliver, O. Hidalgo, and J. L. Pérez. 2005. Molecular characterization of a glycopeptide-resistant Enterococcus faecalis outbreak in an intensive care unit. Enferm. Infecc. Microbiol. Clin. 23:460-463.[Medline]
  18. Malani, P. N., C. A. Kauffman, and M. J. Zervos. 2002. Enterococcal disease, epidemiology, and treatment, p. 385-408. In M. S. Gilmore, D. B. Clewell, P. Courvalin, G. M. Dunny, B. E. Murray, and L. B. Rice (ed.), The enterococci: pathogenesis, molecular biology, and antibiotic resistance. ASM Press, Washington, D.C.
  19. Malathum, K., K. V. Singh, G. M. Weinstock, and B. E. Murray. 1998. Repetitive sequence-based PCR versus pulsed-field gel electrophoresis for typing of Enterococcus faecalis at the subspecies level. J. Clin. Microbiol. 36:211-215.[Abstract/Free Full Text]
  20. Mundy, L. M., D. F. Sahm, and M. Gilmore. 2000. Relationships between enterococcal virulence and antimicrobial resistance. Clin. Microbiol. Rev. 13:513-522.[Abstract/Free Full Text]
  21. Nallapareddy, S. R., R. W. Duh, K. V. Singh, and B. E. Murray. 2002. Molecular typing of selected Enterococcus faecalis isolates: pilot study using multilocus sequence typing and pulsed-field gel electrophoresis. J. Clin. Microbiol. 40:868-876.[Abstract/Free Full Text]
  22. Nallapareddy, S. R., H. Wenxiang, G. M. Weinstock, and B. E. Murray. 2005. Molecular characterization of a widespread, pathogenic, and antibiotic resistance-receptive Enterococcus faecalis lineage and dissemination of its putative pathogenicity island. J. Bacteriol. 187:5709-5718.[Abstract/Free Full Text]
  23. Nemoy, L. L., M. Kotetishvili, J. Tigno, A. Keefer-Norris, A. D. Harris, E. N. Perencevich, T. A. Johnson, D. Torpey, A. Sulakvelidze, J. G. Morris, Jr., and O. C. Stine. 2005. Multilocus sequence typing versus pulsed-field gel electrophoresis for characterization of extended-spectrum beta-lactamase-producing Escherichia coli isolates. J. Clin. Microbiol. 43:1776-1781.[Abstract/Free Full Text]
  24. Novais, C., T. M. Coque, J. C. Sousa, F. Baquero, L. Peixe, and the Portuguese Resistance Study Group. 2004. Local genetic patterns within a vancomycin-resistant Enterococcus faecalis clone isolated in three hospitals in Portugal. Antimicrob. Agents Chemother. 48:3613-3617.[Abstract/Free Full Text]
  25. Paulsen, I. T., L. Banerjei, G. S. Myers, K. E. Nelson, R. Seshadri, T. D. Read, D. E. Fouts, J. A. Eisen, S. R. Gill, J. F. Heidelberg, H. Tettelin, R. J. Dodson, L. Umayam, L. Brinkac, M. Beanan, S. Daugherty, R. T. DeBoy, S. Durkin, J. Kolonay, R. Madupu, W. Nelson, J. Vamathevan, B. Tran, J. Upton, T. Hansen, J. Shetty, H. Khouri, T. Utterback, D. Radune, K. A. Ketchum, B. A. Dougherty, and C. M. Fraser. 2003. Role of mobile DNA in the evolution of vancomycin-resistant Enterococcus faecalis. Science 299:2071-2074.[Abstract/Free Full Text]
  26. Peacock, S. J., G. D. de Silva, A. Justice, A. Cowland, C. E. Moore, C. G. Winearls, and N. P. Day. 2002. Comparison of multilocus sequence typing and pulsed-field gel electrophoresis as tools for typing Staphylococcus aureus isolates in a microepidemiological setting. J. Clin. Microbiol. 40:3764-3770.[Abstract/Free Full Text]
  27. Rice, L. B., and L. L. Carias. 1998. Transfer of Tn5385, a composite, multiresistance chromosomal element from Enterococcus faecalis. J. Bacteriol. 180:714-721.[Abstract/Free Full Text]
  28. Robredo, B., C. Torres, K. V. Singh, and B. E. Murray. 2000. Molecular analysis of Tn1546 in vanA-containing Enterococcus spp. isolated from humans and poultry. Antimicrob. Agents Chemother. 44:2588-2589.[Free Full Text]
  29. Schouls, L. M., H. G. van der Heide, L. Vauterin, P. Vauterin, and F. R. Mooi. 2004. Multiple-locus variable-number tandem repeat analysis of Dutch Bordetella pertussis strains reveals rapid genetic changes with clonal expansion during the late 1990s. J. Bacteriol. 186:5496-5505.[Abstract/Free Full Text]
  30. Shankar, N., A. S. Baghdayan, and M. S. Gilmore. 2002. Modulation of virulence within a pathogenicity island in vancomycin-resistant Enterococcus faecalis. Nature 417:746-750.[CrossRef][Medline]
  31. Shimodaira, H., and M. Hasegawa. 1999. Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Mol. Biol. Evol. 16:1114-1146.
  32. Smith, J. M., N. H. Smith, M. O'Rourke, and B. G. Spratt. 1993. How clonal are bacteria? Proc. Natl. Acad. Sci. USA 90:4384-4388.[Abstract/Free Full Text]
  33. Swofford, D. L. 2000. PAUP*: phylogenetic analysis using parsimony and other methods, version 4. Sinauer, Sunderland, Mass.
  34. Tendolkar, P. M., A. S. Baghdayan, and N. Shankar. 2003. Pathogenic enterococci: new developments in the 21st century. Cell. Mol. Life Sci. 60:2622-2636.[CrossRef][Medline]
  35. Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H. Persing, and B. Swaminathan. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33:2233-2239.[Medline]
  36. Thorisdottir, A. S., L. L. Carias, S. H. Marshall, M. Green, M. J. Zervos, C. Giorgio, L. A. Mermel, J. M. Boyce, A. A. Medeiros, H. Fraimow, and L. B. Rice. 1994. IS6770, an enterococcal insertion-like sequence useful for determining the clonal relationship of clinical enterococcal isolates. J. Infect. Dis. 170:1539-1548.[Medline]
  37. Tomayko, J. F., and B. E. Murray. 1995. Analysis of Enterococcus faecalis isolates from intercontinental sources by multilocus enzyme electrophoresis and pulsed-field gel electrophoresis. J. Clin. Microbiol. 33:2903-2907.[Abstract]
  38. Urwin, R., and M. C. Maiden. 2003. Multi-locus sequence typing: a tool for global epidemiology. Trends Microbiol. 11:479-487.[CrossRef][Medline]
  39. Velasco, D., S. Pérez, M. A. Domínguez, R. Villanueva, and G. Bou. 2004. Description of a nosocomial outbreak of infection caused by a vanA-containing strain of Enterococcus faecalis in La Coruña, Spain. J. Antimicrob. Chemother. 53:892-893.[Free Full Text]
  40. Waar, K., A. B. Muscholl-Silberhorn, R. J. Willems, M. J. Slooff, H. J. Harmsen, and J. E. Degener. 2002. Genogrouping and incidence of virulence factors of Enterococcus faecalis in liver transplant patients differ from blood culture and fecal isolates. J. Infect. Dis. 185:1121-1127.[CrossRef][Medline]
  41. Willems, R. J., J. Top, M. van Santen, D. A. Robinson, T. M. Coque, F. Baquero, H. Grundmann, and M. J. Bonten. 2005. Global spread of vancomycin-resistant Enterococcus faecium from distinct nosocomial genetic complex. Emerg. Infect. Dis. 11:821-828.[Medline]


Journal of Clinical Microbiology, June 2006, p. 2220-2228, Vol. 44, No. 6
0095-1137/06/$08.00+0     doi:10.1128/JCM.02596-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ruiz-Garbajosa, P.
Right arrow Articles by Willems, R. J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ruiz-Garbajosa, P.
Right arrow Articles by Willems, R. J. L.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Antimicrob. Agents Chemother. Clin. Microbiol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS