Previous Article | Next Article ![]()
Journal of Clinical Microbiology, August 2006, p. 2897-2903, Vol. 44, No. 8
0095-1137/06/$08.00+0 doi:10.1128/JCM.02549-05
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
National Reference Centre for Salmonella and Shigella,1 Bacteriology Division,2 Bureau of Quality Assurance,3 Phage Typing Centre, Department Pasteur Institute, Scientific Institute of Public Health, 14 Wytsman Street, B-1050 Brussels, Belgium,4 Centre National de Référence des Salmonella, Unité de Biodiversité des Bactéries Pathogènes Emergentes, Institut Pasteur, INSERM U389, 28 rue du Docteur Roux, 75724 Paris Cedex 15, France,5 Unité BioAgresseurs, Santé et Environnement, Institut National de la Recherche Agronomique, 37380 Nouzilly, France,6 Department of Bacteriology and Immunology, CODA-CERVA-VAR, Groeselenberg 99, 1180 Brussels, Belgium7
Received 7 December 2005/ Returned for modification 22 January 2006/ Accepted 21 May 2006
|
|
|---|
|
|
|---|
Considering that the highest incidence of salmonellosis is among children <5 years old, resistance to ESC is of concern (39). Salmonella strains resistant to ESC have been reported since the late 1980s, and their numbers have increased ever since. Two major resistance mechanisms have been identified in Salmonella. In the first, the isolates express plasmid-mediated AmpC-like ß-lactamases that hydrolyze the cephamycins, extended-spectrum cephalosporins, and monobactams. In the second mechanism, the Salmonella strains express an ESBL that is able to hydrolyze monobactams and oxyimino cephalosporins (such as cefotaxime and ceftazidime) but not the cephamycins (18). CTX-M ß-lactamases (cefotaximases) are a relatively novel family of plasmid-mediated ESC and have been classified as Ambler class A. These enzymes generally possess higher levels of hydrolytic activity against cefotaxime than against ceftazidime and are inhibited by clavulanic acid, sulbactam, and tazobactam. They also provide resistance to cefepime. On the basis of their amino acid sequences, the CTX-M enzymes have been classified into five major phylogenetic branches (groups 1, 2, 8, 9, and 25) (4).
Here we report the emergence of ESBL (CTX-M-2)-producing Salmonella enterica serovar Virchow isolated in Belgium and in France from poultry, poultry products, and humans during the period 2000 to 2003. The ESBL-producing isolates were characterized by phage typing and pulsed-field gel electrophoresis (PFGE), and the mechanisms of resistance to ESC were studied.
|
|
|---|
In France, the French National Reference Center for Salmonella receives human Salmonella isolates for serotyping through its network comprised of approximately 1,500 voluntary hospitals or private clinical laboratories, which together represent 30% of all French clinical laboratories. Approximately 12,000 strains are characterized per year through the French National Reference Center for Salmonella.
Serotyping and phage typing. Serotyping of Salmonella isolates was carried out by slide agglutination with commercial antisera by the Kauffmann-White scheme (26). Phage typing was performed according to the recommendations of the Health Protection Agency Service (Colindale, United Kingdom) (33).
Antimicrobial susceptibility testing. Antibiotic susceptibility was tested on a representative part of the population of S. enterica serovar Virchow isolated from humans between 2000 and 2003 (155 tested out of 570 isolated in Belgium and 190 tested out of 923 isolated in France). All strains isolated from poultry and poultry products were tested.
For the Belgian isolates, the susceptibility to 13 antibiotics was determined by the disk diffusion method (Kirby-Bauer) following recommendations of the CLSI (formerly NCCLS) (21). The antibiotics tested were ampicillin, amoxicillin plus clavulanic acid, cefotaxime, chloramphenicol, tetracycline, nalidixic acid, ciprofloxacin, streptomycin, kanamycin, gentamicin, sulfonamides, trimethoprim, and trimethoprim plus sulfamethoxazole. Bio-Rad (Nazareth, Belgium) disks were used for Salmonella isolated from humans, and Rosco tablets (International Medical, Brussels, Belgium) were used for Salmonella isolated from poultry products and poultry. Interpretation of inhibition zones was performed according to the CLSI criteria, and quality control was performed using the Escherichia coli ATCC 25922 reference strain.
Antimicrobial susceptibility testing for French isolates was performed as described previously (36) using French Antibiogram Committee guidelines.
Multidrug resistance was defined according to Enter-net (international surveillance network for enteric infections, http://www.hpa.org.uk/hpa/inter/index.htm) as resistance to four or more antimicrobials (34).
MIC determination. MICs were determined using Etest (AB Biodisk, Solna, Sweden) according to manufacturer's instructions and CSLI guidelines (20). The following antimicrobial agents were used: ampicillin, ticarcillin, ticarcillin-clavulanic acid, piperacillin, piperacillin-tazobactam, cefoxitin, cefotaxime, ceftazidime, cefepime, aztreonam, and ciprofloxacin. The ESBL phenotype was detected by using the ESBL detection Etest strip (E-testESBL; AB Biodisk, Solna, Sweden) and the double-disk synergy method.
Molecular characterization of ß-lactamases. Total DNA was extracted using the InstaGene matrix kit (Bio-Rad) in accordance with the manufacturer's recommendations. CTX-M-specific PCR analysis was performed using forward primer CTX-M-F (5'-C(A/G)ATGTGCAG(C/T)ACCAGTAA-3') and reverse primer CTX-M-R (5'-CGC (A/G)ATATC(A/G)TTGGTGGTG-3'), which amplify a 540-bp internal fragment of blaCTX-M, as previously described (37). The PCR assay amplifying the entire coding sequence of blaCTX-M-2 was performed using forward primer CTX-M-2-F (5'-ATGATGACTCAGAGCATTCG-3') (located at positions 1 to 20 with respect to the CTX-M translational starting point) and reverse primer CTX-M-2-R (5'-TCAGAAACCGTGGGTTAC-3') (located at positions 876 to 859). The forward primer TEM-F (5'-ATAAAATTCTTGAAGACGAAA-3') and reverse primer TEM-R (5'-GACAGTTACCAATGCTTAATC-3') were used for amplification of blaTEM (37), and forward primer SHVfw (ATGCGTTATATTCGCCTGTG) and reverse primer SHVrev (TTAGCGTTGCCAGTGCTC) were used for amplification of blaSHV (29). All PCR amplifications were carried out as previously described (37), except that the annealing temperature was 52°C for blaCTX-M. The purified PCR fragments were sequenced on both strands by Genome Express (Meylan, France), using an ABI 3100 DNA sequencer (Applied Biosystems, Foster City, CA). The nucleotide sequence was analyzed with the Lasergene software (DNA Star, Madison, WI). The BLASTN program of NCBI (http://www.ncbi.nlm.nih.gov) was used for databases searches.
Preparation of crude extracts of ß-lactamase and IEF. Crude extracts of ß-lactamases from 10 CTX-M-2-producing strains (selected on the basis of the isolation year and their origin [human, poultry, or poultry product]) were obtained by sonication followed by 45 min of ultracentrifugation at 100,000 x g using a Beckman L8-55 M ultracentrifuge. Isoelectric focusing (IEF) was performed with a PhastSystem apparatus (Amersham-Pharmacia Biotech, Freiburg, Germany) as previously described (36).
Plasmid analysis. Plasmid transfer experiments were carried out in liquid medium with six selected isolates as previously described (37). These six isolates were selected on the basis of the isolation year and their origin. E. coli J5, which is resistant to rifampin, was used as the recipient strain. Transconjugants were selected on Drigalski agar supplemented with ceftiofur (10 mg/liter) and rifampin (250 mg/liter). Plasmid DNA was purified from E. coli transconjugants by an alkaline lysis procedure (32) and subjected to 0.8% agarose gel electrophoresis. DNA restriction fragment length polymorphisms were analyzed using agarose gel electrophoresis of plasmid DNA cleaved with EcoRI (Roche, Mannheim, Germany). Southern blotting using a blaCTX-M-2 probe was performed as described previously (22).
PCR amplification and sequencing of QRDR regions of gyrA, gyrB, and parC genes. After amplification of a fragment of the gyrA, gyrB, and parC genes containing the quinolone resistance-determining region (QRDR) as previously described (12), the fragments were sequenced on a CEQ 2000 DNA sequencer (Beckman Coulter, High Wycombe, United Kingdom), using the DTSC-2 method. The sequences were compared and analyzed by Genestream software (developed by Institut de Génétique Humaine, Montpellier, France).
Pulsed-field gel electrophoresis. Genomic DNA suitable for PFGE was prepared according to the PulseNet method (www.cdc.gov/pulsenet) and digested with the restriction endonuclease XbaI (New England Biolabs, Leusden, Netherlands). S. enterica serovar Braenderup H9812 was used as a size marker. We have randomly selected cefotaxime-resistant isolates (33 among the 101 CTX-M-2-producing S. enterica serovar Virchow isolates) from different years and from different origins (poultry, poultry products, and animals). All human CTX-M-2-producing isolates (11) were included in the typing. Five other S. enterica serovar Virchow strains originating from national collections (cefotaxime susceptible or cefotaxime resistant [see Fig. 3]) were used in this study as comparison isolates (independent isolates). FingerprintingII Informatix software (Bio-Rad) was used to compare the PFGE profiles. The bands generated were analyzed by using the Dice coefficient and the unweighted-pair group method using average linkages, using a tolerance of 1%.
![]() View larger version (65K): [in a new window] |
FIG. 3. (A) Representative XbaI PFGE patterns observed among CTX-M-2-producing S. enterica serovar Virchow isolates and among serovar Virchow isolates used as comparison isolates. Lane M, XbaI-digested DNA from S. enterica serovar Braenderup H9812, used as molecular size marker; lane 1, isolate 03-3832; lane 2, isolate 03-5167; lane 3, isolate 03-12787; lane 4, isolate 02-2928; lane 5, isolate 03-664; lane 6, isolate 518SA03; lane 7, comparison isolate 02-4352 (B/2002/H/TEM-52 ESBL, +*); lane 8, isolate 01-2133; lane 9, comparison isolate 02-4366 (B/2002/H/CTX-M-3 ESBL, +*); lane 10, comparison isolate 03-1324 (F/2003/H/nalidixic acid resistant, *); lane 11, comparison isolate 03-3111 (F/2003/H/nalidixic acid and ampicillin resistant, *); lane 12, comparison isolate 03-4256 (F/2003/H/pansusceptible, *). F, France; B, Belgium; V, veterinary isolate; H, human isolate. *, comparison isolate susceptible to cefotaxime; +*, comparison isolate resistant to cefotaxime. (B) Dendrogram generated by FingerprintingII Informatix software, showing the results of cluster analysis on the basis of PFGE fingerprinting. Similarity analysis was performed using the Dice coefficient, and clustering was by the unweighted-pair group method using average linkages. The different PFGE profiles (asterisks indicate profiles of comparison isolates), numbers of isolates, years of isolation, types of bla genes, and phage types are indicated. ND, not determined.
|
|
|
|---|
![]() View larger version (15K): [in a new window] |
FIG. 1. Percentage of S. enterica serovar Virchow strains isolated in Belgium from humans, poultry, and poultry products between 1999 and 2003. The percentages of S. enterica serovar Virchow strains isolated from poultry and poultry products show a significant increase over the years (P = 0.011 for poultry and P = 0.055 for poultry products), following similar trends (slopes are not significantly different). The linear regression lines, equations, and r2 coefficients are shown.
|
(iii) Humans. During the same period of time, 14 cephalosporin-resistant S. enterica serovar Virchow strains were isolated from stool samples of humans with gastroenteritis (two in 2001, three in 2002, and nine in 2003) in Belgium. In France, no ESC-resistant serovar Virchow strains of human origin were detected between 2000 and 2002, although 190 serovar Virchow strains were tested (Table 1). In 2003, three ESC-resistant strains were detected among the 100 serovar Virchow strains tested. These strains were recovered from three patients who suffered gastroenteritis but had no history of travel to Belgium. In both countries, the fraction of serovar Virchow among the total Salmonella isolated remained relatively stable in humans (approximately 1% in Belgium and 2% in France for the period 1999 to 2003) (Fig. 1). ESBL production was confirmed by double-disk synergy tests. While no data about the antibiotic regimens were available in Belgium, the three patients living in France were treated with ciprofloxacin or with extended-spectrum cephalosporins. All of the human cases arose sporadically in unrelated persons.
|
View this table: [in a new window] |
TABLE 1. Distribution of antibiotic resistance phenotypes in S. enterica serovar Virchow strains isolated from humans in Belgium and France between 2000 and 2003
|
Antimicrobial susceptibility. In 2003, in Belgium, multidrug resistance to at least four unrelated antibiotics (35) was quite common among S. enterica serovar Virchow isolates (50% of human isolates) (Table 1); 63.6% of these isolates showed resistance to at least five antibiotics (ampicillin, tetracycline, trimethoprim, nalidixic acid, and sulfonamides) (Table 1). Nalidixic acid resistance in human strains doubled during the period 2000 to 2003 in Belgium (46% in 2000 and more than 84% in 2003).
Antimicrobial susceptibility was determined for all 104 ESBL-producing strains. All the isolates displayed coresistance to tetracycline, trimethoprim, nalidixic acid, and sulfonamides and showed a reduced susceptibility to ciprofloxacin (MICs of between 0.5 and 1 µg/ml).
The ß-lactam susceptibility phenotype was determined for all the ESBL-producing strains. Table 2 shows characteristics of selected isolates. These strains were highly resistant to ampicillin (MICs of
256 µg/ml), cefotaxime (MICs of
256 µg/ml), cefepime (MICs of between 16 and 256 µg/ml), and to a lesser extent to aztreonam (MICs of between 16 and 64 µg/ml). The strains appeared to be partially susceptible or completely susceptible to ceftazidime (MICs of between 4 and 8 µg/ml) and susceptible to imipenem (MICs of between 0.25 and 0.5 µg/ml). The activities of piperacillin and, in some cases, of ticarcillin were partially restored by inhibitors such as tazobactam or clavulanic acid (data not shown). The synergy between cefotaxime and tazobactam or clavulanic acid confirmed the production of an ESBL. The higher levels of resistance to cefotaxime versus ceftazidime as well as the resistance to cefepime corresponded well with the resistance phenotype conferred by the CTX-M-type ESBLs in Salmonella strains as previously described (24).
|
View this table: [in a new window] |
TABLE 2. Susceptibilities, ß-lactamase characterization, PFGE profiles, and phage types of selected S. enterica serovar Virchow isolates under study
|
Determination of resistance genes for ß-lactams and quinolone resistance mutations. In order to determine the nature of the ß-lactamases produced, PCR amplifications specific for ß-lactamase genes of the TEM, SHV, and CTX-M families were performed. TEM and CTX-M consensus PCR assays gave the expected PCR fragments (respectively, 1,080 bp and 540 bp) for all isolates tested. All SHV amplifications were negative. PCR product sequence analysis of 101 S. enterica serovar Virchow strains of the 104 isolates revealed 100% identity with the blaTEM-1 and blaCTX-M-2 sequences (GenBank accession numbers AF427132 and AJ427469). Specific CTX-M-2 gene amplifications also confirmed the sequence analysis (data not shown). Two human Belgian isolates from 2002 harbored the blaTEM-52 or blaCTX-M-3 gene, and one strain isolated in France in 2003 harbored the blaCTX-M-9 gene. We further characterized only the CTX-M-2-producing strains.
To characterize the molecular basis of the reduced susceptibility to ciprofloxacin of the ESBL-producing strains, the QRDRs of the gyrA, gyrB, and parC genes of 15 representative isolates of different origins were subjected to PCR amplification and subsequent sequencing. For all of the isolates tested, only one mutation, leading to a Ser83-to-Phe substitution (TCC
TTC), was identified in gyrA.
IEF. IEF revealed the production of ß-lactamases with isoelectric points of 5.4 and 7.9 in all isolates (Table 2), which confirmed that two enzymes, one of the TEM family (pI 5.4) and one of the CTX-M family (pI 7.9), might be responsible for the phenotypes.
Transfer of resistance and plasmid analysis. Resistance transfer experiments were carried out in liquid medium with E. coli J5 (Rifr) as the recipient strain. E. coli transconjugants were obtained for all six selected S. enterica serovar Virchow isolates (142SA01, 1639SA00, 02-2928, 03-1902, 03-664, and 03-5167) of animal or human origin. All other resistance determinants, except nalidixic acid resistance, were cotransferred with the cefotaxime resistance determinant. Plasmid extraction from all transconjugants revealed a high-molecular-weight plasmid (>100 kb) (data not shown). EcoRI restriction analysis showed that all conjugative plasmids had very similar fingerprints (Fig. 2). Southern blot hybridization with a blaCTX-M-2 probe confirmed the presence of the cefotaxime resistance gene on an approximately 6-kb EcoRI fragment (Fig. 2).
![]() View larger version (57K): [in a new window] |
FIG. 2. Restriction analysis (EcoRI) (A) and Southern blot hybridization with a blaCTX-M-2 probe (B) of plasmid DNAs isolated from E. coli transconjugants. Lanes M, markers (SmartLadder; Eurogentec, Seraing, Belgium); 1, E. coli transconjugant p142SA01-1; 2, E. coli transconjugant p1639SA00-1; 3, E. coli transconjugant p02-2928-1; 4, E. coli transconjugant p03-1902-1; 5, E. coli transconjugant p03-664-1; 6, E. coli transconjugant p03-5167-1. All lanes are from the same gel.
|
PFGE. XbaI macrorestriction and PFGE were used to determine the genetic relatedness of the cefotaxime-resistant S. enterica serovar Virchow isolates (Fig. 3A and B). Three distinct profiles were observed among the 33 cefotaxime-resistant isolates tested (Fig. 3B). Thirty-one of these isolates displayed the same restriction fragment profiles (X1), confirming the relatedness among the cefotaxime-resistant isolates. The second profile (differing by four bands) was represented by only one strain, isolated from a broiler in 2003 (X4). The third profile was observed in one human strain in 2001 (X2). The comparison isolates displayed profiles totally different from those shown by the CTX-M-2-producing isolates.
|
|
|---|
All ESC-resistant human strains from Belgium caused self-limiting gastroenteritis. The two patients living in Paris were treated first unsuccessfully with extended-spectrum cephalosporins, followed by successful treatment with ciprofloxacin. With the exception of two strains isolated around Paris, all the ESBL (CTX-M-2)-producing strains were geographically clustered in northeast Belgium.
In this study, we report the clonal spreading of a strain carrying a large plasmid that harbored all resistance genes detected in the isolates with the exception of nalidixic acid resistance. During the last decade, the role of conjugative plasmids in the wide dissemination of antibiotic resistance genes has been increasingly reported in the literature (7, 13, 16).
While the origin of the first CTX-M-2-producing isolate remains unknown, the chronology of isolation of the resistant strains argues for a selection in poultry flocks and subsequent dissemination in humans via the food chain. Few studies have shown this way of spread of ESBL-producing S. enterica strains (25). Most commonly, the reports describe nosocomial outbreaks due to ESBLs in the genus Salmonella (14). The selection in poultry flocks might be attributable to the use of antimicrobial agents in these animals (5).
In Belgium, ceftiofur was approved in April 1990 for use by injection in 1-day-old chicks to prevent septicemia caused by E. coli. However, since maximum levels for ceftiofur residues in poultry meat were not established, the drug was withdrawn from the Belgian market on 1 January 2000. Presently, two ESC are still approved as therapeutic agents for systemic use in food-producing animals in Belgium: cefquinome (in 1998) and ceftiofur (in 1997), which are approved for use in cattle and pigs but not for use in poultry.
The emergence of Salmonella isolates that are resistant to ESC has already been reported worldwide. This resistance is frequently attributed to the production of various plasmid-encoded extended-spectrum ß-lactamases, including the TEM, SHV, PER, and CTX-M enzymes (24, 30). In the present study, the ESC-resistant isolates produced CTX-M-2 ESBL enzymes. In Belgium, two other S. enterica serovar Virchow strains (producing, respectively, TEM-52 and CTX-M-3 enzymes) were also isolated in humans during this period. In France in 2003, one and eight CTX-M-9-producing S. enterica serovar Virchow strains were isolated from a human and from poultry, respectively (37).
CTX-M ß-lactamases usually confer high-level resistance to aminopenicillins (e.g., ampicillin or amoxicillin), carboxypenicillins (e.g., ticarcillin), ureidopenicillins (e.g., piperacillin), and narrow-spectrum cephalosporin. The susceptibilities of bacteria to 7-
-methoxy cephalosporins (cefoxitin) and carbapenems (e.g., imipenem), however, are unchanged (4). This group of enzymes is one of the most frequently encountered ESBL types in Salmonella spp. (15). The CTX-M-2 ß-lactamase was first identified in S. enterica serovar Typhimurium in Buenos Aires, Argentina, in 1990 (3). More recently, 34 cefotaxime-resistant S. enterica serovar Typhimurium strains were identified in seven regions of Russia and Belarus (10). Their resistance to ESC was attributed to the production of CTX-M-4- and CTX-M-5-like ß-lactamases, both belonging to the CTX-M-2 family (24). In 2002, CTX-M enzymes belonging to groups 1, 2, and 9 also emerged in human E. coli strains in Belgium (27).
In addition to ESBL production, all isolates displayed a decreased susceptibility to ciprofloxacin (MIC of between 0.5 and 1 µg/ml). This resistance was associated with one substitution in the GyrA protein at Ser83, which is the most frequently observed in Salmonella (9, 34). In members of the Enterobacteriaceae, resistance to quinolones is generally acquired in a two-step mutation process. A first mutation in the QRDR of the gyrA gene mediates full resistance to narrow-spectrum quinolones such as nalidixic acid and decreased susceptibility to fluoroquinolones. This is why the measurement of susceptibility to nalidixic acid is used as an indicator for the detection of low-level resistance to ciprofloxacin. A second mutation in one of the gyrA, parC, or gyrB genes mediates full resistance to fluoroquinolones (6). Another important mechanism of decreased susceptibility to fluoroquinolones may be active efflux due to overproduction of the AcrAB efflux pump. This mechanism was shown to play a major role in the high-level fluoroquinolone resistance of S. enterica serovar Typhimurium DT204 strains carrying multiple target gene mutations in gyrA, gyrB, and parC (2). Because the isolates in this study did not show full resistance to ciprofloxacin (MICs of between 0.5 and 1 µg/ml), the existence of an efflux mechanism was not investigated.
At the present time, ciprofloxacin is one of the most potent antimicrobials available for medical treatment of invasive gastrointestinal infections in adults (8). Even a decreased susceptibility to fluoroquinolones has become a major problem in medical practice. For example, Aarestrup et al. (1) reported several treatment failures in patients infected by Salmonella isolates due to a decreased susceptibility to fluoroquinolones (1). Generally, fluoroquinolones are not recommended to treat salmonellosis in young children due to the drugs' potential secondary effects on cartilage development. Recently, however, these drugs have been used successfully without secondary effects in both immunocompromised children and children suffering from multidrug-resistant gram-negative bacterial infections (including neonatal infections and multidrug-resistant enteric infections caused by Salmonella and Shigella spp.) (17). This result could be of importance for treatment of bacteremia due to ESBL-producing S. enterica serovar Virchow in children. The tendency of serovar Virchow to invade the bloodstream and to cause systemic disease in previously healthy children and infants was recently reported in the United Kingdom, Spain, Greece, and Australia (38); however, the reason for this phenomenon remains unclear. Because of the propensity of this serovar to cause invasive disease, resistance to therapeutically important antibiotics is of particular concern.
In conclusion, we have documented that S. enterica serovar Virchow producing CTX-M-2 ESBL was identified first in poultry flocks, then in poultry meat, and subsequently in humans in Belgium (and France) over the time period 2000 to 2003. The chronology of isolation of this strain suggests that these bacteria were transmitted to humans via the food chain, specifically by poultry meat. The appearance of decreased susceptibility to fluoroquinolones and resistance to extended-spectrum cephalosporins in animal, food, and human Salmonella isolates constitutes a major concern, since such strains could disseminate on a large scale and jeopardize classical antibiotic therapy. An efficient and vigilant surveillance system for antimicrobial drug resistance, especially in animal strains, is therefore essential to detect any trend in the short and long terms.
In Belgium, this work was financed in part by the Federal Public Service Health, Food Chain Safety and Environment and in part by the Federal Agency for the Safety of the Food Chain.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»