Previous Article | Next Article ![]()
Journal of Clinical Microbiology, August 2006, p. 2914-2920, Vol. 44, No. 8
0095-1137/06/$08.00+0 doi:10.1128/JCM.00568-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Division of Oral Microbiology and Immunology, Department of Operative and Preventive Dentistry and Periodontology, and Department of Medical Microbiology, RWTH Aachen University Hospital, Aachen, Germany,1 R. M. Alden Research Laboratory, Santa Monica, California 90404,2 UCLA School of Medicine, Los Angeles, California 900733
Received 16 March 2006/ Returned for modification 13 May 2006/ Accepted 4 June 2006
|
|
|---|
|
|
|---|
Despite their recent discovery at various infected sites in the oral cavity (14, 19), human-associated SGOs have remained largely uncharacterized. In order to extend our knowledge of their ubiquity and phylogenetic diversity, we looked for possible candidates from the clinical culture collection of the R. M. Alden Research Laboratory, Santa Monica, Calif., focusing on isolates that could not be biochemically identified as members of any previously described species. The seven strains that we found constitute distinct lineages within the division of Synergistes. Here we provide a phylogenetic characterization of these isolates along with a first profile of biochemical activity and antimicrobial susceptibility. We have also developed a specifically targeted 16S rRNA gene PCR system to directly assess the incidence and phylotypes of SGOs in various human sites, such as feces and subgingival plaque.
|
|
|---|
Biochemical testing. Biochemical tests performed at the R. M. Alden Research Laboratory included determination of susceptibility to special potency disks of kanamycin (1,000 µg), vancomycin (5 µg), and colistin (10 µg) as well as catalase, spot indole, nitrate reduction, growth on bile, urease, growth stimulation with formate/fumarate, and SIM (sulfide-indole-motility), as described previously (22). In addition, an enzymatic profile was determined using the RapID ANA II system (Remel, Lenexa, KS) according to the manufacturer's instructions.
Antimicrobial testing. All SGOs were tested against 14 antimicrobial agents, including ampicillin-sulbactam (Pfizer, Roerig Division, Groton, CT); amoxicillin-clavulanate and ticarcillin-clavulanate (Glaxo SmithKline, Philadelphia, PA); piperacillin-tazobactam (Wyeth Laboratories, Pearl River, NY); ertapenem, imipenem, and cefoxitin (Merck & Co., Rahway, NJ); ceftriaxone (Roche Laboratories Inc., Nutley, NJ); moxifloxacin (Bayer Corporation, Mt. Prospect, IL); levofloxacin (Johnson & Johnson, Springhouse, PA); chloramphenicol and penicillin (Sigma, St. Louis, MO); clindamycin (Voigt Global Distributing, Kansas City, MO); and metronidazole (Searle Inc., Skokie, IL). Antimicrobial powders were reconstituted according to the manufacturers' instructions, and serial twofold dilutions were made to prepare the plates. Susceptibility testing was performed by the standard agar dilution method according to the procedure described in CLSI (formerly NCCLS) M11-A6 (3).
Collection of fecal and oral samples. Fecal and oral samples were collected for cultivating-independent molecular methods-based screening of SGOs. (i) Fecal samples were obtained from three healthy adult subjects. The donating individuals, one female (age 47) and two males (age 26 and 33), were without special diet and were free of medication. (ii) Subgingival plaque was initially investigated from three patients with chronic periodontal disease (CP) and from two patients with aggressive periodontal disease (AP). From these five plaque samples two samples, CP1177 and AP1156, were selected to generate clone libraries for detailed analysis. Sample CP1177 was obtained from a periodontal pocket of a 45-year-old male with a pocket depth of 6 mm, while AP1156 was obtained from a periodontal pocket of a 53-year-old male with a pocket depth of 7 mm.
DNA extraction. Microbial DNA from subgingival plaque and fecal samples, as well as DNA from pure cultures, was extracted and purified with a Qiamp DNA Mini kit ("tissue protocol"; QIAGEN, Hilden, Germany) according to the manufacturer's instructions, with one modification: 0.8 g of zirconia-silica beads (0.1 mm in diameter; Biospec, Bartlesville, OK) was added prior to the addition of Proteinase K. Samples were then agitated in a FastPrep FP 120 instrument (Qbiogene, Carlsbad, CA) at 6.5 m/s for 45 s. All further steps followed the original protocol. The DNA concentration (A260) and the purity (A260/A280) were calculated using a Gene Quant II photometer (Pharmacia Biotech, Cambridge, England).
Probe design. The 16S forward primer Syn360F (5' GGAATATTGGGCAATGGG 3'), starting at Escherichia coli position 360, as well as the 16S reverse primer Syn961R (5' GTTCTTCGGTTTGCATCG 3'), starting at Escherichia coli position 961, were designed based on regions of identity within 16S rRNA genes following the alignment of 75 Synergistes sequences (including the isolates from this study) and using the function "probe design" of the ARB software package (10). The primers were tested for possible cross-hybridization with the 16S rRNA genes of bacterial strains unrelated to the Synergistes division: Actinobacillus actinomycetemcomitans (ATCC 33384T), Actinomyces gerencseriae (ATCC 23860T), Capnocytophaga ochracea (ATCC 33596T), Fusobacterium nucleatum (ATCC 25586T), Haemophilus aphrophilus (ATCC 33389T), Peptoniphilus asaccharolyticus (MCCM 027677), Porphyromonas gingivalis (ATCC 33277T), Prevotella intermedia (ATCC 25611T), Prevotella nigrescens (ATCC 33563T), Stomatococcus mucilaginosus (MCCM 00293), and Tannerella forsythensis (ATCC 43037T), as well as four fecal isolates, Bacteroides fragilis AC-1, Clostridium perfringens AC-2, Enterococcus faecalis AC-3, and Escherichia coli AC-4, obtained from the Department of Medical Microbiology, University Hospital RWTH Aachen, Germany. Using the PCR temperature profile outlined below, no PCR product was obtained for these non-target bacterial strains.
PCR amplification. For generating almost complete 16S rRNA gene information of approximately 1,400 bp in length from Synergistes strains, PCR amplification of the 16S rRNA gene was performed on an Eppendorf thermocycler (Mastercycler personal) in a volume of 50 µl containing 1x PCR buffer, 1.5 mM MgCl2, 2 U Taq polymerase, 0.2 mM each of dATP, dCTP, dGTP, and dTTP (Roche Applied Science, Penzberg, Germany), 100 nM of each primer, and 1 µl of template DNA (approximately 50 ng). Universal primers used were PF1 (5' AGAGTTTGATCCTGGCTCAG 3') and PR1 (5' GGCTACCTTGTTACGACTT 3') (20), with PCR cycling conditions of 94°C for 2 min, followed by 25 cycles of 94°C for 60 s, 55°C for 60 s, and 72°C for 1.5 min, with a final extension of 72°C for 10 min.
Amplification and detection of Synergistes 16S rRNA genes from total community DNA directly extracted from oral samples (periodontal pockets) was performed on a LightCycler 2.0 (Roche Applied Science) using LightCycler FastStart DNA Masterplus SYBR Green I in a total volume of 20 µl. Final reactions contained 100 nM of the primers Syn360F and Syn961R (see above) and 1 µl of template DNA (approximately 50 ng) to give an approximately 600-bp amplification product. PCR cycling conditions included a "touch-down" temperature profile of 95°C for 10 min, followed by 10 cycles of 95°C for 10 s, 66°C for 7 s (with a decrease of 0.2°C after each cycle), 72°C for 25 s, and 40 cycles each of 95°C for 10 s, 64°C for 7 s, and 72°C for 25 s. Melting curve analysis was performed to determine the melting point of the amplification products and to assess reaction specificity. The presence of single DNA bands of the expected size was also confirmed by agarose gel electrophoresis.
Finally, for the amplification and detection of Synergistes 16S rRNA genes from total community DNA directly extracted from fecal samples, a nested PCR approach was necessary. The first round of amplification was performed using the universal primers PF1 and PR1 under the conditions described above with 1 µl of template DNA (approximately 50 ng). Likewise, the second round of amplification (nested PCR) was performed using the primers Syn360F and Syn961R under the conditions described above, using as template 1 µl of the PCR product from the first round.
Cloning and sequencing. PCR products were cloned using a TOPO TA cloning kit (Invitrogen Corp., San Diego, CA) following the protocol of the manufacturer. The preparation of plasmid DNA of randomly selected clones, PCR amplification of cloned inserts, and nonradioactive sequencing were carried out as described previously (20). Prior to sequencing, PCR products were purified using the QIAGEN Purification kit according to the manufacturer's instructions. Bidirectional sequencing was performed using a Big Dye-Deoxy terminator cycle sequencing kit (Applied Biosystems) and an automatic capillary DNA sequencer (API Prism 310; Applied Biosystems). While the sequences for the clinical isolates and for the fecal samples could be determined by direct sequencing (i.e., without cloning) of the respective PCR products, sequences for the periodontal samples were determined from cloned PCR products, as direct sequencing led to ambiguous sequences.
Phylogenetic analysis. The identities of the 16S rRNA gene sequences were confirmed by searching the international sequence databases using the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST/). Sequences were subsequently integrated within the ARB program package (10) and analyzed and edited using its alignment tools. Phylogenetic tree reconstruction was done using the neighbor-joining approach with Jukes Cantor correction. The robustness of the tree topology was verified through calculating bootstrap values for the neighbor-joining tree and through comparison with the topology of a maximum likelihood tree, calculated by using the default settings in ARB.
Nucleotide sequence accession numbers. The gene sequences determined in this study (i.e., 16S rRNA gene sequences of clinical isolates, fecal samples, and periodontal clones) have been deposited in the EMBL, GenBank, and DDBJ nucleotide sequence databases under accession numbers DQ412708 to DQ412725.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Biochemical reaction of clinical isolates phylogenetically belonging to the Synergistes division and other taxaa
|
0.06 to 4 µg/ml; breakpoints for anaerobes have yet to be established), chloramphenicol, clindamycin, and metronidazole. However, in contrast to the soft-tissue isolates (RMA 10849 and 14551), the five levofloxacin-susceptible isolates of intestinal origin were resistant to moxifloxacin (MICs,
8 µg/ml). In addition, one isolate (RMA 14605) was penicillin resistant (MIC > 4 µg/ml) and nonsusceptible (intermediate) to piperacillin-tazobactam (MIC = 64 µg/ml). Phylogenetic analysis of novel strains. Phylogenetic analysis was based on nearly full-length sequences (approximately 1,400 bp), except for strains RMA 16406 and RMA 15677 (approximately 500 bp). The identities of all sequences as belonging to the division Synergistes were confirmed by searching the GenBank database. Phylogenetic tree reconstruction was performed by including a representative set of publicly available reference sequences. Figure 1 depicts the evolutionary relationships of the clinical isolates at the interdivision level, while Fig. 2 shows the phylogenetic relationships among Synergistes sequence types. The five strains isolated from peritoneal fluid formed a coherent cluster (cluster I) moderately related to Synergistes jonesii, with approximately 85% similarity (Fig. 2). Within this cluster, strains RMA 16088, RMA 14605, and RMA 15677 grouped tightly with each other, while strains RMA 16406 and RMA 16290 showed a similarity of approximately 95% to the other three strains. In contrast, strain RMA 14551 (diabetic foot) formed a distinct lineage distantly related to cluster I and with approximately 82% similarity to the oral strain Synergistes sp. strain P4G_18 as its closest relative. Likewise, strain RMA 10849 (sacral wound) branched separately, showing a similarity of approximately 90% to its closest relative, the oral isolate E3_33 (deposited in the GenBank database as "Flexistipes sp. E3_33"). Although they represent different lineages, strains RMA 14551 and RMA 10849 shared a common interior branching point with a sequence similarity of approximately 78% and were thus together designated cluster II. In summary, all seven clinical isolates fell within the phylogenetic radiation of Synergistes and represented at least three distinct evolutionary lineages (Fig. 1 and 2).
![]() View larger version (16K): [in a new window] |
FIG. 1. Evolutionary distance tree showing novel Synergistes isolates and clones in relation to representatives of major bacterial division lineages. Sequences determined in this study are depicted as triangles. The tree was constructed using the ARB software package (neighbor-joining, Jukes Cantor correction). The statistical significance levels of interior nodes shown as percentages were determined by performing bootstrap analyses (1,000 replications; only values over 50% are shown). The scale bar corresponds to 0.1 substitutions per nucleotide.
|
![]() View larger version (21K): [in a new window] |
FIG. 2. Evolutionary distance tree showing novel isolates and clones in relation to representative sequences from the Synergistes and Flexistipes divisions. Sequences determined in this study are shown in boldface type or are combined in triangles when clustering tightly together. Numbers within triangles refer to the number of clones. The tree was constructed using the ARB software package (neighbor-joining, Jukes Cantor correction). The statistical significance levels of interior nodes shown as percentages were determined by performing bootstrap analyses (1,000 replications; only values over 50% are shown). The scale bar corresponds to 0.1 substitutions per nucleotide.
|
Periodontal pocket samples from five different patients were also collected and analyzed. In contrast to human fecal DNA samples, all periodontal samples yielded PCR products with correct fragment sizes directly through PCR with Synergistes-specific primers. However, ambiguity-free sequences could not be obtained by direct sequencing of the PCR products, which indicated the presence of multiple sequence types. We therefore generated clone libraries from two samples (AP1156 and CP1177) and sequenced randomly selected clones (five clones per clone library). GenBank database research affirmed the affiliation of all sequence types to Synergistes, which, after phylogenetic tree reconstruction, were grouped in a separate cluster forming a unique line of descent with no close relationship to any previously cultured species (Fig. 2, cluster III). Periodontal sequences were split into two subbranches, with seven clones grouping together (including all clones from sample CP1177), sharing approximately 96% similarity to the second periodontal subgroup (groups depicted as triangles) as well as to oral clone sequence types determined in other studies (Fig. 2). The overall similarity of cluster III to cluster I and cluster II was approximately 80%.
|
|
|---|
In contrast to the cluster I isolates, strains of cluster II were from soft-tissue infections. The fact that both strains were found in mixed cultures (strain RMA 14551 with Aerococcus species, Morganella morganii, Proteus mirabilis, Staphylococcus epidermidis, and Porphyromonas somerae; strain RMA 10849 with alpha-hemolytic streptococci, Anaerococcus tetradius, Finegoldia magna, and Porphyromonas asaccharolytica) makes it difficult to assess the origin or the principal habitat of these SGOs.
SGOs from the periodontal pockets formed a phylogenetically separate cluster (cluster III), remote from cluster I and II but related to sequence types found in 16S rRNA gene molecular inventories from the oral microflora (7, 15). While the sequence diversity among clones from sample CP1177 is low and might reflect interoperon variability of one particular strain, sample AP1156 consisted of at least two different phylotypes within cluster III (Fig. 2). However, the diversity of oral SGOs is even greater, since two other (not further described) strains, "Synergistes sp. P4G_18P1" (W. G. Wade and A. de Lillo, unpublished) and "Flexistipes sp. E3_33" (15), were both isolated from the oral cavity grouped within cluster II (Fig. 2). In fact, they were the closest relatives to the soft-tissue strains RMA 14551 and RMA 10849, respectively (Fig. 2). Interestingly, cluster II shares a common interior branching point with cluster I (Fig. 2; tree topology being supported by a maximum likelihood tree). This means that the oral SGOs from cluster II are actually more closely related to the isolates from soft-tissue infections, and also to the SGOs from peritoneal fluid, rather than to their oral "partners" from cluster III. This in turn indicates the high number of Synergistes phylotypes that can be found in the oral cavity, which apparently provides several ecological niches and as such might be one major reservoir of genetic diversity for human SGOs.
Sequence-based detection of SGO. The seven clinical isolates described in this study (i.e., clusters I and II) demonstrate that at least some members of these clades are cultivable in the clinical laboratory. However, so far no cultured isolates have been described for cluster III, which is exclusively represented by clone sequences, and the ability of clinical laboratories to culture these various human phenotypes may be limited. In addition, besides being slow growing, the clinical isolates reported here proved to be biochemically inert (Table 1), which constitutes a potential for misclassification when using biochemical test kits such as the RapID-ANA System (Table 1). Thus, molecular methods-based approaches may be the method of choice both for enhancing our understanding of the range and nature of human-associated SGOs and for identifying potential clinical isolates.
We developed an rRNA primer system with intended target specificity for Synergistes and were able to demonstrate the presence of different phylotypes in periodontal pockets and in human feces. This primer system appears to have advantages over the primer pair used by Godon et al. (4), since the latter did not detect SGOs in human feces even when nested PCR had been performed. Furthermore, in contrast to Godon et al. (4), our assay detects a relatively small 16S rRNA gene fragment of approximately 600 bp in size, sufficient for genotypic identification but also suitable for quantification using real-time PCR (RTQ-PCR).
In a first attempt, we quantified SGOs in the fecal and the oral samples by RTQ-PCR using our specific primer pair, along with determination of the total microbial flora using a broad-ranged primer pair as previously described (20 and data not shown). The proportion of SGOs relative to the total microbiota was 0.01% in the fecal sample and 0.04% in the oral samples. These values are consistent with the findings of Godon et al. (4), who found SGOs in a large variety of anaerobic ecosystems with an abundance below 1% according to the detection frequency in clone libraries. However, as determined by cultivation, the proportions of SGOs in peritoneal fluid and soft-tissue infections was higher, ranging from 0.5% to 20% according to the number of CFU of SGOs and total bacterial flora. These preliminary observations provide some support for claiming that SGOs may have a role as human pathogens. Work is currently under way to deeply assess the quantity of SGOs in defined anaerobic infectious processes (e.g., endodontic infections) by RTQ-PCR.
Final considerations. SGOs in humans are most likely involved in the anaerobic metabolism of protein amino acids, as most cultivated strains have been shown to degrade amino acids (2, 4, 11). For instance, Synergistes jonesii, the closest relative to the isolates of cluster I, uses arginine and histidine as major energy-yielding substrates (13) and is able to detoxifiy non-protein amino acids, such as dihydroxypyridine, in the rumen of cattle (1). Since many plants produce a variety of potentially toxic amino acids (4), niche specialization of distinct groups of SGOs in plant eaters (including humans) might be in part a function of the host's diet. Such niche adaptation might be associated with the broad diversity of SGOs throughout several environmental habitats (4). The present study expands the view of Synergistes as a diverse and ubiquitous member of the human-associated bacterial ecosystem. The novel culture isolates now available will enable us to study their physiological properties, helping define the role that Synergistes isolates might play as human colonizers or pathogens.
This work was supported in part by a grant from LCL Biokey GmbH, Aachen, Germany, and the START program of the Faculty of Medicine, RWTH Aachen, Germany.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»