Previous Article | Next Article 
Journal of Clinical Microbiology, September 2006, p. 3201-3207, Vol. 44, No. 9
0095-1137/06/$08.00+0 doi:10.1128/JCM.00656-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
An Outbreak of Keratitis Caused by Mycobacterium immunogenum
Jorge Luiz Mello Sampaio,1,3*
Doraldo Nassar Junior,2
Denise de Freitas,2
Ana Luisa Höfling-Lima,2
Kozue Miyashiro,3
Fernando Lopes Alberto,3 and
Sylvia Cardoso Leão1
Departamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de São Paulo, São Paulo, Brazil,1
Departamento de Oftalmologia, Universidade Federal de São Paulo, São Paulo, Brazil,2
Instituto Fleury de Ensino e Pesquisa, São Paulo, Brazil3
Received 27 March 2006/
Returned for modification 7 June 2006/
Accepted 11 July 2006
 |
ABSTRACT
|
|---|
From 8 October to 12 November 2003, 36 patients underwent surgical correction of myopia in a São Paulo, Brazil, clinic. Five patients had clinical signs of infectious keratitis, and a Mycobacterium species with previously unreported patterns determined by PCR restriction enzyme analysis of the hsp65 gene and PCR restriction enzyme analysis of the 16S-23S rRNA internal transcribed spacer (ITS) was isolated from corneal scrapings from four of these patients. Subsequent evaluation by phenotypic tests and partial sequencing of the hsp65, sodA, rpoB, and 16S rRNA genes and the ITS supported the species identification as a variant of Mycobacterium immunogenum. The source of infection was not determined. The outbreak was caused by a single clone, as evidenced by identical pulsed-field gel electrophoresis and enterobacterial repetitive intergenic consensus-PCR profiles. This is the first report of an outbreak where this species was isolated from infected tissues.
 |
INTRODUCTION
|
|---|
Species belonging to the Mycobacterium chelonae-abscessus group have been isolated from many environmental sources, including potable water and distribution systems, swimming pool water, metalworking fluids, and soil (9, 28, 30). Their ability to survive starvation, the resistance to free chlorine or glutaraldehyde observed in some strains, and their ubiquity in the environment create favorable conditions for the occurrence of infections when sterility precautions or disinfection procedures are disregarded (29, 30). Many health care-associated outbreaks caused by M. abscessus or M. chelonae have been documented since the first report in 1969 (12). "Mycobacterium massiliense" and "Mycobacterium bolletii" have been recently described and proposed as M. chelonae-M. abscessus group members, but to date there are no reports concerning their isolation from environmental samples (1, 4). Mycobacterium immunogenum is a recently described rapidly growing species of the M. chelonae-M. abscessus group and occupies the same ecological niche as other M. chelonae-M. abscessus group members. Clinical isolates include those causing disseminated cutaneous infections, catheter-related infections, septic arthritis, chronic pneumonia, pacemaker-related sepsis, and possible keratitis (17, 31). A single genotype was isolated from metalworking fluids at 10 different sites in six states in the United States, where hypersensitivity pneumonitis occurred among metal-grinding machinists, but M. immunogenum was not isolated from those patients (28). This species caused pseudo-outbreaks related to bronchoalveolar lavage procedures in Missouri and Maryland, but to date no reports of outbreaks of infections caused by this species have emerged (31). From 8 October to 12 November 2003, 36 patients71 eyeshad laser in situ keratomileusis (LASIK) performed in a private clinic located in the urban area of the city of São Paulo, Brazil. Among those patients, five had clinical signs of infectious keratitis, and a Mycobacterium species with a distinct PRA-hsp65 (PCR restriction enzyme analysis of the hsp65 gene) pattern was isolated from corneal scrapings from four of these patients. An epidemiological investigation was undertaken, and species identification was done by partial sequencing of multiple gene targets.
 |
MATERIALS AND METHODS
|
|---|
Epidemiological study.
A retrospective cohort study was conducted. All patients who underwent LASIK from 8 October to 12 November 2003 were followed up for 6 months after surgery. Any patient who had LASIK and presented with a corneal opacity was defined as a possible case of keratitis due to rapidly growing mycobacteria (RGM). Confirmed cases were those with a corneal scraping culture positive for RGM. The surgical procedures and sterilization process used were reviewed.
Environmental investigation.
In December 2003, samples of tap water, anesthetic solution, povidone iodine solution, nonsurgical soap, commercial distilled water, water from the reservoir of a bench-top autoclave, and water from the air conditioning system drain were collected. The samples were first concentrated and decontaminated with N-acetylcysteine sodium hydroxide and then plated on Middlebrook 7H10 agar. The plates were incubated in ambient air at 30°C and observed weekly for 1 month.
Cultivation of corneal scrapings and Ziehl-Neelsen staining.
Corneal scrapings were collected with a Kimura spatula after topical anesthesia and plated directly on sheep blood agar, chocolate agar, and Sabouraud dextrose agar plates and in thioglycolate medium. Inoculated media were then incubated in ambient air at 35°C and observed daily for 2 weeks. Slides with corneal smears or bacterial smears were stained by the Ziehl-Neelsen method as described elsewhere (6).
Phenotypic tests.
Sodium chloride tolerance; utilization of citrate, mannitol, and sorbitol; growth rate; and pigment production were determined after incubation in ambient air at 30°C as described by Vincent et al. (27).
Susceptibility testing.
Susceptibility to amikacin, tobramycin, doxycycline, ciprofloxacin, and clarithromycin was assessed by broth microdilution according to CLSI document M24-A (7). Staphylococcus aureus ATCC 29213 (ATCC is a trademark of the American Type Culture Collection) was used as a quality control strain.
Genomic DNA extraction.
Genomic DNA was extracted from bacteria grown on solid media as described by Sampaio et al. (21). DNA concentration was estimated by spectrophotometry with GeneQuant (Pharmacia).
Amplicons of the 16S-23S rRNA internal transcribed spacer for sequencing reactions and restriction enzyme analysis (PRA-ITS).
The ITS fragment was amplified and sequenced with primers SP1 (5'ACCTCCTTTCTAAGGAGCACC) and SP2 (5'GATGCTCGCAACCACTATCCA) as previously described (20), except that Platinum Taq DNA polymerase (Invitrogen) was used and amplicons were digested separately with HaeIII, HhaI, or TaqI (Invitrogen) and then separated by electrophoresis in 2% Metaphor-1% SeaKem LE agarose gels (BioWhittaker Molecular Applications Inc.). PRA-ITS genotypes were assigned after estimation of fragment sizes by the BioNumerics program (Applied Maths). The interpretative criteria used were those of Roth et al. (20). Clinical isolates of M. chelonae ITS genotype II (F436), M. abscessus ATCC 19977, and M. immunogenum ATCC 700505 were used as controls.
PCR and restriction enzyme analysis of the hsp65 gene (PRA-hsp65).
A 441-bp fragment of the hsp65 gene was amplified with primers Tb11 (5'ACCAACGATGGTGTGTCCAT) and Tb12 (5'CTTGTCGAACCGCATACCCT) as previously described, with the following minor modifications (23). A total of 5 µl of each DNA solution (50 µg/ml) was added to 45 µl of a PCR mixture containing 50 mM KCl, 20 mM Tris-HCl (pH 8.4), 1.5 mM MgCl2, 1% enhancer (Invitrogen), 200 µM each 2'-deoxynucleoside 5'-triphosphate, 1 µM each primer, and 1.25 U of Taq DNA polymerase (Promega). Amplicons were digested separately with BstEII (Promega) and HaeIII (Invitrogen), and restriction fragments were separated by electrophoresis in 2% Metaphor-1% SeaKem LE agarose gels. PRA genotypes were assigned after estimation of fragment sizes by the BioNumerics program v. 4.0 (Applied Maths). Clinical isolates of M. chelonae (F436) and M. abscessus II (F649) previously identified by PRA-ITS and PRA-hsp65, M. abscessus ATCC 19977, and M. immunogenum ATCC 700505 were used as controls. The interpretative criteria used for PRA-hsp65 were those of Leão et al. (16).
Amplicons of the hsp65 gene for sequencing reactions.
External primers hsp667FW (5'GGCCAAGACAATTGCGTACG) and hsp667RV (5'GGAGCTGACCAGCAGGATG) were used to amplify and sequence a 667-bp region containing Telenti's fragment (positions 145 to 585 of the M. tuberculosis H37Rv genome) of the hsp65 gene. A total of 5 µl of each DNA solution (50 µg/ml) was added to 45 µl of a PCR mixture containing 50 mM KCl, 20 mM Tris-HCl (pH 8.4), 1.5 mM MgCl2, 1% enhancer (Invitrogen), 200 µM each 2'-deoxynucleoside 5'-triphosphate, 1 µM each primer, and 1.25 U of Platinum Taq DNA polymerase (Invitrogen). Amplification conditions were as follows: 2 min at 95°C followed by 30 cycles of 94°C for 45 s, 57°C for 45 s, and 72°C for 45 s, with a final extension step of 72°C for 5 min (22).
Amplicons of the 16S rRNA gene.
rrs (16S rRNA) gene amplicons were obtained with primers 16S28F (5'AGAGTTTGATCATGGCTCAG) and 16S1512R (5'ACGGCTACCTTGTTACGACTT). A total of 5 µl of each DNA solution (50 µg/ml) was added to 45 µl of a PCR mixture containing 50 mM KCl, 20 mM Tris-HCl (pH 8.4), 2.5 mM MgCl2, 200 µM each 2'-deoxynucleoside 5'-triphosphate, 1 µM each primer, and 1.0 U of Platinum Taq DNA polymerase. Reaction mixtures were submitted to the following cycling conditions: 2 min at 95°C followed by 35 cycles of 94°C for 30 s, 52°C for 30 s, and 72°C for 1 min, with a final extension step of 72°C for 5 min. Amplicons were sequenced with primers 16S28F, 16S1512R, 16S800F (5'ATTAGATACCCTGGTAG), 16S1050F (5'TGTCGTCAGCTCGTG) (3), rrs264 (5'TGCACACAGGCCACAAGGGA), rrs259 (5'TTTCACGAACAACGCGACAA), and rrs244 (5'CCCACTGCTGCCTCCCGTAG) (15).
Amplicons of the sodA gene.
Amplicons of the sodA gene were obtained and sequenced with primers SodlgF (5'GAAGGAATCTCGTGGCTGAATAC) and SodlgR (5'AGTCGGCCTTGACGTTCTTGTAC). A total of 5 µl of each DNA solution (50 µg/ml) was added to 45 µl of a PCR mixture containing 50 mM KCl, 20 mM Tris-HCl (pH 8.4), 2.5 mM MgCl2, 200 µM each 2'-deoxynucleoside 5'-triphosphate, 1 µM each primer, and 1.0 U of Taq DNA polymerase (Promega). Amplification conditions were as follows: 2 min at 95°C followed by 35 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 2 min, with a final extension step of 72°C for 5 min (3).
Amplicons of the rpoB gene.
A 764-bp fragment was amplified with primers MycoF (5'GCAAGGTCACCCCGAAGGG) and MycoR (5'AGCGGCTGCTGGGTGATCATC). A total of 5 µl of each DNA solution (50 µg/ml) was added to 45 µl of a PCR mixture containing 50 mM KCl, 20 mM Tris-HCl (pH 8.4), 2.5 mM MgCl2, 200 µM each 2'-deoxynucleoside 5'-triphosphate, 1 µM each primer, and 1.0 U of Taq DNA polymerase (Promega). PCR mixtures were heated at 95°C for 1 min and then subjected to 35 cycles of denaturation at 94°C for 30s, 64°C for 30 s, and 72°C for 90 s with a final single step of 72°C for 5 min. Primers MycoseqF (5'GAAGGGTGAGACCGAGCTGAC) and MycoseqR (5'GCTGGGTGATCATCGAGTACGG) were used as internal sequencing primers (2).
Sequence determination of 16S-23S ITS, 16S rRNA, hsp65, rpoB, and sodA genes.
A partial sequence of the hsp65 gene was determined for all four outbreak isolates. For all other targets, two randomly chosen isolates (F1111 and F1112) were sequenced. Amplicons were purified with GFX PCR DNA and a Gel Band purification kit (Amersham Biosciences) and sequenced in an ABI PRISM 3100 sequencer with a BigDye Terminator cycle sequencing kit (Applied Biosystems). The sequences obtained were compared with those deposited in the GenBank database with BLAST (basic local alignment tool) (http://www.ncbi.nlm.nih.gov/BLAST) and aligned with selected sequences from ATCC strains with the BioEdit Sequence Alignment Editor, version 4.8.5 (11).
Enterobacterial repetitive intergenic consensus (ERIC) PCR.
ERIC PCR was performed with primers ERIC1R (5'TGTAAGCTCCTGGGGATTCAC) and ERIC2 (5'AAGTAAGTGACTGGGGTGAGCG) as described by Sampaio et al. (21). DNA from M. immunogenum strain ATCC 700505 was tested in the same reaction batch.
Genomic restriction endonuclease digestion and pulsed-field gel electrophoresis (PFGE).
PFGE was performed as previously described by Sampaio et al. (21). The interpretative criteria applied were those described by Tenover et al. (24).
Nucleotide sequence accession numbers.
The GenBank database accession numbers of the nucleotide sequences generated in this study are DQ288262, DQ288263, DQ288264, DQ288265, and DQ288266.
 |
RESULTS
|
|---|
Outbreak cohort.
The surgical facility, located in the urban area of the city of São Paulo, Brazil, started its practice in March 1999, and up until 7 October 2003, approximately 2,214 patients underwent LASIK there. No possible cases of keratitis were detected in this population. From 8 October to 12 November 2003, 36 patients71 eyesunderwent LASIK performed by the same surgeon at this surgical facility. Surgeries were performed in batches every 2 or 3 weeks. Among those patients, five had clinical signs of infectious keratitis. The attack rate was 7.04 per 100 eyes or 13.89 per 100 patients. The median interval from exposure to clinically apparent infection was 20 days. The 31 patients who were potentially exposed and did not show clinical signs of keratitis were recalled for a follow-up visit in the third month following surgery. None of them had clinical signs of keratitis or corneal infiltrates 3 months after surgery. Patients 1 and 2 underwent LASIK on both eyes on 8 October (Tables 1 and 2). On 28 October, patient 1 presented with a small white infiltrate on the right cornea. A sample was not collected, and the patient improved with empirical treatment based on amikacin (14 mg/ml) and clarithromycin (10 mg/ml) eye drops plus oral clarithromycin at 500 mg twice daily for 2 months. On 30 October, patient 2 presented with a small white infiltrate on the right cornea. The patient was treated with ciprofloxacin eye drops but had no clinical improvement. On 20 November, a corneal scraping was collected and sent to the laboratory for acid-fast staining and culture. The direct smear was positive, and the culture was positive for RGM. Empirical treatment based on amikacin (14 mg/ml) and clarithromycin (10 mg/ml) eye drops plus oral clarithromycin 500 mg twice daily was initiated, but clinical improvement was only achieved after corneal flap removal and maintenance with topical and systemic drugs for 3 months.
View this table:
[in this window]
[in a new window]
|
TABLE 1. Summary of epidemiological investigation of three groups of patients with M. immunogenum postoperative keratitis
|
|
Patients 3 and 4 underwent LASIK on both eyes on 29 October (Tables 1 and 2). On 20 November, patient 3 presented with photophobia and conjunctival hyperemia. He was treated with ciprofloxacin eye drops but had no clinical improvement. On 27 November, multiple white infiltrates were noted on his left cornea (Fig. 1) and corneal scrapings were collected. The direct smear was positive, and the culture was positive for RGM.

View larger version (118K):
[in this window]
[in a new window]
|
FIG.1. Biomicroscopy of the left cornea of patient 3, demonstrating multiple deep stromal white infiltrates resembling bacterial colonies.
|
|
Patient 4 presented with photophobia and conjunctival hyperemia on 18 November. On 20 November, corneal scrapings were collected and sent to the laboratory for acid-fast staining and culture. The direct smear was positive, and the culture was positive for RGM.
Patient 5 underwent LASIK on both eyes on 12 November (Tables 1 and 2). On 28 November, he presented with photophobia, pain, and conjunctival hyperemia in his left eye. Amikacin (14 mg/ml) and clarithromycin (10 mg/ml) eye drops plus oral clarithromycin were initiated. On 4 December, corneal scrapings were collected. The direct smear was positive, and the culture was positive for RGM. No cases of keratitis had occurred in this clinic before this outbreak, and no more cases of keratitis occurred after 12 November 2003. Cases of keratitis occurring in the city of São Paulo are usually referred to the Ophthalmology Department of the Federal University of São Paulo, a reference center in Brazil. Cases of infectious keratitis following LASIK caused by M. chelonae and M. abscessus have been diagnosed (10), but no cases of keratitis due to M. immunogenum have been diagnosed in São Paulo.
Sterilization procedures.
Reusable items submitted to autoclaving were the keratome and suction rings. Although quality assurance tests of the autoclave and sterilization cycles were not regularly recorded, the equipment was challenged during the outbreak investigation and was shown to sterilize Bacillus subtilis-impregnated strips submitted to the same sterilization procedure routinely used.
Environmental samples.
None of the environmental cultures grew RGM.
Phenotypic tests.
All outbreak isolates were nonpigmented, rapidly growing, acid-fast bacilli. They were unable to grow on Lowenstein-Jensen medium containing 5% sodium chloride or to utilize citrate, D-mannitol or D-sorbitol as the sole carbon source. The MICs of amikacin, tobramycin, doxycycline, ciprofloxacin, and clarithromycin were, respectively, 32 µg/ml, 16 µg/ml, >16 µg/ml, >16 µg/ml, and 2 µg/ml for all isolates.
Analysis of partial sequences and PRA-ITS and PRA-hsp65 patterns.
For all of the targets examined, sequences from outbreak isolates had 100% similarity. When partial sequences of the hsp65, 16S rRNA, sodA, and rpoB genes and ITS were compared to those available in the GenBank database, the highest similarity indices obtained were with sequences belonging to M. immunogenum (Table 3). The highest similarity index with the hsp65 gene sequence available in the GenBank database was with strain M-JY14, an environmental strain of M. immunogenum (14), followed by M. immunogenum ATCC 700505 and ATCC 700506 (Table 3). When sequences from outbreak isolates were aligned with that from M. immunogenum ATCC 700506 (GenBank accession no. AY498741), base substitutions were observed at positions 291, 292, 306, 358, 413, and 575 (M. tuberculosis H37Rv genome). Substitutions at positions 291 and 306 occurred at regions corresponding to HaeIII recognition sites in M. immunogenum ATCC 700505 or ATCC 700506, resulting in a new PRA-hsp65 pattern (Fig. 2) with 325- and 130-bp bands after BstEII digestion and 200-, 70-, 58-, and 55-bp bands after HaeIII digestion. Type strain M. immunogenum ATCC 700505 had a PRA-hsp65 pattern with 325- and 130-bp bands after BstEII digestion and 145-, 70-, 58-, and 55-bp bands after HaeIII digestion (Fig. 3).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 2. Alignment of hsp65 gene partial sequences from species belonging to the M. chelonae-M. abscessus group and M. immunogenum outbreak isolate F1112. Gray boxes correspond to restriction sites recognized by the HaeIII endonuclease. Note that substitutions at positions 291 and 306 (M. tuberculosis H37Rv genome) in isolate F1112 resulted in loss of restriction sites.
|
|

View larger version (116K):
[in this window]
[in a new window]
|
FIG. 3. PRA-hsp65 patterns after BstEII (lanes 1 to 6) or HaeIII (lanes 7 to 12) digestion. Lanes: 1 and 7, M. abscessus I ATCC 19977; 2 and 8, M. abscessus II strain F649; 3 and 9, M. chelonae strain F436; 4 and 10, M. immunogenum ATCC 700505; 5 and 11, M. immunogenum outbreak isolate F1111; 6 and 12, M. immunogenum outbreak isolate F1112.
|
|
When the partial ITS sequence from isolate F1112 was aligned with that of M. immunogenum ATCC 700505 and ATCC 700506 (accession no. AY497531 and AY593977, respectively), 10 base substitutions, three insertions, and one deletion were observed. Substitutions at positions 28 and 105 (M. tuberculosis H37Rv genome) resulted in recognition sites for HhaI. A deletion at position 114 and a substitution at position 115 resulted in loss of a restriction site recognized by TaqI, while a substitution at position 153 resulted in a recognition site for this restriction endonuclease, resulting in a new PRA-ITS pattern (Fig. 4). Outbreak isolates had an ITS pattern with an amplicon of 269 bp, no restriction with HaeIII (data not shown), 157-, 71-, and 41-bp fragments after HhaI digestion, and 157- and 112-bp fragments after restriction with TaqI. Type strain M. immunogenum ATCC 700505 had an amplicon of 267 bp, no restriction with HaeIII or HhaI, and 148- and 119-bp fragments after restriction with TaqI (Fig. 5).

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 4. Alignment of partial ITS sequences from species belonging to the M. chelonae-M. abscessus group, including three M. chelonae genotypes, and M. immunogenum outbreak isolate F1112. Gray boxes and white boxes correspond to restriction sites recognized by the HhaI and TaqI endonucleases, respectively. Note that in the sequence corresponding to isolate F1112, substitutions at positions 28 and 105 (M. tuberculosis H37Rv genome) resulted in restriction sites recognized by HhaI; a deletion at position 114, an insertion at position 117, and a substitution at position 153 resulted, respectively, in loss and gain of restriction sites recognized by TaqI. The "M. bolletii" ITS sequence was not included since it is not yet available in the GenBank database.
|
|

View larger version (77K):
[in this window]
[in a new window]
|
FIG. 5. PRA-ITS patterns after HaeIII (lanes 1 to 5), HhaI (lanes 6 to 10), or TaqI (lanes 11 to 15) digestion. Lanes: 1, 6, and 11, M. abscessus ATCC 19977; 2, 7, and 12, M. chelonae ITS genotype II strain F436; 3, 8, and 13, M. immunogenum ATCC 700505; 4, 9, and 14, outbreak isolate F1111; 5, 10, and 15, outbreak isolate F1112. Note that there are no restriction fragments after HaeIII digestion in any of the isolates or strains (lanes 1 to 5) and no restriction fragments after HhaI digestion in M. abscessus, M. chelonae, or M. immunogenum ATCC 700505 (lanes 6 to 8).
|
|
Partial sequences of the 16S rRNA gene from outbreak isolates F1111 and F1112 gave evidence of a single substitution at position 183 (M. tuberculosis H37Rv genome) compared to that of M. immunogenum ATCC 700505 (results not shown). When partial sequences of the sodA gene from outbreak isolates F1111 and F1112 were aligned with that from the type strain, substitutions were observed at positions 33, 81, 129, 201, 378, 438, and 451 (M. tuberculosis H37Rv genome). In comparing partial sequences of the rpoB gene from outbreak isolates F1111 and F1112 to that from the M. immunogenum type strain (GenBank accession no. AY262739), base substitutions at positions 2538, 2544, 2883, and 3073 and deletions at positions 2823 to 2831 were observed (M. tuberculosis H37Rv genome) (results not shown).
PFGE and ERIC-PCR.
Outbreak isolates were undistinguishable by PFGE and ERIC-PCR, while the ERIC-PCR profile obtained with M. immunogenum ATCC 700505 was different from those obtained with outbreak isolates (Fig. 6).

View larger version (112K):
[in this window]
[in a new window]
|
FIG. 6. (A) PFGE pattern of DraI digests of chromosomal DNA. Lanes: 1 and 6, lambda DNA standards (New England Biolabs); 2, 3, 4, and 5, outbreak isolates F1111, F1112, F1113, and F1114, respectively. (B) Electrophoretic patterns obtained by ERIC-PCR. Lanes: 1 and 7, DNA digested with HindIII (Invitrogen) plus  174 replicative-form DNA digested with HaeIII (Invitrogen); 2, F1111; 3, F1112; 4, F1113; 5, F1114; 6, M. immunogenum ATCC 700505.
|
|
 |
DISCUSSION
|
|---|
Although infectious keratitis is a rare complication of LASIK, RGM are the most frequent bacterial agents isolated in such cases (13). This is the third reported outbreak of keratitis caused by RGM following LASIK in Brazil (5, 10), adding to the growing list of 25 cases and outbreaks of these infections which have been published and indexed in PubMed since the first description in 1998 (19). In this outbreak, the source of contamination was not identified. Failure to isolate M. chelonae-M. abscessus group species from environmental samples may be due to insufficient sample volume or to collection of environmental samples after the operating room was thoroughly cleaned. Outbreak isolates were initially evaluated by PRA-hsp65 and shown to have a pattern similar to that of M. chelonae. The high MIC of tobramycin (16 µg/ml) and the inability to use citrate as the sole carbon source were inconsistent with M. chelonae, which prompted us to perform additional identification tests.
Identification of mycobacteria by gene sequencing has been mostly based on the hsp65 and 16S rRNA genes (25). The finding of similarity indices of 98.35% and 99.93%, respectively, with partial sequences of the hsp65 and 16S rRNA genes from M. immunogenum type strain ATCC 700505 would be enough to confirm species identification, since McNabb et al. (18) demonstrated that when comparing hsp65 sequences, a correct species identification can be confidently made when the similarity index is
97%. The recent description of "M. massiliense" and "M. bolletii," in which hsp65 partial sequences are shown to have 99.32% to 100% similarity indices compared to each other or to M. abscessus type II (GenBank accession no. AY859675, AY596465, and AY603554), indicates that the maximum similarity index of 98.35% obtained when comparing hsp65 partial sequences from outbreak isolates to those available in the GenBank database is not enough to confirm identification of the species as M. immunogenum.
Drancourt and Raoult (8) have proposed that when analyzing rRNA gene sequences, a match of 99.5% or more would represent intraspecies variability. This criterion may even be used to differentiate M. abscessus, M. chelonae, and M. immunogenum from each other since similarity indices vary from 99.32% to 99.39% when sequences longer than 1,480 bp are compared. In contrast to that proposal, 16S rRNA gene sequences of M. abscessus, "M. massiliense," and "M. bolletii" have a 100% similarity index (GenBank accession no. AY593980, AY457071, and AY859681).
Partial sodA sequences from outbreak isolates had a match of 98.32% with those from M. immunogenum, which supports this species identification, in accordance with Adékambi and Drancourt (3), who found 98% to 100% similarity indices when partial sodA sequences from the same species were compared. Exceptions are the recently proposed species "M. massiliense" and "M. bolletii," in which the sodA sequences have matches of 98.64% and 98.41% (GenBank accession no. AY498743, AY862403, and AY596465) with that from M. abscessus ATCC 19977, respectively.
The analysis of a 651-bp region from the rpoB gene from outbreak isolates (Table 3) showed a 99.38% match with M. immunogenum ATCC 700505, an index higher than 98.3%, the minimal value obtained by Adékambi et al. (2) when comparing isolates of the same species. This region also has enough polymorphism to discriminate "M. massiliense" and "M. bolletii" from other species belonging to the M. chelonae-M. abscessus group, since their similarity indices vary from 93% to 98.08% (GenBank accession no. AY147164, AY147163, AY262739, AY859692, and AY593981).
Although there is not a consensus for a cutoff for species identification when analyzing ITS partial sequences, the highest match (95.53%) for outbreak isolate F1112 was with M. immunogenum ATCC 700505, a value above the maximum match (94%) obtained when comparing ITS sequences from different species belonging to the M. chelonae-M. abscessus group (GenBank accession no. AJ314870, AJ314875, AJ291582, AJ291583, AJ291584, AY593978, and AY497531). The phenotypic and genotypic characteristics described here for outbreak isolates are concordant, and we propose that they are a variant of M. immunogenum. Outbreak isolates had indistinguishable PFGE profiles, indicating that they have the same clonal origin. This also suggests a common source of infection for all patients. ERIC-PCR grouped outbreak isolates into a single cluster and differentiated them from type strain M. immunogenum ATCC 700505. The discriminatory power of PFGE has not been determined for this species, although Wallace et al. (28) analyzed 15 epidemiologically unrelated clinical isolates and demonstrated that they were correctly classified as unrelated by PFGE according to the criteria of Tenover et al. (24). This outbreak was caused by a single clone of a variant of M. immunogenum, and to our knowledge this is the first report of an outbreak where this species was isolated from infected tissue.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Maria Jesus Garcia for providing genomic DNA from M. immunogenum strain ATCC 700505, Maria Cecilia Zorat Yu for storing M. immunogenum outbreak isolates, and Luciano Morales and Edson de Paula Bispo for editing the images.
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: Universidade Federal de São PauloEscola Paulista de Medicina, Departamento de Microbiologia, Imunologia e Parasitologia, Rua Botucatu, 8623° andar, 04023-062 São Paulo, Brazil. Phone: 55 11 50147730. Fax: 55 11 50147601. E-mail: sampaio{at}ecb.epm.br. 
 |
REFERENCES
|
|---|
- Adékambi, T., P. Berger, D. Raoult, and M. Drancourt. 2006. rpoB gene sequence-based characterization of emerging non-tuberculous mycobacteria with descriptions of Mycobacterium bolletii sp. nov., Mycobacterium phocaicum sp. nov. and Mycobacterium aubagnense sp. nov. Int. J. Syst. Evol. Microbiol. 56:133-143.[Abstract/Free Full Text]
- Adékambi, T., P. Colson, and M. Drancourt. 2003. rpoB-based identification of nonpigmented and late-pigmenting rapidly growing mycobacteria. J. Clin. Microbiol. 41:5699-5708.[Abstract/Free Full Text]
- Adékambi, T., and M. Drancourt. 2004. Dissection of phylogenetic relationships among 19 rapidly growing Mycobacterium species by 16S rRNA, hsp65, sodA, recA and rpoB gene sequencing. Int. J. Syst. Evol. Microbiol. 54:2095-2105.[Abstract/Free Full Text]
- Adékambi, T., M. Reynaud-Gaubert, G. Greub, M. J. Gevaudan, B. La Scola, D. Raoult, and M. Drancourt. 2004. Amoebal coculture of "Mycobacterium massiliense" sp. nov. from the sputum of a patient with hemoptoic pneumonia. J. Clin. Microbiol. 42:5493-5501.[Abstract/Free Full Text]
- Alvarenga, L., D. Freitas, A. L. Hofling-Lima, R. Belfort, Jr., J. Sampaio, L. Sousa, M. Yu, and M. Mannis. 2002. Infectious post-LASIK crystalline keratopathy caused by nontuberculous mycobacteria. Cornea 21:426-429.[CrossRef][Medline]
- Chapin, K. C., and T. Lauderdale. 2003. Reagents, stains, and media: bacteriology, p. 354-383. In P. R. Murray, E. J. Baron, J. H. Jorgensen, M. A. Pfaller, and R. H. Yolken (ed.), Manual of clinical microbiology, 8th ed., vol. 1. ASM Press, Washington, D.C.
- CLSI. 2003. Susceptibility testing of mycobacteria, nocardiae, and other aerobic actinomycetes; approved standard. CLSI (NCCLS) document M24-A. CLSI, Wayne, Pa.
- Drancourt, M., and D. Raoult. 2005. Sequence-based identification of new bacteria: a proposition for creation of an orphan bacterium repository. J. Clin. Microbiol. 43:4311-4315.[Free Full Text]
- Fischeder, R., R. Schulze-Robbecke, and A. Weber. 1991. Occurrence of mycobacteria in drinking water samples. Zentbl. Hyg. Umweltmed. 192:154-158.
- Freitas, D., L. Alvarenga, J. Sampaio, M. Mannis, E. Sato, L. Sousa, L. Vieira, M. C. Yu, M. C. Martins, A. Hoffling-Lima, and R. Belfort, Jr. 2003. An outbreak of Mycobacterium chelonae infection after LASIK. Ophthalmology 110:276-285.[CrossRef][Medline]
- Hall, T. A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41:95-98.
- Inman, P. M., A. Beck, A. E. Brown, and J. L. Stanford. 1969. Outbreak of injection abscesses due to Mycobacterium abscessus. Arch. Dermatol. 100:141-147.[CrossRef][Medline]
- John, T., and E. Velotta. 2005. Nontuberculous (atypical) mycobacterial keratitis after LASIK: current status and clinical implications. Cornea 24:245-255.[CrossRef][Medline]
- Khan, I. U. H., S. B. Selvaraju, and J. S. Yadav. 2005. Occurrence and characterization of multiple novel genotypes of Mycobacterium immunogenum and Mycobacterium chelonae in metalworking fluids. FEMS Microbiol. Ecol. 54:329-338.[Medline]
- Kirschner, P., B. Springer, U. Vogel, A. Meier, A. Wrede, M. Kiekenbeck, F. C. Bange, and E. C. Bottger. 1993. Genotypic identification of mycobacteria by nucleic acid sequence determination: report of a 2-year experience in a clinical laboratory. J. Clin. Microbiol. 31:2882-2889.[Abstract/Free Full Text]
- Leão, S. C., A. Martin, G. I. Mejia, J. C. Palomino, J. Robledo, M. A. S. Telles, and F. Portaels. 2004. Practical handbook for the phenotypic and genotypic identification of mycobacteria. Vanden Broele, Brugges, Belgium.
- Maloney, S., S. Welbel, B. Daves, K. Adams, S. Becker, L. Bland, M. Arduino, R. Wallace, Jr., Y. Zhang, G. Buck, et al. 1994. Mycobacterium abscessus pseudoinfection traced to an automated endoscope washer: utility of epidemiologic and laboratory investigation. J. Infect. Dis. 169:1166-1169.[Medline]
- McNabb, A., D. Eisler, K. Adie, M. Amos, M. Rodrigues, G. Stephens, W. A. Black, and J. Isaac-Renton. 2004. Assessment of partial sequencing of the 65-kilodalton heat shock protein gene (hsp65) for routine identification of Mycobacterium species isolated from clinical sources. J. Clin. Microbiol. 42:3000-3011.[Abstract/Free Full Text]
- Reviglio, V., M. L. Rodriguez, G. S. Picotti, M. Paradello, J. D. Luna, and C. P. Juarez. 1998. Mycobacterium chelonae keratitis following laser in situ keratomileusis. J. Refract. Surg. 14:357-360.[Medline]
- Roth, A., U. Reischl, A. Streubel, L. Naumann, R. M. Kroppenstedt, M. Habicht, M. Fischer, and H. Mauch. 2000. Novel diagnostic algorithm for identification of mycobacteria using genus-specific amplification of the 16S-23S rRNA gene spacer and restriction endonucleases. J. Clin. Microbiol. 38:1094-1104.[Abstract/Free Full Text]
- Sampaio, J. L., C. Viana-Niero, D. de Freitas, A. L. Hofling-Lima, and S. C. Leao. 2006. Enterobacterial repetitive intergenic consensus PCR is a useful tool for typing Mycobacterium chelonae and Mycobacterium abscessus isolates. Diagn. Microbiol. Infect. Dis. 55:107-118.[CrossRef][Medline]
- Selvaraju, S. B., I. U. Khan, and J. S. Yadav. 2005. A new method for species identification and differentiation of Mycobacterium chelonae complex based on amplified hsp65 restriction analysis (AHSPRA). Mol. Cell. Probes 19:93-99.[CrossRef][Medline]
- Telenti, A., F. Marchesi, M. Balz, F. Bally, E. C. Bottger, and T. Bodmer. 1993. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis. J. Clin. Microbiol. 31:175-178.[Abstract/Free Full Text]
- Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H. Persing, and B. Swaminathan. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33:2233-2239.[Medline]
- Tortoli, E. 2003. Impact of genotypic studies on mycobacterial taxonomy: the new mycobacteria of the 1990s. Clin. Microbiol. Rev. 16:319-354.[Abstract/Free Full Text]
- Reference deleted.
- Vincent, V., B. A. Brown-Elliott, K. C. J. Jost, and R. J. J. Wallace. 2003. Mycobacterium: phenotypic and genotypic identification, p. 560-584. In P. R. Murray, E. J. Baron, J. H. Jorgensen, M. A. Pfaller, and R. H. Yolken (ed.), Manual of clinical microbiology, 8th ed., vol. 1. ASM Press, Washington, D.C.
- Wallace, R. J., Jr., Y. Zhang, R. W. Wilson, L. Mann, and H. Rossmoore. 2002. Presence of a single genotype of the newly described species Mycobacterium immunogenum in industrial metalworking fluids associated with hypersensitivity pneumonitis. Appl. Environ. Microbiol. 68:5580-5584.[Abstract/Free Full Text]
- Wallace, R. J., Jr. 1987. Nontuberculous mycobacteria and water: a love affair with increasing clinical importance. Infect. Dis. Clin. N. Am. 1:677-686.[Medline]
- Wallace, R. J., Jr., B. A. Brown, and D. E. Griffith. 1998. Nosocomial outbreaks/pseudo-outbreaks caused by nontuberculous mycobacteria. Annu. Rev. Microbiol. 52:453-490.[CrossRef][Medline]
- Wilson, R. W., V. A. Steingrube, E. C. Bottger, B. Springer, B. A. Brown-Elliott, V. Vincent, K. C. Jost, Jr., Y. Zhang, M. J. Garcia, S. H. Chiu, G. O. Onyi, H. Rossmoore, D. R. Nash, and R. J. Wallace, Jr. 2001. Mycobacterium immunogenum sp. nov., a novel species related to Mycobacterium abscessus and associated with clinical disease, pseudo-outbreaks and contaminated metalworking fluids: an international cooperative study on mycobacterial taxonomy. Int. J. Syst. Evol. Microbiol. 51:1751-1764.[Abstract]
Journal of Clinical Microbiology, September 2006, p. 3201-3207, Vol. 44, No. 9
0095-1137/06/$08.00+0 doi:10.1128/JCM.00656-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Viana-Niero, C., Lima, K. V. B., Lopes, M. L., da Silva Rabello, M. C., Marsola, L. R., Brilhante, V. C. R., Durham, A. M., Leao, S. C.
(2008). Molecular Characterization of Mycobacterium massiliense and Mycobacterium bolletii in Isolates Collected from Outbreaks of Infections after Laparoscopic Surgeries and Cosmetic Procedures. J. Clin. Microbiol.
46: 850-855
[Abstract]
[Full Text]