Author's Correction for Hui et al., J. Clin. Microbiol. 44 (8) 2983-2987.
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hui, C.-K.
Right arrow Articles by Lau, G. K. K.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Hui, C.-K.
Right arrow Articles by Lau, G. K. K.

 Previous Article

Journal of Clinical Microbiology, January 2007, p. 278, Vol. 45, No. 1
0095-1137/07/$08.00+0     doi:10.1128/JCM.01830-06

AUTHOR'S CORRECTION

Comparison of Real-Time PCR Assays for Monitoring Serum Hepatitis B Virus DNA Levels during Antiretroviral Therapy

Chee-Kin Hui, Scott Bowden, Hai-Ying Zhang, Anita Wong, Sharon Lewin, Frank Rousseau, Herve Mommeja-Marin, Nikki P. Lee, John M. Luk, Stephen Locarnini, Nancy Leung, Nikolai V. Naoumov, and George K. K. Lau

Department of Medicine, The University of Hong Kong, Hong Kong SAR, China; Centre for the Study of Liver Diseases, The University of Hong Kong, Hong Kong SAR, China; Research Centre for Infection and Immunity, The University of Hong Kong, Hong Kong SAR, China; Victorian Infectious Diseases Reference Laboratory, North Melbourne, Victoria, Australia; Clinical Trials Centre, The University of Hong Kong, Hong Kong SAR, China; Victorian Infectious Diseases Service, The Royal Melbourne Hospital, Parkville, Victoria, Australia; Department of Microbiology and Immunology, The University of Melbourne, Parkville, Victoria, Australia; Gilead Sciences Inc., Durham, North Carolina; Department of Surgery, The University of Hong Kong, Hong Kong SAR, China; Department of Medicine, AHML Nethersole Hospital, Hong Kong SAR, China; and Institute of Hepatology, University College London, London, United Kingdom

Volume 44, no. 8, p. 2983-2987, 2006. Pages 2983 to 2987: "Molecular Beacons assay" should read "in-house assay" throughout.

Page 2983, column 2. Lines 1 to 5 should read as follows. "... A prototype assay was also developed by Abbott Laboratories (Abbott Park, IL), but the product was never commercialized (1). One commercial assay that has been developed is the RealART HBV LC PCR kit (Artus GmbH, Hamburg, Germany). An in-house real-time PCR assay has also been developed (10a, 17a). In this study, we evaluated the performance characteristics of the RealART HBV LC PCR kit and the in-house assay and compared them..."

Page 2984, column 1. Lines 40 to 56 should read as follows. "Molecular beacon analysis. HBV viral loads were determined using real-time PCR as previously described (10a). The primers and molecular beacon probe sequences were selected from conserved regions within the precore domain of the HBV genome. Standard curves were generated using 10-fold serial dilutions (1.3 x 107 to 1.3 x 101) of a pBlueBac plasmid ligated with a supergenomic length of HBV DNA. Real-time PCR was performed in 50 µl total volume containing 0.5x TaqMan buffer A (Applied Biosystems), 0.5x TaqMan Buffer II, 3.0 mM MgCl2, 1.25 U AmpliTaq Gold, 0.4 pmol/ml of HBV-specific beacon TW5 (CGC[GTCCTACTGTTCAAGCCTCCAAGCTGTG]A[C]GCG), 0.4 pmol/ml of forward primer PC1 (5'-GGGAGGAGATTAGGTTAA-3'), 0.4 pmol/ml of reverse primer PC2 (5'-GGCAAAAACGAGAGTAACTC-3') and 5 µl of either patient DNA or plasmid standard. PCR conditions were 95°C for 10 min followed by 45 cycles of 94°C for 15 s, 50°C for 30 s, and 72°C for 30 s."

Page 2984, column 2, line 6: "(1)" should read "(1a)."

Page 2986, column 1, line 32: "(1)" should read "(1a)."

Page 2986: Reference 1 should be reference 1a.

Page 2986: The following reference was inadvertently omitted.

Page 2987: The following references were inadvertently omitted.

1. Abravaya, K., J. Huff, R. Marshall, B. Merchant, C. Mullen, G. Schneider, and J. Robinson. 2003. Molecular beacons as diagnostic tools: technology and applications. Clin. Chem. Lab. Med. 41:468-474.
10a. Lewin, S. R., R. M. Ribeiro, T. Walters, G. K. Lau, S. Bowden, S. Locarnini, and A. S. Perelson. 2001. Analysis of hepatitis B viral load decline under potent therapy: complex decay profiles observed. Hepatology 34:1012-1020.
17a. Wightman, F., T. Walters, A. Ayres, S. Bowden, A. Bartholomeusz, D. Lau, S. Locarnini, and S. R. Lewin. 2004. Comparison of sequence analysis and a novel discriminatory real-time PCR assay for detection and quantification of lamivudine-resistant hepatitis B virus strains. J. Clin. Microbiol. 42:3809-3812.

Journal of Clinical Microbiology, January 2007, p. 278, Vol. 45, No. 1
0095-1137/07/$08.00+0     doi:10.1128/JCM.01830-06





This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hui, C.-K.
Right arrow Articles by Lau, G. K. K.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Hui, C.-K.
Right arrow Articles by Lau, G. K. K.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»